Open Access

Complete sequence determination of a novel reptile iridovirus isolated from soft-shelled turtle and evolutionary analysis of Iridoviridae

  • Youhua Huang1,
  • Xiaohong Huang2,
  • Hong Liu3,
  • Jie Gong1,
  • Zhengliang Ouyang1,
  • Huachun Cui1,
  • Jianhao Cao1,
  • Yingtao Zhao4,
  • Xiujie Wang4,
  • Yulin Jiang3Email author and
  • Qiwei Qin2Email author
Contributed equally
BMC Genomics200910:224

DOI: 10.1186/1471-2164-10-224

Received: 18 November 2008

Accepted: 14 May 2009

Published: 14 May 2009

Abstract

Background

Soft-shelled turtle iridovirus (STIV) is the causative agent of severe systemic diseases in cultured soft-shelled turtles (Trionyx sinensis). To our knowledge, the only molecular information available on STIV mainly concerns the highly conserved STIV major capsid protein. The complete sequence of the STIV genome is not yet available. Therefore, determining the genome sequence of STIV and providing a detailed bioinformatic analysis of its genome content and evolution status will facilitate further understanding of the taxonomic elements of STIV and the molecular mechanisms of reptile iridovirus pathogenesis.

Results

We determined the complete nucleotide sequence of the STIV genome using 454 Life Science sequencing technology. The STIV genome is 105 890 bp in length with a base composition of 55.1% G+C. Computer assisted analysis revealed that the STIV genome contains 105 potential open reading frames (ORFs), which encode polypeptides ranging from 40 to 1,294 amino acids and 20 microRNA candidates. Among the putative proteins, 20 share homology with the ancestral proteins of the nuclear and cytoplasmic large DNA viruses (NCLDVs). Comparative genomic analysis showed that STIV has the highest degree of sequence conservation and a colinear arrangement of genes with frog virus 3 (FV3), followed by Tiger frog virus (TFV), Ambystoma tigrinum virus (ATV), Singapore grouper iridovirus (SGIV), Grouper iridovirus (GIV) and other iridovirus isolates. Phylogenetic analysis based on conserved core genes and complete genome sequence of STIV with other virus genomes was performed. Moreover, analysis of the gene gain-and-loss events in the family Iridoviridae suggested that the genes encoded by iridoviruses have evolved for favoring adaptation to different natural host species.

Conclusion

This study has provided the complete genome sequence of STIV. Phylogenetic analysis suggested that STIV and FV3 are strains of the same viral species belonging to the Ranavirus genus in the Iridoviridae family. Given virus-host co-evolution and the phylogenetic relationship among vertebrates from fish to reptiles, we propose that iridovirus might transmit between reptiles and amphibians and that STIV and FV3 are strains of the same viral species in the Ranavirus genus.

Background

Iridoviruses are nuclear and cytoplasmic large DNA viruses (NCLDVs), which infect invertebrates and poikilothermic vertebrates, such as insects, fish, amphibians and reptiles, crustaceans and mollusks [1]. The serious systemic diseases caused by some members of the Iridoviridae family have made an important impact on modern aquaculture and wildlife conservation. The current members of the family Iridoviridae can be divided into five genera: Ranavirus, Lymphocystivirus, Megalocytivirus, Iridovirus and Chloriridovirus [2]. Typical characteristics of all iridoviruses include the icosahedral viral particles (~120 to 300 nm) present in the cytoplasm; also, the iridovirus genomes are circularly permuted and terminally redundant [3, 4]. At present 13 iridovirus agents isolated from amphibians, fish and insects have been sequenced completely. These include Lymphocystis disease virus 1 (LCDV-1, genus Lymphocystivirus), Chilo iridescent virus (CIV, genus Iridovirus), Tiger frog virus (TFV, genus Ranavirus), infectious spleen and kidney necrosis virus (ISKNV, genus Megalocytivirus), Singapore grouper iridovirus (SGIV, genus Ranavirus), Frog virus 3 (FV3, genus Ranavirus), Lymphocystis disease virus China (LCDV-C, genus Lymphocystivirus), Grouper iridovirus (GIV, genus Ranavirus), Ambystoma tigrinum virus (ATV, genus Ranavirus), Rock bream iridovirus (RBIV, genus Megalocytiviru s), Red sea bream iridovirus (RSIV, genus Megalocytiviru s), Orange-spotted grouper iridovirus (OSGIV, genus Megalocytivirus) and Invertebrate iridescent virus 3 (IIV-3, Chloriridovirus) [5, 6].

Soft-shelled turtle iridovirus (STIV), the causative agent of a novel viral disease called 'red neck disease' in the farmed soft-shelled turtle (Trionyx sinensis) in China was first reported in 1998 [7]. The virus could be propagated in several fish cell lines and caused an obvious cytopathogenic effect (CPE). To our knowledge, although several iridovirus-like agents from reptiles such as turtles have been isolated, no genomic information on a reptile iridovirus has been reported [811]. To facilitate understanding of the molecular mechanism of reptile iridovirus pathogenesis, we determined the complete genomic sequence of STIV and compared its genome structure with other sequenced iridoviruses to help determine its taxonomic position and evolutionary status.

Results and discussion

Features of the STIV genome

The determination of the STIV complete genome sequence was carried out by 454 Life Sciences Technology as described [12]. About 2.1 million bp were sequenced, covering nearly 20-fold of the STIV genome sequence. The individual sequences were assembled into a continuous sequence using GS De Novo Assembler software (Roche). The results indicated that the complete STIV genome consists of 105 890 bp with 98.5% identity to the complete FV3 genome. The G+C content of STIV is 55.1% (Figure 1). Computer assisted analysis revealed 105 potential open reading frames (ORFs), which encode polypeptides ranging from 40 to 1,294 amino acids. The locations, orientations, sizes and BLASTP results for the putative ORFs are shown in Table 1. Forty-two individual putative gene products showed significant homology to functionally characterized proteins of other species. Forty-nine ORFs with unknown function have orthologs in other sequenced iridovirus genomes and 14 ORFs share no homology with other iridovirus genes. Seven ORFs (003L, 019R, 022L, 026L, 036L, 080R and 081R) that partially overlapped with others are not annotated as ORFs in the FV3 genome. The other seven ORFs (023R, 033R, 039R, 069L, 078R, 101L and 105R) have corresponding orthologs in the FV3 genome, but their annotations were missed in analysis [13]. The reconstructed common ancestor of the NCLDVs had at least 41 genes [14], whereas in the STIV genome only 20 putative protein products shared homology with the ancestral proteins of NCLDVs, including proteins involved in viral DNA replication, transcription, virion packaging and morphogenesis (see Additional File 1). In addition, a few noncoding regions were identified in the STIV genome and this feature is similar to FV3. In these regions, 20 microRNAs were predicted and are described in detail below.
Table 1

Properties of ORFs within the STIV genome

     

Best Match homolog

 

ORF

Nucleotide position

No. of amino acids

Molecular mass

(kDa)

Conserved domain or signature (CD/Prosite accession no.)

E-value

Identity

(%)

Accession no.

Species

Predicted structure or function

001R

16–786

256

29.67

Poxvirus Late Transcription Factor (pfam04947)

1e-148

99

YP_031579

FV3

putative replicating factor

002L

2385-1414

323

35.01

DUF230, Poxvirus proteins of unknown function (pfam03003)

2e-157

97

YP_031580|

FV3

Virion-associated membrane protein

003La

2668-2423

81

8.82

      

004L

3261-2563

232

25.74

 

1e-90

99

YP_003773

ATV

 

005R

3191–4507

438

48.29

 

0.0

98

YP_031581

FV3

 

006R

4547–4729

60

6.51

 

1e-18

100

YP_031582

FV3

 

007R

5162–5818

218

24.82

US22, herpes virus early nuclear protein (pfam02393)

3e-100

92

YP_031583

FV3

orf250-like protein

008R

6008-5757

83

9.69

 

2e-37

100

YP_031584

FV3

 

009L

7177-6769

142

15.18

 

8e-55

91

ABB92275

TFV

 

010R

7277–11161

1294

140.99

DNA-directed RNA polymerase subunit alpha (PRK08566,)

0.0

99

YP_031586

FV3

DNA-dependent RNA polymerase II large subunit

011L

14356-11510

948

106.45

Helicase conserved C-terminal domain (pfam00271)

0.0

99

YP_031586

FV3

D6/D11 like helicase

012R

14372–14785

137

14.88

 

2e-70

100

YP_031588

FV3

 

013R

15135–15347

70

7.88

 

5e-24

98

YP_031589

FV3

 

014L

16306-15413

297

32.66

 

7e-146

99

YP_031590

FV3

 

015R

17072–17428

118

13.31

 

6e-44

99

YP_031592

FV3

 

016R

17524–18471

315

35.37

ABC_ATPase, Poxvirus A32 protein (pfam04665, cd00267)

0.0

98

AAL77796

TFV

A32 virion packaging ATPase

017L

19770-18835

311

34.00

 

5e-157

95

YP_003857

ATV

 

018L

21315-19807

502

53.47

 

0.0

99

YP_031595

FV3

 

019Ra

20090–20869

259

28.11

      

020L

21591-21352

79

8.35

 

3e-28

98

YP_031596

FV3

 

021R

21643–24240

865

94.42

2-cysteine adaptor domain(pfam08793)

0.0

92

ABB92284

TFV

 

022La

22859-22326

177

18.78

      

023R

24251–24697

148

16.03

 

5e-60

92

ABB92285

TFV

 

024L

25593-24934

219

25.37

 

8e-112

98

YP_031599

FV3

 

025R

25723-28650

975

108.95

D5 N terminal like (pfam08706)

0.0

99

YP_031600

FV3

putative D5 family NTPase/ATPase

026La

28049-27423

208

21.58

 

9e-40

75

YP_164148

SGIV

 

027R

29058–30206

382

42.61

 

0.0

97

YP_031601

FV3

 

028R

30604–31701

365

41.04

 

0.0

98

YP_031602

FV3

 

029R

31895–32680

261

39.50

 

2e-128

100

YP_031603

FV3

P31k protein

030R

32858–33034

58

6.07

 

2e-23

90

AAD38359

FV3

truncated putative eIF-2alpha-like protein

031R

33565–36477

970

107.18

Putative lipopolysaccharide modifying enzyme (smart00672)

0.0

98

YP_031605

FV3

tyrosine kinase

032R

36526–37014

162

18.21

 

2e-89

99

YP_031606

FV3

 

033R

37151–37411

86

9.44

      

034R

37905-38324

139

15.15

 

2e-72

98

ABB92294

TFV

 

035R

38374–40308

644

71.50

Rho termination factor (pfam07498)

0.0

86

ABB92295

TFV

neurofilament triplet H1 like protein

036La

39047-38472

191

20.01

      

037R

40391–40582

63

6.64

 

1e-14

98

YP_031611

FV3

 

038R

40726–41046

106

11.39

 

6e-50

99

YP_031612

FV3

L-protein-like protein

039R

41140–41460

106

10.20

      

040R

41515–41790

91

9.14

      

041R

42588–43229

213

23.62

catalytic domain of ctd-like phosphatases (smart00577)

3e-109

99

YP_031615

FV3

putative NIF/NLI interacting factor

042R

43370–45067

565

62.28

ribonucleotide-diphosphate reductase subunit alpha (PRK09102)

0.0

99

YP_031616

FV3

ribonucleoside diphosphate reductase alpha subunit

043R

45173–45523

116

12.72

 

3e-41

98

YP_031617

FV3

putative hydrolase

044R

45592–46095

167

18.05

 

4e-64

88

YP_031618

FV3

 

045R

46477–49974

1165

129.13

 

0.0

99

YP_031619

FV3

orf2-like protein

046L

50766-50509

85

9.36

 

3e-30

100

YP_031620

FV3

 

047L

51634-51308

108

12.02

 

1e-44

96

YP_003844

ATV

 

048L

52171-51761

136

15.55

 

2e-72

100

YP_031623

FV3

 

049L

52803-52225

192

21.62

translation initiation factor IF-2 (PRK05306)

2e-35

77

YP_003846

ATV

neurofilament triplet H1 protein

050L

53344-52928

138

15.54

 

3e-66

100

YP_031625

FV3

 

051L

53598-53347

83

9.56

 

8e-35

100

YP_031626

FV3

 

052L

55205-53706

499

55.48

SAP domain (pfam02037)

2e-149

78

YP_003850

ATV

 

053R

55285–56970

561

61.62

 

0.0

99

YP_031629

FV3

 

054L

58294-57227

355

39.35

3-beta hydroxysteroid dehydrogenase(pfam01073)

0.0

100

ABI36881

RGV

3beta-hydroxysteroid dehydrogenase

055R

58633–60201

522

54.73

L1R_F9L, Lipid membrane protein of large eukaryotic DNA viruses (pfam02442)

0.0

100

YP_031631

FV3

myristylated membrane protein

056L

60755-60435

106

11.50

      

057L

61963-60668

431

47.29

DEXH-box helicases (cd00269)

0.0

99

YP_031633

FV3

A18 like helicase

058L

62120-61971

49

5.19

 

2e-09

93

YP_003822

ATV

 

059R

62157–62561

134

15.23

 

6e-66

97

ABB92316

TFV

 

060R

62602–64098

498

53.60

 

0.0

98

YP_031636

FV3

putative phosphotransferase

061R

64549–65103

184

20.49

 

3e-92

97

ABB92319

TFV

 

062L

66787-65729

352

40.04

 

0.0

98

YP_031638

FV3

 

063R

66947–69988

1013

114.52

DNA polymerase family B (pfam00136)

0.0

99

YP_031639

FV3

DNA polymerase

064L

74278-70613

1221

133.21

RNA polymerase beta subunit (cd00653)

0.0

99

YP_031641

FV3

DNA-dependent RNA polymerase II, subunit II

065R

74004–74540

178

19.64

 

2e-19

38

YP_164170

SGIV

 

066R

74657–75151

164

17.38

dUTPase (COG0756)

2e-84

100

AAZ22692

RGV

dUTPase

067R

75261–75548

95

10.38

CARD, Caspase recruitment domain (pfam00619)

3e-35

94

YP_031643

FV3

CARD-like protein

068L

76015-75851

54

4.95

 

1e-08

98

YP_031644

FV3

 

069L

76210-76061

49

5.12

      

070L

76693-76400

97

10.81

 

5e-23

96

YP_031645

FV3

 

071L

77911-76748

387

43.88

Ribonucleotide Reductase beta subunit (cd01049)

0.0

99

YP_031646

FV3

ribonucleotide reductase small subunit

072L

78502-78236

88

9.28

 

8e-28

79

YP_003808

ATV

 

073R

78619–78894

91

9.72

 

6e-31

100

YP_031648

FV3

 

074R

78903–79277

124

13.37

 

2e-44

100

YP_031649

FV3

 

075R

79316–79549

77

8.34

 

1e-27

98

YP_031650

FV3

 

076R

79593–79727

44

4.89

      

077R

79834–80316

160

17.24

 

2e-78

95

YP_003804

ATV

 

078L

81742-80768

324

36.13

Zinc finger C2H2 type domain signature (PS00028)

2e-178

98

YP_031652

FV3

ring finger protein

079L

83005-81917

362

38.14

 

5e-167

100

YP_031653

FV3

 

080Ra

81987–82415

142

14.81

      

081Ra

82500–82943

147

15.30

      

082L

83316-83062

84

9.26

Possible membrane associated motif in LPS-induced tumor necrosis factor (smart00714)

7e-30

98

YP_031654

FV3

LPS-induced tumor necrosis factor alpha

083R

83379–83600

73

7.99

 

2e-31

95

YP_031655

FV3

 

084L

83944-83597

115

12.84

 

6e-56

100

YP_031656

FV3

VLTF2-like late transcription factor

085L

85203-84529

224

25.60

 

5e-119

93

ABB92336

TFV

 

086R

85303–87021

572

63.50

 

0.0

98

YP_031658

FV3

putative ATPase dependent protease

087L

88760-87645

371

40.36

Ribonuclease III C terminal domain (cd00593)

0.0

100

YP_031659

FV3

ribonuclease III

088R

88816–89094

92

10.51

C2C2 Zinc finger (smart00440)

1e-41

98

YP_031660

FV3

transcription elongation factor IIS

089R

89223–89696

157

17.65

 

5e-87

98

YP_031661

FV3

immediate early protein ICP-18

090R

90146–90790

214

24.73

Site-specific DNA methylase (COG0270)

2e-122

100

YP_031662

FV3

cytosine DNA methyltransferase

091R

91177–91914

245

26.05

 

5e-133

99

YP_031663

FV3

proliferating cell nuclear antigen

092R

91989–92576

195

22.12

Deoxyribonucleoside kinase (cd01673)

1e-106

99

YP_031664

FV3

thymidine kinase

093L

95345-93564

593

64.26

 

0.0

97

ABB92341

TFV

 

094R

95378–95830

150

16.53

Erv1/Alr family (pfam04777)

4e-83

99

YP_031667

FV3

thiol oxidoreductase

095R

95899–97044

381

43.28

 

3e-140

92

YP_031668

FV3

 

096R

97137–98528

463

49.92

Iridovirus major capsid protein (pfam04451)

0.0

99

YP_031669

FV3

major capsid protein

097R

98652–99839

395

45.57

T4 RNA ligase (pfam09511)

0.0

98

YP_031670

FV3

immediate early protein ICP-46

098L

100767-100552

71

7.63

 

3e-12

98

YP_031671

FV3

 

099L

101295-100828

155

17.85

 

2e-79

100

YP_031673

FV3

 

100R

101389–102480

363

40.63

Xeroderma pigmentosum G N- and I-regions (cd00128)

0.0

99

YP_031674

FV3

FLAP endonuclease

101L

102699-102571

42

4.31

      

102R

103281–103952

223

24.28

 

7e-123

98

YP_031675

FV3

 

103R

104035–104448

137

15.29

 

5e-73

99

YP_031676

FV3

Bcl-2-like protein

104R

104973–105677

234

26.9

herpes virus US 22 like protein (pfam02393)

4e-47

51

YP_031583

FV3

 

105R

105716–105856

46

5.73

      

Note. FV3, Frog virus 3; TFV, Tiger frog virus; ATV, Ambystoma tigrinum virus; SGIV, Singapore grouper iridovirus; RGV, Rana grylio virus.

aputative overlapped ORFs in STIV genome.

https://static-content.springer.com/image/art%3A10.1186%2F1471-2164-10-224/MediaObjects/12864_2008_Article_2108_Fig1_HTML.jpg
Figure 1

Schematic organization of the STIV genome. (A) Linear predicted open reading frame (ORF) map of the STIV genome. Predicted ORFs are represented by arrows indicating the approximate size and the direction of transcription based on the position of methionine initiation and termination codons. White arrows represent ORFs in the forward strand, whereas gray arrows identify those in the complement strand. (B) The G+C content of STIV genome. The graphic representation was calculated using the plot option in DNAMAN program and a window of 200 nucleotides. The kilobase scale is shown below the G+C plot.

Repetitive sequences

Repetitive sequences are not only found in eukaryotic genomes [15], but have also been identified in large DNA viruses, where they are involved in genome replication and gene transcription [16, 17]. Similar to other iridoviruses, the STIV genome contains 21 repeat sequences (Table 2). Interestingly, a 34 tandem repeated CA dinucleotide called microsatellite or simple sequence repeat (SSR) was closely associated with a predicted gene encoding for a ring finger protein (ORF078L) in the STIV genome. Such a repeat sequence has only been reported in the FV3 genome, but not in other sequenced iridoviruses or mammalian large DNA viruses. These SSRs could serve to modify viral genes involved in gene regulation, transcription and protein function and modification in their function mainly depends on the number of repeats [18]. The biological functions of the repeat sequences and the CA dinucleotide microsatellite in STIV remain to be characterized.
Table 2

Sets of repeat sequences in STIV genome

Location

size (bp)

Copy number

Matches (%)

G+C content (%)

800 – 845

15

3.1

96

30

1004 – 1190

64

2.9

97

32

1499 – 1578

9

8.9

95

63

11243 – 11282

14

2.9

100

22

22236 – 22276

15

2.7

100

50

28871 – 28952

30

2.7

100

26

38641 – 39108

222

2.1

100

50

39783 – 39831

21

2.3

100

66

41855 – 41886

16

2.0

100

43

43198 – 43222

6

4.2

100

68

45776 – 45812

18

2.1

100

55

49952 – 50070

39

3.1

100

36

52268 – 52597

18

18.3

100

55

54757 – 54890

39

3.4

100

56

60328 – 60387

16

3.8

97

21

65561 – 65592

15

2.1

100

33

80609 – 80676

2

34.0

100

50

93066 – 93178

30

3.8

98

51

95254 – 95296

18

2.4

100

78

96781 – 96922

21

6.8

100

65

99849 – 99882

11

3.1

100

44

DNA replication and repair

STIV encodes a protein (ORF063R) similar to family B DNA polymerases, which contains a nucleotide-polymerizing domain fused to an N-terminal exonuclease domain. In eukaryotes and prokaryotes, DNA polymerase is an essential replication enzyme and is able to proofread misincorporated nucleotides as well as replicate DNA [19]. Besides these functions, the poxvirus DNA polymerases could also play critical roles in catalyzing concatemer formation and promoting virus recombination [20, 21]. Some viruses, such as baculoviruses and poxviruses, not only exploit the host cell proliferating cell nuclear antigen (PCNA) proteins to contribute to viral DNA replication [22], but also encode PCNA-like genes by themselves [23, 24]. A homolog of PCNA was identified in STIV. STIV also encodes a homologue of the poxvirus D5 family proteins (ORF025R) that contains a unique D5N domain and belongs to the helicase superfamily III within the AAA+ ATPase class [25]. The highly conserved D5 protein is required for the viral DNA replication or lagging-strand synthesis [26].

Other putative proteins encoded by STIV with known or presumed functions in viral DNA replication, recombination and repair included thymidine kinase (ORF092R), virion packaging ATPase (ORF016R), helicase (ORF057L) and tyrosine kinase (ORF031R) as well as FLAP endonuclease (ORF100R) with a conserved nuclease domain (N- and I- regions). The FLAP endonuclease homologs are not only present in STIV and other iridoviruses, but also in the poxvirus, ascovirus and mimivirus [14]. Interestingly, FLAP endonuclease homologs have been identified in herpesviruses and shown to destabilize preexisting host mRNAs in infected cells [27]. Thus, the protein product of ORF100R might function in STIV virogenesis.

Proteins involved in transcription

The gene products involved in transcription include two DNA-dependent RNA polymerase subunits (DdRP, ORF010R and ORF064L), transcription factor-like proteins (ORF001L), transcription elongation factor S-II/TFIIS (ORF088R) and a putative NIF/NLI interacting factor containing a CTD phosphatase domain (ORF041R). The DNA-dependent RNA polymerases (DdRPs) are multifunctional enzymes and exist ubiquitously in prokaryotes, eukaryotes and cytoplasmic DNA viruses [28, 29]. The putative protein encoded by ORF088R contains a C2C2 zinc finger domain and is homologous to the TFIIS, which is ubiquitous in many organisms and plays an important role in transcript elongation [30, 31]. Virally encoded TFIIS regulate the elongation potential of the viral RNA polymerase during vaccinia virus infection [32].

Nucleotide metabolism

Four proteins involved in nucleotide metabolism were predicted in the STIV genome, including the large and small subunits of the ribonucleotide reductase (RNR, ORF042R and ORF071L respectively), deoxyuridine triphosphate nucleotidohydrolase (dUTPase, ORF066R) and RNase III (ORF087L). Viral RNR is either required for virus growth or is involved in anti-apoptosis functions during viral pathogenesis [33, 34]. A putative dUTPase homolog encoded by ORF066R contains five conserved motifs and a conserved Tyr residue as the substrate binding site. dUTPase is an essential enzyme and plays multiple cellular roles [35]. In cells infected with Epstein-Barr virus, virally encoded dUTPase homologs function as highly specific enzymes for efficient replication, or serve to upregulate several proinflammatory cytokines [36, 37].

STIV ORF087L also contains a well-conserved RNase III catalytic domain that is required for the cleavage of double stranded (ds)RNA templates [38]. Nearly all STIV encoded nucleotide metabolism enzymes have orthologs in other large DNA viruses. This is consistent with the view that the frequent acquisition of nucleotide metabolism enzymes during DNA virus evolution appears to reflect specific adaptations of viruses for the different types of cells in which they propagate [22].

Structural proteins

Despite the emerging information about iridovirus genomes, there has been little focus on the roles of structural proteins in viral pathogenesis. Three putative structural proteins were examined in the STIV genome. ORF096R encodes a major capsid protein 463 amino acids long that shares 99% identity to FV3. Similar to the MCP gene, the two other genes, ORF002L and ORF055R, are also highly conserved in all sequenced iridovirus genomes [5]. ORF002L encodes a putative membrane protein with a poxvirus conserved region and a C-terminal transmembrane domain. In addition, ORF055R is a myristylated membrane protein homolog with two adjacent transmembrane domains and a conserved sequence M-G-X-X-X-(S/T/A) for N-terminal glycine myristylation. The myristylated membrane protein encoded by vaccinia virus plays a role in virus assembly [39]. The roles of the two putative membrane proteins of STIV during viral infection need to be evaluated.

Virus-host interactions

In addition to the essential genes required for virus replication, STIV also contains several putative genes involved in host-virus interactions, especially in immune evasion. STIV ORF054R shares 40% identity with the vaccinia virus 3-beta-hydroxysteroid oxidoreductase-like protein (3-β-HSD), which has been suggested to contribute to virulence by suppressing inflammatory responses [40]. In addition, three proteins that might be involved in apoptotic signaling have also been identified: ORF067R encodes a protein containing caspase recruitment domain (CARD) and ORF082L encodes a protein sharing sequence homology with the lipopolysaccharide induced tumor necrosis factor-alpha (LITAF) of viruses and eukaryotes [41, 42]. There is also a Bcl-2-like protein (ORF103R) containing BH1, BH2 domains and a typical 'NWGR' signature motif. Bcl-2 homologs are also found in herpesviruses, poxvirus, African swine fever virus (ASFV) and adenoviruses [43]. Considering that several iridovirus agents can induce apoptosis during infection, and that virally induced apoptosis aids the progression of replication and dissemination [44, 45], these apoptosis-regulating genes might manipulate the balance of life and death in STIV infected cells. In addition, the virally encoded eIF-2α decoy could inhibit eIF-2α phosphorylation and block interferon action during virus infections. Interestingly, STIV ORF030R also displays a truncated eIF-2α-like protein as well as FV3 ORF026R, which is different from the complete eIF-2α homologs conserved among eukaryotes and other viruses, suggesting that STIV and FV3 are likely isolates of the same viral species.

Noncoding RNAs

MicroRNAs (miRNAs) are key regulators of gene expression in higher eukaryotes. Recently, miRNAs have been identified from viruses with double-stranded DNA genomes. The computational method has been applied successfully to predict miRNAs encoded by herpes simplex virus 1 and human cytomegalovirus [46, 47]. We applied the same algorithm to the STIV genome and searched for 21-nucleotide (nt) sequences with hairpin-structured precursors. Twelve precursor sequences encoding 20 miRNA candidates were identified in the STIV genome (Table 3). MicroRNAs of mammalian viruses play important roles during infection, such as repressing host immune responses and apoptosis, and regulating gene expression [48, 49]. Whether the potential miRNAs are functional in STIV needs further investigation.
Table 3

Sequences of predicted STIV pre-miRNAs and miRNAs and their genomic locations

Precursor no.

Predicted pre-miRNA sequence, 5' to 3'

(mature miRNA sequence highlightened in italic)

STIV sequence coordinates

1

GGUGUAACAUCUCAAGAUACGAUGGAUCUAUG AGAGAGACUAAAAAUGUGGACAACCUUUCAGACUAUUAUCUUGAGAGAAUAUAUCUU

14907–14995

2

AAAAGUUUCCGAGAUGGUAAAGACUCUGAGAUAAUAUCGAGAGAAUAAAGACUCUUUCAGAGAUAAUAUCUUACG AUGUUGUACCACCUCAUU

18571–18663

3

AACAACGUCUUGAGAUACUAUUAUCUUA AGAUACUAUUAUCUUAAGAUACUAUUAUCUUAAG AUACUUUC

60321–60390

4

ACAAACUGGUGAUAUAUUCUUUCAGAAGAUAUU CUCUGGGAGAGUAUCUUUCAGAAGAUUAUAUC UCAGAAAGUUUUAGG

65173–65252

5

GUCUAGAAAUAUUAUUGAGGGUAUCUUACAAUAUUAGUAAAGAUAUCUUCUGAAAGAGUAUCUUACUAUAGUAGUACAGUAUCU UACAAUAGAGAGAUCU

87293–87392

6

UUAGGUCUGGAUAUUAUCUCUGAAAGAACGUCUUAGG AUAAAAUCUUAGGAUAUUCUUUCAGAAGA UUUCUAGGAUAAGA

42283–42362

7

UGACGGAGGGUUGUUCCACUCCACGGGGGCUUUGGGACACUCUACCUGAACCCUGGGUGGAGACCACUCUUUGU A

195–121

8

CGGUGCGAUCGGUGUACACACAAGUGAUG GACACACCACACAGGUCCAGCACGUGUGUACACCAG AGGUAAUUUUCUUAA

4966-4887

9

UAGAGAUGGUAAUAUCUUAAGAUAAUAGUAUC GAGAUGGUAAUAUCUUAAGAUAAUAGUAUCGAGAUGGUAAUAUCUUAAG AUAUUUAGU

28954-28865

10

GCGAGAUACUUUGUGAGAGAUAUCUUACGAUA GUAAUAGUCUUGCGAGAGAAUAUCUUCUGAAAGAGAUUAUAUCUGAAAGAGAUUACGUCUUAAGAUAUCUUACA CAUCACUCUUGUCCU

84184-834064

11

GGUUUCGGCGGCAAUAAGGCGAGUCUCAACAUUAAACCCCAUAC AAAGUCUACGGUCUCUGUAUGAGGAAUGUUGGGAC ACUUGCGCUUGUAACAACGCUUGCAGUCU

100334-100217

12

GGGACCCUUUAAAUCAGAAAGGAUAACACCAGUGUAAACAUAAGUCAUAUGCC UGUGUUGGUUCUCACAGGUGUGUUACUUAUGUUUACACU GGUCUUAGCCUUGCUGGA

104919-104810

Global pairwise alignment and core gene order comparisons

DNA dot matrix (Pustell DNA matrix) analyses of STIV complete genomic sequence with the FV3, TFV, ATV, SGIV, GIV (Figure 2), LCDV-1, LCDV-C, ISKNV and CIV genome sequences (results not shown) revealed that STIV has a high degree of sequence conservation and colinearity with FV3. A slight break was also present when STIV is compared to TFV. Interestingly, STIV have little colinearity with the fish iridoviruses, SGIV and GIV, the second group of genus Ranavirus.
https://static-content.springer.com/image/art%3A10.1186%2F1471-2164-10-224/MediaObjects/12864_2008_Article_2108_Fig2_HTML.jpg
Figure 2

DNA dot plot analysis of the STIV genome (horizontal axis) with itself and other members belonging to the ranaviruses (axis). The vertical axes represent the genomes of (A) STIV, (B) FV3, (C) TFV, (D) ATV, (E) SGIV and (F) GIV. The complete genomic sequences were aligned using the DNAMAN program and both strands of DNA were aligned for the dot matrix plot. Solid lines show the high level of sequence similarity.

We also examined the arrangement of 20 conserved genes, including the major capsid protein and other proteins involved in genome replication, transcription and modification. Given that the origin of virus genome replication is unclear, the MCP gene was chosen as the starting point for all iridovirus genomes. As shown in Figure 3, STIV has a gene order in common with FV3 and TFV, but shows obvious differences from ATV, SGIV and GIV. In addition, the orders of these genes are significantly discriminative among different genera. The presence of inversion in ATV and different gene arrangements are consistent with the high recombination frequency in iridoviruses.
https://static-content.springer.com/image/art%3A10.1186%2F1471-2164-10-224/MediaObjects/12864_2008_Article_2108_Fig3_HTML.jpg
Figure 3

The genomic arrangement of 20 conserved genes in the family Iridoviridae. Genes are indicated by black outline boxes. The MCP genes were designated as the starting point for all iridovirus genomes and genome names are listed on the right. Horizontal distances are shown proportional to base pair distances and the vertical lines indicate the conserved genes in different iridovirus isolates. The following are the conserved genes according to their order in the STIV genome: major capsid protein (096R); immediate-early protein ICP-46 (097R); FLAP endonuclease (100R); putative replicating factor (001R); DNA-dependent RNA polymerase II largest subunit (010R); D6/D11-like helicase (011L); A32 virion packaging ATPase (016R); unknown protein (021R); unknown (024L); D5 family NTPase (025R); NIF/NLI interacting factor (041R); myristylated membrane protein (055R); phosphotransferase (060R); DNA polymerase (063R); DNA-dependent RNA polymerase subunit II (064L); ribonucleotide reductase small subunit (071R); Ribonuclease III (087L); proliferating cell nuclear antigen, PCNA (091R); thymidine kinase (092R) and thiol oxidoreductase (094R).

Phylogenetic analysis

To test the phylogenetic relationship of STIV with other members of iridoviruses, the full-length protein sequences encoded by four conserved core genes, including the major capsid protein (MCP), a myristilated membrane protein, ribonuclease III and DNA polymerase (DNA pol) were used for phylogenetic analysis. The alignments were performed using ClustalX and the unweighted parsimony bootstrap consensus tree was obtained by heuristic search with 100 bootstrap replicates. As shown in Figure 4A, the results from four phylogenetic trees provided consistent evidence that STIV is most closely related to FV3, the typical species of the genus Ranavirus, followed by TFV, ATV, SGIV and GIV.
https://static-content.springer.com/image/art%3A10.1186%2F1471-2164-10-224/MediaObjects/12864_2008_Article_2108_Fig4_HTML.jpg
Figure 4

Phylogenetic analysis of STIV with other iridovirus isolates based on four conserved core genes and the complete genome sequence. (A) Complete amino acid sequences of major capsid protein (ORF096R), myristilated membrane protein (ORF055R), DNA polymerase (ORF063R) and ribonuclease III (ORF087L) of STIV, FV3, TFV, ATV, SGIV, GIV, LCDV-C, LCDV-1, CIV, IIV-3, ISKNV, RBIV and OSGIV were aligned using Clustal-X and parsimony bootstrap trees generated using PHYLIP. Numbers above branches indicate bootstrap support values based on 100 replicates. (B) Unrooted phylogenetic tree of vertebrate iridoviruses based on the complete genomic sequences. Alignments were made using the MAFFT 6 program and a dendrogram was constructed using the MEGA4 program.

Furthermore, given the significant difference in the genome length between vertebrate and invertebrate iridoviruses, a phylogenetic analysis based on the complete genomes of 11 sequenced vertebrate iridovirus isolates was performed. The results further suggested that STIV is most closely related to FV3 (Figure 4B). Given the nature of virus-host coevolution and the phylogenetic relationships among vertebrates from fish to reptiles, we propose that the iridovirus might transmit between reptiles and amphibians, and that STIV and FV3 are strains of the same viral species belonging to the Ranavirus genus of family Iridoviridae. Interclass infections of iridovirus have been observed by in vivo and in vitro studies on sympatric species of fish and amphibians that can be infected by the same virus [50]. Whether the STIV infects frogs and FV3 infects turtles are questions that need to be evaluated.

Gene gain and loss in the Iridoviridae family

During virus-host coevolution, gene gain and loss are likely to have host-specific effects. The acquired genes could contribute to the evasion of host defenses, while the lost genes may coincide with either the loss of an antigenic signal to the host cell immune system or the gain of virulence [51, 52]. To better understand the evolution of gene content in the Iridoviridae family, we analyzed the gene gain and loss events among the 13 sequenced iridovirus agents. According to our strict homology definition, only 11 clusters of orthologous groups (COGs) contained a homolog from all the iridovirus isolates. Several previously defined conserved core genes were excluded, including the putative replication factor and proliferating cell nuclear antigen (PCNA)-like proteins. These genes shared additional homology characteristics such as a predicted conserved domain, but showed poor alignment scores. We generated a phylogenetic tree based on these 11 concatenated proteins showing the number of genes gained and lost at each branch. As shown in Figure 5, although our mapping of gene gain and loss assumes that gene loss could occur throughout the tree, reptile ranavirus and amphibian ranavirus (+2/-) have less gene gain-and-loss events than fish ranavirus (+50/-24), fish lymphocystivirus (+65/-26), fish megalocytivirus (+86/-19) and insect iridovirus (+105/-). The variance among ranaviruses supported the point that SGIV and GIV were classified into the second Ranavirus group. Moreover, both STIV and FV3 gained five and lost four genes compared with TFV during evolution, again suggesting that STIV shares the highest identity with FV3. In addition, a number of COGs were only present within a specific genus. Tumor necrosis factor receptor (TNFR) homologs or TNFR-associated proteins were gained in fish iridovirus and lost in amphibian and reptile iridoviruses, while DNA topoisomerase II, NAD-dependent DNA ligase, SF1 helicase, inhibitor of apoptosis protein (IAP) and baculovirus repeated open reading frame (BRO protein) were lost in vertebrate iridoviruses. These genes might have contributed greatly in favoring adaptation to different natural host species during iridovirus-host co-evolution.
https://static-content.springer.com/image/art%3A10.1186%2F1471-2164-10-224/MediaObjects/12864_2008_Article_2108_Fig5_HTML.jpg
Figure 5

Phylogeny of the iridovirus based on concatenated protein sequences and the gene gain and loss events. The host of the virus and the virus classification are indicated on the right. Bootstrap values are shown in black next to the nodes and the numbers of gene gain (+) and loss (--) events along each branch are indicated in grey.

Conclusion

In summary, the present study provided the complete genome sequence of turtle iridovirus. The phylogenetic tree and dot plot analyses suggested that STIV, a novel reptile iridovirus isolate, and FV3 are strains of the same virus species belonging to the genus Ranavirus in the family Iridoviridae. The genome data will not only contribute to better understanding the reptile iridovirus pathogenesis, but also shed light on the evolution of the different iridovirus isolates.

Methods

Virus propagation and genome DNA preparation

The virus strain used for genome sequencing was STIV (strain 9701) isolated from diseased red-neck turtle (Trionyx sinensis) in China [7]. Fathead minnow (FHM) cells were cultured in Minimum Essential Medium (MEM, Gibco/Invitrogen) containing 10% fetal bovine serum (FBS, Gibco). When STIV-infected FHM cells exhibited 80% CPE, cells were collected and frozen at -20°C. The frozen cells were thawed, and cell debris was removed by centrifugation at 4 000 × g for 30 min at 4°C and the supernatant containing STIV was ultracentrifuged in a Beckman (rotor type, SW41) at 28 000 rpm (~130 000 × g) for 1 h at 4°C. The pellet was resuspended in 1 ml of PBS and further centrifuged using discontinuous sucrose gradient (20, 30, 40, 50 and 60%) centrifugation at 28 000 rpm (~130 000 × g) for 1 h. The virus particle band was collected and used to prepare the STIV genomic DNA using phenol-chloroform extraction as described [53].

DNA sequencing

Sequencing of STIV genome was carried out using a pyrosequencing platform, the Genome Sequencer 20 (GS20) System (454 Life Science Corporation, Roche). Briefly, after the quality of STIV genome DNA had been assessed by agarose gel electrophoresis and analysed by Agilent bioanalyzer (Agilent Technologies, Santa Clara, CA, USA), ~10 μg samples were sheared by nebulization into 300–500 bp fragments. The whole genomic library was amplified using GS20 emPCR kits and sequenced with the 454 Life Science GS 20 instrument according to the manufacturer's recommendations. The GS De Novo Assembler software generates a consensus sequence of the whole DNA sample by assembly of de novo shotgun sequencing reads into contigs and subsequent ordering of these contigs into scaffolds. The average reading frame length was about 100 bp with 20-fold coverage of the whole genome. To fill the gaps, 16 oligonucleotide primers were used to amplify by polymerase chain reaction (PCR) directly from the genome DNA and the corresponding PCR products were sequenced using an automated ABI 3730 apparatus (Applied Biosystems, Shanghai, China).

Genome structure prediction

Nucleotide and amino acid sequences were analyzed using the DNASTAR software package (Lasergene, Madison, WI, USA). The genomic organization was drawn using the DNAMAN program. Nucleotide sequence and protein database searches were performed using the BLAST programs at the NCBI website http://www.ncbi.nlm.nih.gov. The whole genome sequence was also submitted to http://www.softberry.com (Softberry Inc., Mount Kisco, NY, USA) for identification of all putative ORFs. For more refined analyses, conserved motifs and domains and putative functions of deduced STIV proteins composed of 40 or more amino acids with homologies to other proteins in sequence databases were identified using several online programs as follows: for conserved motifs and domains, http://smart.embl-heidelberg.de and http://www.ncbi.nlm.nih.gov/Structure/cdd/wrpsb.cgi were used; for transmembrane domain predictions, http://www.cbs.dtu.dk/services/TMHMM-2.0/ was used. DNA repetitive sequences were detected computationally using REPuter and a tandem repeats finder [54]. The STIV microRNA prediction was carried out as described [47].

Iridovirus phylogeny

To analyze the evolutionary position of STIV in the family Iridoviridae, four conserved iridovirus genes, which are also present in other large DNA viruses, were evaluated using the PHYLIP program based on the amino acid alignment. Multiple alignments of proteins and nucleotide sequences were generated using the MAFFT 6 and ClustalX programs [55, 56]. In addition, a phylogenetic tree was constructed using MEGA version 4 with complete genomic sequences corresponding to the available sequencing data of iridoviruses.

Gene gain and loss events in the Iridoviridae family

All the putative iridovirus genes were obtained from NCBI databases and the all-against-all BLASTP similarity search was performed. The different iridovirus genes were regarded as COGs based on protein sequence similarity. The homologs were determined if one hit the other in the BLASTP search with an e-value ≤ 10-5 and the maximal produced alignments covered at least 60% of the longer protein, while the homologous proteins from multiple copies of a gene in one genome were counted only once. Eleven sets of COGs were aligned independently using the ClustalX alignment program, then the alignments were concatenated into a single alignment and a neighbor-joining (NJ) tree was constructed using MEGA version 4. Gene gain and loss events were processed with PAML software package and assigned to branches in the phylogenetic tree [57].

Nucleotide sequence accession number

The complete STIV genome sequence has been deposited in GenBank under accession No. EU627010. The nucleotide sequences of other iridoviruses can be found in GenBank and the accession numbers were listed as follows: FV3, AY548484; TFV, AF389451; ATV, AY150217; GIV, AY666015; SGIV, AY521625; LCDV-1, L63545; LCDV-C, AY380826; ISKNV, AF371960; RBIV, AY532606; OSGIV, AY894343; IIV-6, AF303741 and IIV-3, DQ643392.

Notes

Declarations

Acknowledgements

We thank Dr Xionglei He for his comments on the manuscript as well as Zhidong Chen for his bioinformatics assistance. This work was supported by grants from the National Basic Research Program of China (973) (2006CB101802), from the Natural Science Foundation of China (30725027, 30700616, 30571437), from the National High Technology Development Program of China (863) (2006AA100306, 2006AA09Z445, 2006AA09Z411), from the Natural Foundation of Guangdong, China (06104920) and from the Chinese Academy of Sciences (KZCX2-YW-BR-08).

Authors’ Affiliations

(1)
State Key Laboratory of Biocontrol, School of Life Sciences, Sun Yat-sen University
(2)
Laboratory of Marine Biology, South China Sea Institute of Oceanology, Chinese Academy of Sciences
(3)
Shenzhen Exit & Entry Inspection and Quarantine Bureau
(4)
State Key Laboratory of Plant Genomics, Institute of Genetics and Developmental Biology, Chinese Academy of Sciences

References

  1. Williams T, Barbosa-Solomieu V, Chinchar VG: A decade of advances in iridovirus research. Adv Virus. 2005, 65: 173-248. 10.1016/S0065-3527(05)65006-3.View ArticleGoogle Scholar
  2. Chinchar VG, Essbauer S, He JG, Hyatt A, Miyazaki T, Seligy D, Williams T: Iridoviridae. Virus Taxonomy, VIIIth Report of the International Committee on Taxonomy of Viruses. Edited by: Fauqet CM, Mayo MA, Maniloff J, Desselberger U, Ball LA. 2005, Academic Press, London, 163-175.Google Scholar
  3. Delius H, Darai G, Flügel RM: DNA Analysis of insect Iridescent virus 6: evidence for circular permutation and terminal redundancy. J Virol. 1984, 49: 609-614.PubMed CentralPubMedGoogle Scholar
  4. Goorha R, Murti KG: The genome of frog virus 3, an animal DNA virus, is circularly permuted and terminally redundant. Proc Natl Acad Sci USA. 1982, 79: 248-252. 10.1073/pnas.79.2.248.PubMed CentralView ArticlePubMedGoogle Scholar
  5. Eaton HE, Metcalf J, Penny E, Tcherepanov V, Upton C, Brunetti CR: Comparative genomic analysis of the family Iridoviridae: re-annotating and defining the core set of iridovirus genes. Virol J. 2007, 4: 11-10.1186/1743-422X-4-11.PubMed CentralView ArticlePubMedGoogle Scholar
  6. Kurita J, Nakajima K, Hirono I, Aoki T: Complete genome sequencing of red sea bream Iridovirus (RSIV). Fisheries Sci. 2002, 68: 1113-1115. 10.1046/j.1444-2906.2002.00540.x.View ArticleGoogle Scholar
  7. Chen ZX, Zheng JC, Jiang YL: A new iridovirus isolated from soft-shelled turtle. Virus Res. 1999, 63: 147-151. 10.1016/S0168-1702(99)00069-6.View ArticlePubMedGoogle Scholar
  8. Johnson AJ, Pessier AP, Wellehan JF, Childress A, Norton TM, Stedman NL, Bloom DC, Belzer W, Titus VR, Wagner R, Brooks JW, Spratt J, Jacobson ER: Ranavirus infection of free-ranging and captive box turtles and tortoises in the United States. J Wildl Dis. 2008, 44: 851-863.View ArticlePubMedGoogle Scholar
  9. Allender MC, Fry MM, Irizarry AR, Craig L, Johnson AJ, Jones M: Intracytoplasmic inclusions in circulating leukocytes from an eastern box turtle (Terrapene carolina carolina) with iridoviral infection. J Wildl Dis. 2006, 42: 677-684.View ArticlePubMedGoogle Scholar
  10. Marschang RE, Becher P, Posthaus H, Wild P, Thiel HJ, Müller-Doblies U, Kalet EF, Bacciarini LN: Isolation and characterization of an iridovirus from Hermann's tortoises (Testudo hermanni). Arch Virol. 1999, 144: 1909-1922. 10.1007/s007050050714.View ArticlePubMedGoogle Scholar
  11. Mao J, Hedrick RP, Chinchar VG: Molecular characterization, sequence analysis and taxonomic position of newly isolated fish iridoviruses. Virology. 1997, 229: 212-220. 10.1006/viro.1996.8435.View ArticlePubMedGoogle Scholar
  12. Margulies M, Egholm M, Altman WE, Attiya S, Bader JS, Bemben LA, Berka J, Braverman MS, Chen YJ, Chen Z, Dewell SB, Du L, Fierro JM, Gomes XV, Godwin BC, He W, Helgesen S, Ho CH, Irzyk GP, Jando SC, Alenquer ML, Jarvie TP, Jirage KB, Kim JB, Knight JR, Lanza JR, Leamon JH, Lefkowitz SM, Lei M, Li J, Lohman KL, Lu H, Makhijani VB, McDade KE, McKenna MP, Myers EW, Nickerson E, Nobile JR, Plant R, Puc BP, Ronan MT, Roth GT, Sarkis GJ, Simons JF, Simpson JW, Srinivasan M, Tartaro KR, Tomasz A, Vogt KA, Volkmer GA, Wang SH, Wang Y, Weiner MP, Yu P, Begley RF, Rothberg JM: Genome sequencing in microfabricated high-density picolitre reactors. Nature. 2005, 437: 376-380.PubMed CentralPubMedGoogle Scholar
  13. Tan WG, Barkman TJ, Gregory Chinchar V, Essani K: Comparative genomic analyses of frog virus 3, type species of the genus Ranavirus (family Iridoviridae). Virology. 2004, 323: 70-84. 10.1016/j.virol.2004.02.019.View ArticlePubMedGoogle Scholar
  14. Iyer LM, Balaji S, Koonin EV, Aravind L: Evolutionary genomics of nucleo-cytoplasmic large DNA viruses. Virus Res. 2006, 117: 156-184. 10.1016/j.virusres.2006.01.009.View ArticlePubMedGoogle Scholar
  15. Cox R, Mirkin SM: Characteristic enrichment of DNA repeats in different genomes. Proc Natl Acad Sci USA. 1997, 94: 5237-5242. 10.1073/pnas.94.10.5237.PubMed CentralView ArticlePubMedGoogle Scholar
  16. Klupp BG, Hengartner CJ, Mettenleiter TC, Enquist LW: Complete, annotated sequence of the pseudorabies virus genome. J Virol. 2004, 78: 424-440. 10.1128/JVI.78.1.424-440.2004.PubMed CentralView ArticlePubMedGoogle Scholar
  17. Delhon G, Moraes MP, Lu Z, Afonso CL, Flores EF, Weiblen R, Kutish GF, Rock DL: Genome of bovine herpesvirus 5. J Virol. 2003, 77: 10339-10347. 10.1128/JVI.77.19.10339-10347.2003.PubMed CentralView ArticlePubMedGoogle Scholar
  18. Kashi Y, King DG: Simple sequence repeats as advantageous mutators in evolution. Trends Genet. 2006, 22: 253-259. 10.1016/j.tig.2006.03.005.View ArticlePubMedGoogle Scholar
  19. Hogg M, Aller P, Konigsberg W, Wallace SS, Doublié S: Structural and biochemical investigation of the role in proofreading of a beta hairpin loop found in the exonuclease domain of a replicative DNA polymerase of the B family. J Biol Chem. 2007, 282: 1432-1444. 10.1074/jbc.M605675200.View ArticlePubMedGoogle Scholar
  20. Hamilton MD, Evans DH: Enzymatic processing of replication and recombination intermediates by the vaccinia virus DNA polymerase. Nucleic Acids Res. 2005, 33: 2259-2268. 10.1093/nar/gki525.PubMed CentralView ArticlePubMedGoogle Scholar
  21. Willer DO, Yao XD, Mann MJ, Evans DH: In vitro concatemer formation catalyzed by vaccinia virus DNA polymerase. Virology. 2000, 278: 562-569. 10.1006/viro.2000.0686.View ArticlePubMedGoogle Scholar
  22. Nash K, Chen W, McDonald WF, Zhou X, Muzyczka N: Purification of host cell enzymes involved in adeno-associated virus DNA replication. J Virol. 2007, 81: 5777-5787. 10.1128/JVI.02651-06.PubMed CentralView ArticlePubMedGoogle Scholar
  23. O'Reilly DR, Crawford AM, Miller LK: Viral proliferating cell nuclear antigen. Nature. 1989, 337: 606-10.1038/337606a0.View ArticlePubMedGoogle Scholar
  24. Iyer LM, Koonin EV, Leipe DD, Aravind L: Origin and evolution of the archaeo-eukaryotic primase superfamily and related palm-domain proteins: structural insights and new members. Nucleic Acids Res. 2005, 33: 3875-3896. 10.1093/nar/gki702.PubMed CentralView ArticlePubMedGoogle Scholar
  25. Evans E, Klemperer N, Ghosh R, Traktman P: The vaccinia virus D5 protein, which is required for DNA replication, is a nucleic acid-independent nucleoside triphosphatase. J Virol. 1995, 69: 5353-5361.PubMed CentralPubMedGoogle Scholar
  26. De Silva FS, Lewis W, Berglund P, Koonin EV, Moss B: Poxvirus DNA primase. Proc Natl Acad Sci USA. 2007, 104: 18724-18729. 10.1073/pnas.0709276104.PubMed CentralView ArticlePubMedGoogle Scholar
  27. Everly DN, Read GS: Mutational analysis of the virion host shutoff gene (UL41) of herpes simplex virus (HSV): characterization of HSV type 1 (HSV-1)/HSV-2 chimeras. J Virol. 1997, 71: 7157-7166.PubMed CentralPubMedGoogle Scholar
  28. Jones EV, Puckett C, Moss B: DNA-dependent RNA polymerase subunits encoded within the vaccinia virus genome. J Virol. 1987, 61: 1765-1771.PubMed CentralPubMedGoogle Scholar
  29. Yáñez RJ, Boursnell M, Nogal ML, Yuste L, Viñuela E: African swine fever virus encodes two genes which share significant homology with the two largest subunits of DNA-dependent RNA polymerases. Nucleic Acids Res. 1993, 21: 2423-2427. 10.1093/nar/21.10.2423.PubMed CentralView ArticlePubMedGoogle Scholar
  30. Kim B, Nesvizhskii AI, Rani PG, Hahn S, Aebersold R, Ranish JA: The transcription elongation factor TFIIS is a component of RNA polymerase II preinitiation complexes. Proc Natl Acad Sci USA. 2007, 104: 16068-71603. 10.1073/pnas.0704573104.PubMed CentralView ArticlePubMedGoogle Scholar
  31. Ito T, Arimitsu N, Takeuchi M, Kawamura N, Nagata M, Saso K, Akimitsu N, Hamamoto H, Natori S, Miyajima A, Sekimizu K: Transcription elongation factor S-II is required for definitive hematopoiesis. Mol Cell Biol. 2006, 26: 3194-3203. 10.1128/MCB.26.8.3194-3203.2006.PubMed CentralView ArticlePubMedGoogle Scholar
  32. Black EP, Condit RC: Phenotypic characterization of mutants in vaccinia virus gene G2R, a putative transcription elongation factor. J Virol. 1996, 70: 47-54.PubMed CentralPubMedGoogle Scholar
  33. Lembo D, Donalisio M, Hofer A, Cornaglia M, Brune W, Koszinowski U, Thelander L, Landolfo S: The ribonucleotide reductase R1 homolog of murine cytomegalovirus is not a functional enzyme subunit but is required for pathogenesis. J Virol. 2004, 78: 4278-4288. 10.1128/JVI.78.8.4278-4288.2004.PubMed CentralView ArticlePubMedGoogle Scholar
  34. Langelier Y, Bergeron S, Chabaud S, Lippens J, Guilbault C, Sasseville AM, Denis S, Mosser DD, Massie B: The R1 subunit of herpes simplex virus ribonucleotide reductase protects cells against apoptosis at, or upstream of, caspase-8 activation. J Gen Virol. 2002, 83: 2779-2789.View ArticlePubMedGoogle Scholar
  35. Tóth J, Varga B, Kovács M, Málnási-Csizmadia A, Vértessy BG: Kinetic mechanism of human dUTPase, an essential nucleotide pyrophosphatase enzyme. J Biol Chem. 2007, 282: 33572-33582. 10.1074/jbc.M706230200.View ArticlePubMedGoogle Scholar
  36. Oliveros M, García-Escudero R, Alejo A, Viñuela E, Salas ML, Salas J: African swine fever virus dUTPase is a highly specific enzyme required for efficient replication in swine macrophages. J Virol. 1999, 73: 8934-8943.PubMed CentralPubMedGoogle Scholar
  37. Glaser R, Litsky ML, Padgett DA, Baiocchi RA, Yang EV, Chen M, Yeh PE, Green-Church KB, Caligiuri MA, Williams MV: EBV-encoded dUTPase induces immune dysregulation: Implications for the pathophysiology of EBV-associated disease. Virology. 2006, 346: 205-218. 10.1016/j.virol.2005.10.034.View ArticlePubMedGoogle Scholar
  38. Drider D, Condon C: The continuing story of endoribonuclease III. J Mol Microbiol Biotechnol. 2004, 8: 195-200. 10.1159/000086700.View ArticlePubMedGoogle Scholar
  39. Ravanello MP, Hruby DE: Conditional lethal expression of the vaccinia virus L1R myristylated protein reveals a role in virion assembly. J Virol. 1994, 68: 6401-6410.PubMed CentralPubMedGoogle Scholar
  40. Reading PC, Moore JB, Smith GL: Steroid hormone synthesis by vaccinia virus suppresses the inflammatory response to infection. J Exp Med. 2003, 197: 1269-1278. 10.1084/jem.20022201.PubMed CentralView ArticlePubMedGoogle Scholar
  41. Huang X, Huang Y, Gong J, Yan Y, Qin Q: Identification and characterization of a putative lipopolysaccharide-induced TNF-alpha factor (LITAF) homolog from Singapore grouper iridovirus. Biochem Biophys Res Commun. 2008, 373: 140-145. 10.1016/j.bbrc.2008.06.003.View ArticlePubMedGoogle Scholar
  42. Park EM, Kim YO, Nam BH, Kong HJ, Kim WJ, Lee SJ, Kong IS, Choi TJ: Cloning, characterization and expression analysis of the gene for a putative lipopolysaccharide-induced TNF-alpha factor of the Pacific oyster, Crassostrea gigas. Fish Shellfish Immunol. 2008, 24: 11-17. 10.1016/j.fsi.2007.07.003.View ArticlePubMedGoogle Scholar
  43. Cuconati A, White E: Viral homologs of BCL-2: role of apoptosis in the regulation of virus infection. Genes Dev. 2002, 16: 2465-2478. 10.1101/gad.1012702.View ArticlePubMedGoogle Scholar
  44. Chinchar VG, Bryan L, Wang J, Long S, Chinchar GD: Induction of apoptosis in frog virus 3-infected cells. Virology. 2003, 306: 303-312. 10.1016/S0042-6822(02)00039-9.View ArticlePubMedGoogle Scholar
  45. Huang YH, Huang XH, Gui JF, Zhang QY: Mitochondrion-mediated apoptosis induced by Rana grylio virus infection in fish cells. Apoptosis. 2007, 12: 1569-1577. 10.1007/s10495-007-0089-1.View ArticlePubMedGoogle Scholar
  46. Grey F, Antoniewicz A, Allen E, Saugstad J, McShea A, Carrington JC, Nelson J: Identification and characterization of human cytomegalovirus-encoded microRNAs. J Virol. 2005, 79: 12095-12099. 10.1128/JVI.79.18.12095-12099.2005.PubMed CentralView ArticlePubMedGoogle Scholar
  47. Cui C, Griffiths A, Li G, Silva LM, Kramer MF, Gaasterland T, Wang XJ, Coen DM: Prediction and identification of herpes simplex virus 1-encoded microRNAs. J Virol. 2006, 80: 5499-5508. 10.1128/JVI.00200-06.PubMed CentralView ArticlePubMedGoogle Scholar
  48. Cullen BR: Immunology. Outwitted by viral RNAs. Science. 2007, 317: 329-330. 10.1126/science.1146077.View ArticlePubMedGoogle Scholar
  49. Nair V, Zavolan M: Virus-encoded microRNAs: novel regulators of gene expression. Trends Microbiol. 2006, 14: 169-175. 10.1016/j.tim.2006.02.007.View ArticlePubMedGoogle Scholar
  50. Picco AM, Collins JP: Amphibian Commerce as a Likely Source of Pathogen Pollution. Conserv Biol. 2008, 22: 1582-1589. 10.1111/j.1523-1739.2008.01025.x.View ArticlePubMedGoogle Scholar
  51. McLysaght A, Baldi PF, Gaut BS: Extensive gene gain associated with adaptive evolution of poxviruses. Proc Natl Acad Sci USA. 2003, 100: 15655-15660. 10.1073/pnas.2136653100.PubMed CentralView ArticlePubMedGoogle Scholar
  52. Bubiæ I, Wagner M, Krmpotiæ A, Saulig T, Kim S, Yokoyama WM, Jonjiæ S, Koszinowski UH: Gain of virulence caused by loss of a gene in murine cytomegalovirus. J Virol. 2004, 78: 7536-7544. 10.1128/JVI.78.14.7536-7544.2004.View ArticleGoogle Scholar
  53. Zhang QY, Xiao F, Xie J, Li ZQ, Gui JF: Complete genome sequence of lymphocystis disease virus isolated from China. J Virol. 2004, 78: 6982-6994. 10.1128/JVI.78.13.6982-6994.2004.PubMed CentralView ArticlePubMedGoogle Scholar
  54. Kurtz S, Choudhuri JV, Ohlebusch E, Schleiermacher C, Stoye J, Giegerich R: REPuter: the manifold applications of repeat analysis on a genomic scale. Nucleic Acids Res. 2001, 29: 4633-4642. 10.1093/nar/29.22.4633.PubMed CentralView ArticlePubMedGoogle Scholar
  55. Katoh K, Kuma K, Miyata T, Toh H: Improvement in the accuracy of multiple sequence alignment program MAFFT. Genome Inform. 2005, 16: 22-33.PubMedGoogle Scholar
  56. Larkin MA, Blackshields G, Brown NP, Chenna R, McGettigan PA, McWilliam H, Valentin F, Wallace IM, Wilm A, Lopez R, Thompson JD, Gibson TJ, Higgins DG: Clustal W and Clustal X version 2.0. Bioinformatics. 2007, 23: 2947-2948. 10.1093/bioinformatics/btm404.View ArticlePubMedGoogle Scholar
  57. Yang Z: PAML 4: phylogenetic analysis by maximum likelihood. Mol Biol Evol. 2007, 24: 1586-1591. 10.1093/molbev/msm088.View ArticlePubMedGoogle Scholar

Copyright

© Huang et al; licensee BioMed Central Ltd. 2009

This article is published under license to BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.