Skip to main content
  • Research article
  • Open access
  • Published:

Survey of transcripts expressed by the invasive juvenile stage of the liver fluke Fasciola hepatica

Abstract

Background

The common liver fluke Fasciola hepatica is the agent of a zoonosis with significant economic consequences in livestock production worldwide, and increasing relevance to human health in developing countries. Although flukicidal drugs are available, re-infection and emerging resistance are demanding new efficient and inexpensive control strategies. Understanding the molecular mechanisms underlying the host-parasite interaction provide relevant clues in this search, while enlightening the physiological adaptations to parasitism. Genomics and transcriptomics are still in their infancy in F. hepatica, with very scarce information available from the invasive newly excysted juveniles (NEJ). Here we provide an initial glimpse to the transcriptomics of the NEJ, the first stage to interact with the mammalian host.

Results

We catalogued more than 500 clusters generated from the analysis of F. hepatica juvenile expressed sequence tags (EST), several of them not detected in the adult stage. A set of putative F. hepatica specific transcripts, and a group of sequences conserved exclusively in flatworms were identified. These novel sequences along with a set of parasite transcripts absent in the host genomes are putative new targets for future anti-parasitic drugs or vaccine development.

Comparisons of the F. hepatica sequences with other metazoans genomes or EST databases were consistent with the basal positioning of flatworms in the bilaterian phylogeny. Notably, GC content, codon usage and amino acid frequencies are remarkably different in Schistosomes to F. hepatica and other trematodes.

Functional annotation of predicted proteins showed a general representation of diverse biological functions. Besides proteases and antioxidant enzymes expected to participate in the early interaction with the host, various proteins involved in gene expression, protein synthesis, cell signaling and mitochondrial enzymes were identified. Differential expression of secreted protease gene family members between juvenile and adult stages may respond to different needs during host colonization.

Conclusion

The knowledge of the genes expressed by the invasive stage of Fasciola hepatica is a starting point to unravel key aspects of this parasite's biology. The integration of the emerging transcriptomics, and proteomics data and the advent of functional genomics tools in this organism are positioning F. hepatica as an interesting model for trematode biology.

Background

Fasciola hepatica, the common liver fluke, is recognized as one of the most important parasitic helminths affecting livestock worldwide. Along with the related species F. gigantica, F. hepatica is responsible for massive economic losses estimated globally at 3.2 bn USD mainly due to reduction in meat, wool and milk output in infected animals, with additional costs derived from liver condemnation and flukicide drugs [1]. During the last decade, its relevance as a zoonotic agent in parts of Latin America and Africa has also emerged, with millions at risk of infection [2, 3]. Although effective drugs such as triclabendazole are available, they only provide interim control of the disease, since cattle and sheep are easily reinfected. Moreover, drug resistance against triclabendazole has emerged in Australia and European countries (Ireland, The Netherlands, U.K. and Spain) jeopardizing the long term sustainability of this control strategy [4].

The life cycle of F. hepatica is complex and includes a snail and a mammal as intermediate and definitive hosts respectively. Mammals get infected by ingestion of the quiescent larvae (metacercariae) encysted in the vegetation. An interplay of extrinsic signals from the host (digestive enzymes, bile salts, redox potential, pH, temperature among others) and intrinsic factors from the parasite (enzymes and secretions) determine the emergence of a motile larvae [5]. The newly excysted juveniles (NEJ) actively penetrate and transverse the gut wall into the peritoneal cavity within two or three hours. By four or five days post-infection the parasites reach and penetrate the liver, and continue burrowing through the parenchyma for several weeks. Within the major bile ducts the parasites mature and start to release eggs, that can be found in the bile and feces from 8 weeks post-infection [6].

Unlike mature flukes living in the immunologically safe environment of the bile ducts, NEJ are susceptible targets of the immune response. Only 5-10% of the inoculum in cattle, and 20-25% in sheep reach maturity in experimental infections, indicating that a great part of the emerged juveniles either fail entering the gut or are killed during the migrating phase [7, 8]. Vaccination studies also show that effective protection is correlated with reduced liver damage, a signature of previous destruction of the early NEJs. Despite the crucial role of this stage in determining the further success of the infective process, information regarding NEJs, is very limited, mainly due to the scarce availability of material to explore diverse aspects of the parasite biology. Principal roles for stage specific proteases and antioxidant enzymes in the early infection have been demonstrated by us and others [9–12]. Recent proteomic studies were able to reveal important differences among F. hepatica stages [13–15]. However, the identification of the juvenile specific proteins was limited by the paucity of mRNA sequences to match to peptide mass fingerprinting data. While more than 200 protein sequences and 10,000 EST are available from the adult stage, only 22 mRNA sequences from NEJ (mainly corresponding to cathepsin B and L-like cysteine proteinases) were deposited at the Genbank by July 2009. Consequently we decided to conduct a transcriptomic analysis in order to identify the gene repertoire expressed by the invasive stage of F. hepatica. Transcriptomic approaches in Schistosoma mansoni and S. japonicum have provided a thorough coverage of the genes expressed by diverse stages [16, 17]. Furthermore, they have been invaluable tools for the assembly and annotation of the recently released genomes of these important human parasites [18, 19], opening new avenues for discovery [20, 21]. EST have also been applied successfully to a limited set of other trematodes, namely Echinostoma paraensei[22], Clonorchis sinensis[23–25], Paragonimus westermani[26] and Opisthorchis viverrini[27].

Here we report the analysis of a limited set of NEJ expressed sequence tags, identifying putative stage, species and flatworm specific sequences. This first glimpse of the physiology of the invasive larvae opens new prospects for the understanding of the host-parasite interaction eventually leading to the development of new mechanisms to control fasciolosis, and warrants further analysis using new generation sequencing technologies.

Results and Discussion

Construction of a newly excysted juvenile F. hepatica cDNA library

In order to identify the genes expressed during the invasion process of the platyhelminth F. hepatica, we constructed a full length enriched cDNA library using a modified protocol based on selective amplification of capped polyadenylated RNA species. Since the starting parasite material was limiting, a modified size fractioning step of the products was introduced in order to improve the yield [28] (Additional File 1). More than four thousand reads were produced and analyzed using the Partigene pipeline [29]. Quality and vector trimming drastically reduced the starting 4319 ESTs to 1684 high quality sequences, mainly due to the presence of multimers of the adapters used in the generation of the libraries (see methods). This setback could be expected considering the minimal amount of starting material, and might be corrected using 5' blocked adapters in lower concentrations.

The resulting high quality sequences were clustered into 517 different contigs (249 clusters and 268 singletons), 74.6% of them showing significant similarity (E value < 1e-05) with protein coding genes deposited in public sequence databases, indicating a good representation of cDNAs in this library (Table 1). The most highly abundant EST in juvenile F. hepatica (13.5% of total reads) corresponds to the large subunit of the mitochondrial ribosomal RNA (LSU rRNA), and was discarded from further analysis. Polyadenylated LSU rRNA has already been described in other platyhelminths [28], and in fact, F. hepatica LSU rRNA has been reported to represent about 10% of the adult transcripts [30]. Considering that only 22 sequences from NEJ were available in Genbank by July 2009 (15 of them encoding cathepsins), the present report represents a pertinent contribution to the knowledge of the genes expressed by the invasive stage of the common liver fluke.

Table 1 Overview of F. hepatica NEJ ESTs assembly

Comparison and validation of the FhNEJ ESTs with other databases

In order to establish if the obtained contig sequences correspond to validated transcripts, we compared them to different available databases, including ESTs from the adult F. hepatica stage, predicted coding sequences from selected organisms with complete genomes, and transcriptomes of other eukaryotes representing the main lineages in the metazoan diversity (Additional File 2). To compare the data obtained from the juvenile stage to the adult sequences, we retrieved and analyzed using the Partigene pipeline more than 10,000 EST reads from F. hepatica adult worms available at the Wellcome Trust Sanger Institute, obtaining 4089 contigs (1879 clusters and 2210 singletons), 58% of them showing significant blast hits (E value < 1e-05) with publicly available databases (Additional File 3). These results are very similar to a recently reported analysis of the same dataset performed using a different pipeline [13].

More than half of the juvenile contigs (55.3%) were also found in adult ESTs (Figure 1). A set of 91 juvenile contigs (17.6%), also present in adults, showed no homology to sequences in other databases, suggesting that they might represent Fasciola specific transcripts expressed in diverse stages of the parasite life cycle. On the other hand, there are several juvenile contigs that are absent from the adult database, although represented in other organisms suggesting that they might represent stage specific transcripts (Figure 1). A set of 114 juvenile contigs (22,1%) were common to all other organisms searched indicating core eukaryotic functions such as ribosomal proteins and common enzymes. The absence of some of them from the adult dataset might suggest that the representation of the adult libraries is still partial. Interestingly, 64 contigs (12.4%) are shared only within flatworms, corresponding to conserved uncharacterized transcripts that might be relevant to parasitism. Also 56 contigs (10.9%) are shared only within metazoans and absent in the non metazoan choanoflagellate Monosiga brevicollis, suggesting that they represent metazoan innovations.

Figure 1
figure 1

Distribution of hits of F. hepatica NEJ contigs against diverse databases. The NEJ contigs generated by the Partigene pipeline were compared by Blast with the set of databases corresponding to diverse taxons (listed in Additional file 2), and the results aggregated by their conservation in diverse taxonomic groups. Groups correspond to sequences finding hits in all taxa tested (common), all metazoans, all bilaterians or exclusively in flatworms or in F. hepatica adult stage ESTs. Sequences producing positive hits with some taxa but not with others (i.e. absent in deuterostomes) are also indicated, and sequences producing no hits are depicted in grey. Sequences producing hits with the adult stage ESTs dataset within each category are indicated in orange in the inner circle.

To further characterize conservation patterns between different metazoan lineages, we analyzed the distribution of tblastx hits by three-way comparisons using the Simitri program [31]. As expected, the F. hepatica predicted genes are more similar to homologues from other trematodes rather than cestodes and turbellaria, and to all flatworms rather than other protostomes, supporting the monophylectic origin of flatworms (Figure 2A, C). Consistent with the reports from the schistosomes genomes, we detected slightly more shared genes (being them also more similar) with the complete genomes of vertebrates than with insects and nematodes [18, 19]. These results further support the idea that ancient genomes were gene rich, and that lineage specific gene gain and loss events were frequent during metazoan evolution, particularly within the ecdysozoans [32]. While the relevance of genes shared between trematodes and their hosts has been highlighted, since they may be crucial for parasite adaptation to the host [33], the inverse situation (genes present in the parasite but absent in their hosts), might provide relevant candidates for anti-parasitic intervention.

Figure 2
figure 2

Three way comparisons of F. hepatica juvenile contigs. The complete set of contigs generated by the Partigene pipeline was compared by tblastx with a set of ESTs or cDNA databases indicated in Additional file 2. The resulting tblastx scores were transformed in coordinates and represented in a triangular graph with Simitri. Each sequence is represented by a dot colour coded by its aggregated blast score and placed in the middle area if found in the three databases, on the corresponding cathetus if found in two databases. Sequences that match in only one of the databases or have no hits are not depicted, but their numbers are indicated. For clarity angle bisector lines were added. Comparisons are shown among (A) trematodes, cestodes, and turbellaria (B) cnidarians, mollusks, and annelids (C) flatworms (excluding F. hepatica), mollusks, and annelids (D) lophotrochozoans (excluding platyhelminths) ecdysozoans, and deuterostomes.

Additionally, since we included in the study partial genomes from other lophotrochozoans (annelids and mollusks) we were able to compare the Fasciola dataset to these organisms and other phyla. This is relevant since flatworm position in modern phylogeny is still debated, being placed either within or as sister group of the lophotrochozoa [34–36]. The conserved set of liver fluke genes is almost equally distant from cnidarians, mollusks, and annelids, but slightly closer to the two lophotrochozoans than the model ecdysozoans or vertebrates (Figure 2B, D, and Additional File 4). The trend in this (and all other comparisons performed) were maintained when including the 4089 F. hepatica adult contigs suggesting that the effects observed might not be due to sampling bias (data not shown). The comparisons here presented are consistent with the placement of flatworms basal to the lophotrochozoans.

Compositional characteristics of F. hepatica predicted proteins

The average G+C content of the F. hepatica ESTs (both juvenile or adult) was 45%, a value substantially higher than in S. mansoni and S. japonicum (34%) [37]. Since variation in GC content can result in skewed codon usage [38], we analyzed the frequency of codons and amino acids of the predicted protein coding sequences in all F. hepatica available assemble ESTs (NEJ and adult stage), and compared it to those observed in other trematodes. As indicated in Figure 3A, there is a detectable difference in codon frequency, between the schistosomes and the other trematodes (including F. hepatica). Schistosomes prefer the most AU rich codon of each synonymous family, and are also strongly biased against C or G in the third codon position confirming early predictions obtained with limited gene sets [39]. More striking is the fact that significant differences were also found at the amino acid level, where schistosomes uses less Arg, Ala and Gly, and are enriched in Asn, Ile and Ser (Figure 3B). In a recent paper the tRNA complement of S. mansoni and S. japonicum is analyzed, but no significant correlation between tRNA copy number with the overall codon usage were found in any of the species [40]. The biological and evolutionary significance of the differences here observed is not clear, and deserves further consideration. In any case, these results raise the question that schistosomes might represent a more divergent than expected model for other trematodes.

Figure 3
figure 3

Codon and amino acid usage in different trematodes. Coding sequences of more than 500 amino acids from diverse trematodes were collected and analyzed for their codon and amino acid usage. The graphs indicate (A) the total frequency of use of each codon in diverse trematodes, (B) the total frequency of use of each amino acid in the diverse trematodes species analyzed: Fasciola hepatica (red) Echinostoma paraensei (yellow) Opisthorchis viverrini (green) Clonorchis sinensis (purple), Schistosoma japonicum (sky-blue) and Schistosoma mansoni (blue).

Gene Ontology classification and functional annotation

Gene Ontology (GO) provides a useful way of classifying and annotating sequence information. Our analysis of the F. hepatica juvenile dataset showed up to 179 NEJ contigs with GO assignment. The molecular function classification showed a predominance of the binding category overlapping with almost all other categorizations, followed by enzymes (catalytic activity) and structural components. The discrimination within the binding class showed three main divisions of similar relevance, two overlapping with enzymes and ribosomal proteins and a set identified as protein and DNA binding associated with regulatory functions (Figure 4A). The more represented biological process categories were linked with metabolism, regulation and development (Figure 4B), showing a consistent assignment of GO cellular components (data not shown). Functional annotation of predicted proteins showed a general representation of the diverse biological functions. Proteases and antioxidant enzymes should be highlighted since they have long been under scrutiny for their putative involvement in invasion and immune evasion processes [9, 10, 41–49]. Novel proteins included ribosomal proteins (Additional File 5) several factors associated with protein and gene expression, cell signaling and apoptosis, as well as orthologues of candidate antigens that induce protection against other helminthiasis. They include tetraspanin-like protein [50], a membrane spanning protein located at the tegument of S. mansoni, Sm22.6 tegument antigen [51], and venom allergen-like (VAL) proteins, a candidate vaccine antigen against Necator americanus and Ancylostoma caninum[52–55].

Figure 4
figure 4

Assignation of the juvenile F. hepatica contigs to the major categories of Gene Ontology. The NEJ contigs generated by the Partigene pipeline were compared with Gene Ontology, and the ontologies recovered mapped to the upper category using an in-house modified version of go-slim. Note that each contig might map to more than one category within each ontology (A) Molecular function assignation: the more abundant categories (binding, catalytic and structural component were further subdivided) (B) Cellular component assignation, as in (A) the metabolic process category was subdivided in its child categories.

Relevant molecules for parasitism

Despite the small size of our juvenile library the more represented sequences included proteinases and antioxidant enzymes previously reported as being predominantly expressed in NEJ [12, 56–60], together with predicted proteins of unknown function conserved only in F. hepatica or in other trematodes but not in other taxa (Table 2).

Table 2 Contigs including more reads in the F. hepatica NEJ ESTs assembly

Secreted cathepsins were among the more represented transcripts in juvenile ESTs, and also in the adult dataset (Table 2, Additional File 6). A more detailed analysis of these transcripts showed that different isoforms are are being expressed by the invading and adult stage. While cathepsins L3, L4 and L6 are detected in the juvenile ESTs, they are absent from the much larger adult dataset (with the exception of cathepsins L4). Proteomic analysis have shown that cathepsins L1 and L2 are clearly predominant in adults, in agreement with the relative abundance of their transcripts in the adult EST database [13] (Additional File 6), and it has been proposed that the repertoire of cathepsin Ls gradually change from those expressed in juveniles to a different set characteristic of the adults worms [13–15]. Interestingly, it has recently been reported that the juvenile predominant cathepsin L3 has a strong collagenase activity, that might result essential for the invasion process [61], while the "adult" cathepsin L1 is involved in hemoglobin degradation [14].

We found evidence that within the less characterized cathepsin B gene family a similar phenomenon might be taking place. The cathepsin B forms that appear as frequent in juveniles are quite distinct to the cathepsin B transcripts found in the adult stage dataset (Additional Files 7 and 8), suggesting that they might also be functionally distinct; cathepsin B1 functions as a digestive enzyme in the juvenile gut [62].

Further evidence that changing repertoires of enzymes within gene families might be a common theme in the parasite adaptation to the diverse environments found in their hosts is provided by the legumains. These enzymes have been proposed to have a relevant role activating other enzymes in helminth proteolytic cascades [12, 13, 63–67]. A novel legumain detected in the juvenile ESTs, legumain 3 has an inverted expression pattern with the previously reported legumain isolated from adult worms (Additional File 9, panels A, B). Besides the already described cathepsins and legumains, the degradome of the juvenile liver fluke was enriched by other proteases, including a novel serine proteinase, calcium-dependent cysteine proteinases (calpains), and components of the proteasome and ubiquitin pathway (Table 3). Proteinase inhibitors like cystatins were also produced by the juvenile larvae. These might modulate parasite proteases on the host immune response as was described for nematode cystatins [68–71].

Table 3 Putative host interacting proteins of NEJ of Fasciola hepatica

Sequences encoding detoxifying enzymes like thireodoxin peroxidase (TPx), superoxide dismutase (SOD), thioredoxin 2, glutation S-transferases and a novel glutathione peroxidase not previously reported in F. hepatica were also found in juveniles, stressing their relevance for immune evasion [72]. In flatworms thioredoxin and glutathione peroxidases are the main enzymes involved in detoxifying reactive oxygen species produced by host immune effector cells [73, 74].

Secreted and surface proteins that may modulate host interactions are considered as relevant targets for vaccine or anti-parasitic drug design [75]. SignalP analysis identified putative signal peptides in 60 NEJ predicted proteins, while 52 had an N-terminal signal anchor peptide. Several putative secreted proteins were novel (with no significant hits) or conserved only in trematodes but not detected in other taxa. Some of these transcripts were among the more represented ESTs in juveniles (Table 2). The repeated detection of these transcripts in partial datasets from diverse trematodes support the notion that they are truly highly expressed genes in trematodes, and may be important mediators for parasitism. We selected Contig FHC00023, a predicted secreted protein of unknown function that is the most frequent in the juvenile ESTs with no homologies outside F. hepatica for further analysis. By real time PCR we found that this transcript is predominantly expressed in the invasive stage confirming the in silico observation (Additional File 9 panel C). The putative ORF is characterized by repeated Ser and Thr residues predicted to be glycosilated, and in further analysis showed faint homology with mucins. Parasite-specific proteins (with no counterparts in vertebrates) like these are ideal targets for development of therapeutic agents since they would have no cross-reactivity with host molecules. The elucidation of the function of these proteins is an important task. The growing availability of functional genomics tools like RNA interference in F. hepatica and model trematodes [76–78] offers some hope this can be accomplished.

Conclusions

The data presented here provides an initial picture of the transcriptional status of the invasive stage of the zoonotic trematode F. hepatica, one of the most common parasites of livestock worldwide, and a relevant agent of human disease in impoverished areas of South America and Asia. Besides confirming previously identified genes involved in the invasion process, we also identified plausible candidates for anti-helminthic intervention. A set of putative F. hepatica specific transcripts, together with other flatworm specific sequences identified, and a group of transcripts absent in their mammalian hosts, provide an initial framework to pinpoint novel targets for future anti-parasitic drugs or vaccine development. The availability of recently developed functional genomic tools in liver fluke offers a platform to start unraveling the function of these novel conserved genes. Furthermore, we detected interesting differences between the models Schistosoma species with other lineages of trematodes, suggesting that genomic and transcriptomic efforts in other flukes might be justified. Comparative studies between diverse trematodes would provide more clues on evolutionary adaptations to parasitism. The richness of information obtained from a limited set of data warrants an in dept analysis of the transcriptome using new multiparallel sequencing technologies.

Methods

Parasites

Fasciola hepatica metacercariae were obtained in our laboratory from experimentally infected Lymnaea viatrix snails and maintained encysted on 0.4% carboxymethyl cellulose until use. Excystment of metacercariae was performed as described previously [15]. Briefly, metacercariae were placed in a 100-μm filter and incubated 5 min with 1% sodium hypochlorite, washed exhaustively with PBS and incubated at 39°C for up to 3 hours in a solution prepared by mixing equal volumes of A (0.4% sodium taurocholate, 120 mM NaHCO3, 140 mM NaCl, pH 8.0 and B (50 mM HCl, 33 mM L-cysteine). The emerging NEJs were collected in a 20 μm-filter with RPMI-1640 medium and used for RNA extraction.

RNA extraction, ligation of RNA adaptors and cDNA synthesis

Total RNA from 1200 NEJs was prepared using the Micro to Midi RNA Extraction Kit (Invitrogen), according to the manufacturer's protocol. Two hundred nanograms of total RNA were used for cDNA synthesis using the protocol described [28]. Briefly, the non capped RNAs were dephosphorylated, and the complete mRNAs were decapped by a pyrophosphatase treatment, and later ligated to the GeneRacer RNA oligo to introduce a 5' priming site in complete mRNAs. After this treatment, first strand synthesis was performed with the reverse transcriptase Superscript III (Invitrogen) using GeneRacer oligo-dT primer (5'GCTGTCAACGATACGCTAC GTAACGGCATGACAGTG(T)183').

Preparation of NEJ cDNA libraries

Amplification of full-length cDNAs was performed by PCR using universal forward (GeneRacer 5'Nested: 5'GGACACTGACATGGACTGAAGGAGTA3') and reverse primers (GenerRacer 3'Nested: 5'CGCTACGTAACGGCATGACAGTG3') provided by the GeneRacer kit. PCR was carried out for 30 cycles (94°C, 45 sec; 68°C 45 sec; 72°C 5 min) using Hot Start Taq DNA polymerase (Fermentas). PCR products were size fractionated in three subpopulations (300-800 bp, 800-2000 bp and >2000 bp) by excision from 1% TBE agarose gels, purified with QIAquick Gel Extraction kit (QIAGEN), ligated to pCR4-TA cloning vectors (Invitrogen), electroporated into One Shot TOP 10 Electrocompetent E. coli (Invitrogen), and plated on LB Amp/X-Gal. Recombinant clones from the libraries were randomly picked, grown in Circle Growth medium and stocked at -80°C in 96-well plates in 30% glycerol.

DNA sequencing and Bioinformatics analysis

Clones were cultured in 96 well plates with Circle Growth media and plasmid DNA was purified by alkaline lysis in 96 well plates. DNA was sequenced with M13 reverse primers using the Dyenamic ET Dye Terminator cycle sequencing kit for MegaBace DNA Analysis Systems (GE Healthcare Life Sciences) according to the manufacturer's instructions.

The sequence reads obtained were processed and analyzed using the Partigene pipeline [29]. Briefly, Trace2dbest [79] processed the chromatograms removing low quality (Phred <15, <150 bp) and vector sequences, and the resulting preprocessed ESTs were assembled in a two-step process carried out by CLOBB [80] and Phrap programs; the resulting contigs and singletons were compared to a set of databases maintained locally (listed in Supplementary Table 1) using tBLASTX and BLASTX. Functional categories were analyzed using annot8r [81]. Signal sequence prediction was performed using SignalP3.0 program [82]. Prediction of trans-membrane domains were conducted using TMHMM software [83]. Blast results comparisons were performed with Simitri [31]. All the available ESTs reads from adult stage of F. hepatica available at the Wellcome Trust Sanger Institute http://www.sanger.ac.uk/Projects/Helminths were downloaded and processed with the same pipeline. The juvenile sequences here obtained were deposited at the dbEST with the accessions GT740211 to GT741887.

Codon usage and amino acid frequencies

For F. hepatica adult and juvenile stages, Echinostoma paraensei, Opistorchis viverrini and Clonorchis sinensis, open reading frames were predicted from the assembled EST data using EMBOSS bioinformatics suite [84]. The longest ORF from each EST was retrieved and the predicted protein sequence was blasted against the NCBI nr databank. ORFs with significant hits were kept for further analysis. For S. japonicum and S. mansoni predicted coding regions obtained through the respective genome projects were analyzed. Codon and amino acid usage was calculated using GCUA: General Codon Usage Analysis tool [85]

Real time PCR

Real time PCR experiments were carried out in an Applied Biosystems 7500 Real time PCR System. Ten microliters of different dilutions of cDNA of NEJ and adult parasites were amplified using 0.2 μM each specific primers, 1.5 mM MgCl2, 25 uM dNTPs, 0.25 U Platinun Taq DNA polymerase (Invitrogen), 1× SYBR Green, 1× PCR buffer in a 20 uL volume reaction. Primers sequences are β-actin (Forward 5'-GTGTTGGATTCTGGTGATGGTGTC-3' and Reverse 5'-CAATTTCTCCTTGAT GTCTCG-3'), FHC00023 (Forward 5'-ATGGTGCGAACGCTAAG-3' and Reverse 5'-GAAGAACGCAACGCCGAAGA-3'), Legumain 1 (Forward 5'-CAAGGATGTTTATGAAGGG-3'and Reverse 5'-TGCTTTGTTCATGCTGGC-3') Legumain 3 (Forward 5'-AGCAGACAAAACCCTTATCGT-3'and Reverse 5'-GGAATAATAGTAGGCGACGTG-3'). Reactions were performed in triplicate using the following PCR amplification conditions, 1 cycle (94°C, 5 min), 40 cycles (94°C, 15 seg; 60°C, 10 seg; 72°C, 15 seg). All results were analyzed using the 2-ΔΔCt method and β-actin as internal control group [86].

Note added in proof

Recently a separate study describing the generation of more than 500,000 sequences from an adult cDNA library using 454 sequencing was published [87]. However, at the time of writing these sequences have not been made publically accessible and hence a comparative analysis of this dataset was not possible.

References

  1. Spithill TM, Smooker PM, Copeman DB: Fasciola gigantica: epidemiology, control, immunology and molecular biology. Edited by: Dalton JP. 1999, Fasciolosis CABI Publishing, Oxin, UK, 465-525.

    Google Scholar 

  2. Mas-Coma S, Bargues MD, Valero MA: Fascioliasis and other plant-borne trematode zoonoses. Int J Parasitol. 2005, 35 (11-12): 1255-1278. 10.1016/j.ijpara.2005.07.010.

    Article  CAS  PubMed  Google Scholar 

  3. Garcia HH, Moro PL, Schantz PM: Zoonotic helminth infections of humans: echinococcosis, cysticercosis and fascioliasis. Curr Opin Infect Dis. 2007, 20 (5): 489-494. 10.1097/QCO.0b013e3282a95e39.

    Article  PubMed  Google Scholar 

  4. Fairweather I: Triclabendazole: new skills to unravel an old(ish) enigma. J Helminthol. 2005, 79 (3): 227-234. 10.1079/JOH2005298.

    Article  CAS  PubMed  Google Scholar 

  5. Fried B: Metacercarial excystment of trematodes. Adv Parasitol. 1994, 33: 91-144. full_text.

    Article  CAS  PubMed  Google Scholar 

  6. Andrews SJ: The life cycle of Fasciola hepatica. Edited by: Dalton JP. 1999, Fasciolosis CABI Publishing, Oxin, UK, 1-29.

    Google Scholar 

  7. Haroun ET, Hillyer GV: Resistance to fascioliasis--a review. Vet Parasitol. 1986, 20 (1-3): 63-93. 10.1016/0304-4017(86)90093-2.

    Article  CAS  PubMed  Google Scholar 

  8. Piacenza L, Acosta D, Basmadjian I, Dalton JP, Carmona C: Vaccination with cathepsin L proteinases and with leucine aminopeptidase induces high levels of protection against fascioliasis in sheep. Infect Immun. 1999, 67 (4): 1954-1961.

    CAS  PubMed Central  PubMed  Google Scholar 

  9. Carmona C, Dowd AJ, Smith AM, Dalton JP: Cathepsin L proteinase secreted by Fasciola hepatica in vitro prevents antibody-mediated eosinophil attachment to newly excysted juveniles. Mol Biochem Parasitol. 1993, 62 (1): 9-17. 10.1016/0166-6851(93)90172-T.

    Article  CAS  PubMed  Google Scholar 

  10. Piedrafita D, Parsons JC, Sandeman RM, Wood PR, Estuningsih SE, Partoutomo S, Spithill TW: Antibody-dependent cell-mediated cytotoxicity to newly excysted juvenile Fasciola hepatica in vitro is mediated by reactive nitrogen intermediates. Parasite Immunol. 2001, 23 (9): 473-482. 10.1046/j.1365-3024.2001.00404.x.

    Article  CAS  PubMed  Google Scholar 

  11. Piedrafita D, Spithill TW, Dalton JP, Brindley PJ, Sandeman MR, Wood PR, Parsons JC: Juvenile Fasciola hepatica are resistant to killing in vitro by free radicals compared with larvae of Schistosoma mansoni. Parasite Immunol. 2000, 22 (6): 287-295. 10.1046/j.1365-3024.2000.00300.x.

    Article  CAS  PubMed  Google Scholar 

  12. Tkalcevic J, Ashman K, Meeusen E: Fasciola hepatica: rapid identification of newly excysted juvenile proteins. Biochem Biophys Res Commun. 1995, 213 (1): 169-174. 10.1006/bbrc.1995.2112.

    Article  CAS  PubMed  Google Scholar 

  13. Robinson MW, Menon R, Donnelly SM, Dalton JP, Ranganathan S: An integrated transcriptomic and proteomic analysis of the secretome of the helminth pathogen, Fasciola hepatica: proteins associated with invasion and infection of the mammalian host. Mol Cell Proteomics. 2009

    Google Scholar 

  14. Robinson MW, Tort JF, Lowther J, Donnelly SM, Wong E, Xu W, Stack CM, Padula M, Herbert B, Dalton JP: Proteomics and phylogenetic analysis of the cathepsin L protease family of the helminth pathogen Fasciola hepatica: expansion of a repertoire of virulence-associated factors. Mol Cell Proteomics. 2008, 7 (6): 1111-1123. 10.1074/mcp.M700560-MCP200.

    Article  CAS  PubMed  Google Scholar 

  15. Cancela M, Acosta D, Rinaldi G, Silva E, Duran R, Roche L, Zaha A, Carmona C, Tort JF: A distinctive repertoire of cathepsins is expressed by juvenile invasive Fasciola hepatica. Biochimie. 2008, 90 (10): 1461-1475. 10.1016/j.biochi.2008.04.020.

    Article  CAS  PubMed  Google Scholar 

  16. Verjovski-Almeida S, DeMarco R, Martins EA, Guimaraes PE, Ojopi EP, Paquola AC, Piazza JP, Nishiyama MY, Kitajima JP, Adamson RE, Ashton PD, Bonaldo MF, Coulson PS, Dillon GP, Farias LP, Gregorio SP, Ho PL, Leite RA, Malaquias LC, Marques RC, Miyasato PA, Nascimento AL, Ohlweiler FP, Reis EM, Ribeiro MA, Sa RG, Stukart GC, Soares MB, Gargioni C, Kawano T, Rodrigues V, Madeira AM, Wilson RA, Menck CF, Setubal JC, Leite LC, Dias-Neto E: Transcriptome analysis of the acoelomate human parasite Schistosoma mansoni. Nat Genet. 2003, 35 (2): 148-157. 10.1038/ng1237.

    Article  PubMed  Google Scholar 

  17. Hu W, Yan Q, Shen DK, Liu F, Zhu ZD, Song HD, Xu XR, Wang ZJ, Rong YP, Zeng LC, Wu J, Zhang X, Wang JJ, Xu XN, Wang SY, Fu G, Zhang XL, Wang ZQ, Brindley PJ, McManus DP, Xue CL, Feng Z, Chen Z, Han ZG: Evolutionary and biomedical implications of a Schistosoma japonicum complementary DNA resource. Nat Genet. 2003, 35 (2): 139-147. 10.1038/ng1236.

    Article  PubMed  Google Scholar 

  18. Berriman M, Haas BJ, LoVerde PT, Wilson RA, Dillon GP, Cerqueira GC, Mashiyama ST, Al-Lazikani B, Andrade LF, Ashton PD, Aslett MA, Bartholomeu DC, Blandin G, Caffrey CR, Coghlan A, Coulson R, Day TA, Delcher A, DeMarco R, Djikeng A, Eyre T, Gamble JA, Ghedin E, Gu Y, Hertz-Fowler C, Hirai H, Hirai Y, Houston R, Ivens A, Johnston DA, Lacerda D, Macedo CD, McVeigh P, Ning Z, Oliveira G, Overington JP, Parkhill J, Pertea M, Pierce RJ, Protasio AV, Quail MA, Rajandream MA, Rogers J, Sajid M, Salzberg SL, Stanke M, Tivey AR, White O, Williams DL, Wortman J, Wu W, Zamanian M, Zerlotini A, Fraser-Liggett CM, Barrell BG, El-Sayed NM: The genome of the blood fluke Schistosoma mansoni. Nature. 2009, 460 (7253): 352-358. 10.1038/nature08160.

    Article  CAS  PubMed Central  PubMed  Google Scholar 

  19. Liu F, Zhou Y, Wang ZQ, Lu G, Zheng H, Brindley PJ, McManus DP, Blair D, Zhang QH, Zhong Y, Wang S, Han ZG, Chen Z: The Schistosoma japonicum genome reveals features of host-parasite interplay. Nature. 2009, 460 (7253): 345-351. 10.1038/nature08140.

    Article  PubMed Central  Google Scholar 

  20. Brindley PJ, Mitreva M, Ghedin E, Lustigman S: Helminth genomics: The implications for human health. PLoS Negl Trop Dis. 2009, 3 (10): e538-10.1371/journal.pntd.0000538.

    Article  PubMed Central  PubMed  Google Scholar 

  21. Knox DP: Technological advances and genomics in metazoan parasites. Int J Parasitol. 2004, 34 (2): 139-152. 10.1016/j.ijpara.2003.10.013.

    Article  CAS  PubMed  Google Scholar 

  22. Adema CM, Leonard PM, DeJong RJ, Day HL, Edwards DJ, Burgett G, Hertel LA, Loker ES: Analysis of messages expressed by Echinostoma paraensei miracidia and sporocysts, obtained by random EST sequencing. J Parasitol. 2000, 86 (1): 60-65.

    Article  CAS  PubMed  Google Scholar 

  23. Cho PY, Kim TI, Whang SM, Hong SJ: Gene expression profile of Clonorchis sinensis metacercariae. Parasitol Res. 2008, 102 (2): 277-282. 10.1007/s00436-007-0759-5.

    Article  PubMed  Google Scholar 

  24. Cho PY, Lee MJ, Kim TI, Kang SY, Hong SJ: Expressed sequence tag analysis of adult Clonorchis sinensis, the Chinese liver fluke. Parasitol Res. 2006, 99 (5): 602-608. 10.1007/s00436-006-0204-1.

    Article  PubMed  Google Scholar 

  25. Lee JS, Lee J, Park SJ, Yong TS: Analysis of the genes expressed in Clonorchis sinensis adults using the expressed sequence tag approach. Parasitol Res. 2003, 91 (4): 283-289. 10.1007/s00436-003-0962-y.

    Article  PubMed  Google Scholar 

  26. Kim TS, de Guzman JV, Kong HH, Chung DI: Comparison of gene representation between diploid and triploid Paragonimus westermani by expressed sequence tag analyses. J Parasitol. 2006, 92 (4): 803-816. 10.1645/GE-723R.1.

    Article  CAS  PubMed  Google Scholar 

  27. Laha T, Pinlaor P, Mulvenna J, Sripa B, Sripa M, Smout MJ, Gasser RB, Brindley PJ, Loukas A: Gene discovery for the carcinogenic human liver fluke, Opisthorchis viverrini. BMC Genomics. 2007, 8: 189-10.1186/1471-2164-8-189.

    Article  PubMed Central  PubMed  Google Scholar 

  28. Fernandez C, Gregory WF, Loke P, Maizels RM: Full-length-enriched cDNA libraries from Echinococcus granulosus contain separate populations of oligo-capped and trans-spliced transcripts and a high level of predicted signal peptide sequences. Mol Biochem Parasitol. 2002, 122 (2): 171-180. 10.1016/S0166-6851(02)00098-1.

    Article  CAS  PubMed  Google Scholar 

  29. Parkinson J, Anthony A, Wasmuth J, Schmid R, Hedley A, Blaxter M: PartiGene--constructing partial genomes. Bioinformatics. 2004, 20 (9): 1398-1404. 10.1093/bioinformatics/bth101.

    Article  CAS  PubMed  Google Scholar 

  30. Zurita M, Bieber D, Ringold G, Mansour TE: cDNA cloning and gene characterization of the mitochondrial large subunit (LSU) rRNA from the liver fluke Fasciola hepatica. Evidence of heterogeneity in the fluke mitochondrial genome. Nucleic Acids Res. 1988, 16 (14B): 7001-7012. 10.1093/nar/16.14.7001.

    Article  CAS  PubMed Central  PubMed  Google Scholar 

  31. Parkinson J, Blaxter M: SimiTri--visualizing similarity relationships for groups of sequences. Bioinformatics. 2003, 19 (3): 390-395. 10.1093/bioinformatics/btf870.

    Article  CAS  PubMed  Google Scholar 

  32. Putnam NH, Srivastava M, Hellsten U, Dirks B, Chapman J, Salamov A, Terry A, Shapiro H, Lindquist E, Kapitonov VV, Jurka J, Genikhovich G, Grigoriev IV, Lucas SM, Steele RE, Finnerty JR, Technau U, Martindale MQ, Rokhsar DS: Sea anemone genome reveals ancestral eumetazoan gene repertoire and genomic organization. Science. 2007, 317 (5834): 86-94. 10.1126/science.1139158.

    Article  CAS  PubMed  Google Scholar 

  33. Venancio TM, DeMarco R, Almeida GT, Oliveira KC, Setubal JC, Verjovski-Almeida S: Analysis of Schistosoma mansoni genes shared with Deuterostomia and with possible roles in host interactions. BMC Genomics. 2007, 8: 407-10.1186/1471-2164-8-407.

    Article  PubMed Central  PubMed  Google Scholar 

  34. Halanych KM: The new view of animal phylogeny. Annual Review of Ecology, Evolution, and Systematics. 2004, 35 (1): 229-256. 10.1146/annurev.ecolsys.35.112202.130124.

    Article  Google Scholar 

  35. Aguinaldo AM, Turbeville JM, Linford LS, Rivera MC, Garey JR, Raff RA, Lake JA: Evidence for a clade of nematodes, arthropods and other moulting animals. Nature. 1997, 387 (6632): 489-493. 10.1038/387489a0.

    Article  CAS  PubMed  Google Scholar 

  36. Dunn CW, Hejnol A, Matus DQ, Pang K, Browne WE, Smith SA, Seaver E, Rouse GW, Obst M, Edgecombe GD, Sorensen MV, Haddock SH, Schmidt-Rhaesa A, Okusu A, Kristensen RM, Wheeler WC, Martindale MQ, Giribet G: Broad phylogenomic sampling improves resolution of the animal tree of life. Nature. 2008, 452 (7188): 745-749. 10.1038/nature06614.

    Article  CAS  PubMed  Google Scholar 

  37. El-Sayed NMA, Bartholomeu D, Ivens A, Johnston DA, LoVerde PT: Advances in schistosome genomics. Trends in Parasitology. 2004, 20 (4): 154-157. 10.1016/j.pt.2004.02.002.

    Article  CAS  PubMed  Google Scholar 

  38. Knight RD, Freeland SJ, Landweber LF: A simple model based on mutation and selection explains trends in codon and amino-acid usage and GC composition within and across genomes. Genome Biol. 2001, 2 (4): RESEARCH0010-10.1186/gb-2001-2-4-research0010.

    Article  CAS  PubMed Central  PubMed  Google Scholar 

  39. Musto H, Alvarez F, Tort J, Maseda HR: Dinucleotide biases in the platyhelminth Schistosoma mansoni. Int J Parasitol. 1994, 24 (2): 277-283. 10.1016/0020-7519(94)90039-6.

    Article  CAS  PubMed  Google Scholar 

  40. Copeland CC, Marz M, Rose D, Hertel J, Brindley PJ, Santana CB, Kehr S, Attolini CS, Stadler PF: Homology-based annotation of non-coding RNAs in the genomes of Schistosoma mansoni and Schistosoma japonicum. BMC Genomics. 2009, 10: 464-10.1186/1471-2164-10-464.

    Article  PubMed Central  PubMed  Google Scholar 

  41. Berasain P, Goni F, McGonigle S, Dowd A, Dalton JP, Frangione B, Carmona C: Proteinases secreted by Fasciola hepatica degrade extracellular matrix and basement membrane components. J Parasitol. 1997, 83 (1): 1-5. 10.2307/3284308.

    Article  CAS  PubMed  Google Scholar 

  42. Berasain P, Carmona C, Frangione B, Dalton JP, Goni F: Fasciola hepatica: parasite-secreted proteinases degrade all human IgG subclasses: determination of the specific cleavage sites and identification of the immunoglobulin fragments produced. Exp Parasitol. 2000, 94 (2): 99-110. 10.1006/expr.1999.4479.

    Article  CAS  PubMed  Google Scholar 

  43. Dalton J, Caffrey C, Sajid M, Stack C, Donnelly S, Loukas A, Don T, McKerrow J, Halton DW, Brindley PJ: Proteases in trematode biology. Parasitic Flatworms: molecular biology, biochemistry, immunology and physiology. Edited by: Maule AG, Marks NJ. 2006, CAB interantional

    Google Scholar 

  44. Donnelly S, O'Neill SM, Sekiya M, Mulcahy G, Dalton JP: Thioredoxin peroxidase secreted by Fasciola hepatica induces the alternative activation of macrophages. Infect Immun. 2005, 73 (1): 166-173. 10.1128/IAI.73.1.166-173.2005.

    Article  CAS  PubMed Central  PubMed  Google Scholar 

  45. Donnelly S, Stack CM, O'Neill SM, Sayed AA, Williams DL, Dalton JP: Helminth 2-Cys peroxiredoxin drives Th2 responses through a mechanism involving alternatively activated macrophages. FASEB J. 2008, 22 (11): 4022-4032. 10.1096/fj.08-106278.

    Article  CAS  PubMed Central  PubMed  Google Scholar 

  46. Jayaraj R, Piedrafita D, Dynon K, Grams R, Spithill TW, Smooker PM: Vaccination against fasciolosis by a multivalent vaccine of stage-specific antigens. Vet Parasitol. 2009, 160 (3-4): 230-236. 10.1016/j.vetpar.2008.10.099.

    Article  CAS  PubMed  Google Scholar 

  47. Dalton JP, McGonigle S, Rolph TP, Andrews SJ: Induction of protective immunity in cattle against infection with Fasciola hepatica by vaccination with cathepsin L proteinases and with hemoglobin. Infect Immun. 1996, 64 (12): 5066-5074.

    CAS  PubMed Central  PubMed  Google Scholar 

  48. Sexton JL, Milner AR, Panaccio M, Waddington J, Wijffels G, Chandler D, Thompson C, Wilson L, Spithill TW, Mitchell GF: Glutathione S-transferase. Novel vaccine against Fasciola hepatica infection in sheep. J Immunol. 1990, 145 (11): 3905-3910.

    CAS  PubMed  Google Scholar 

  49. Morrison CA, Colin T, Sexton JL, Bowen F, Wicker J, Friedel T, Spithill TW: Protection of cattle against Fasciola hepatica infection by vaccination with glutathione S-transferase. Vaccine. 1996, 14 (17-18): 1603-1612. 10.1016/S0264-410X(96)00147-8.

    Article  CAS  PubMed  Google Scholar 

  50. Tran MH, Pearson MS, Bethony JM, Smyth DJ, Jones MK, Duke M, Don TA, McManus DP, Correa-Oliveira R, Loukas A: Tetraspanins on the surface of Schistosoma mansoni are protective antigens against schistosomiasis. Nat Med. 2006, 12 (7): 835-840. 10.1038/nm1430.

    Article  CAS  PubMed  Google Scholar 

  51. Pacifico LG, Fonseca CT, Chiari L, Oliveira SC: Immunization with Schistosoma mansoni 22.6 kDa antigen induces partial protection against experimental infection in a recombinant protein form but not as DNA vaccine. Immunobiology. 2006, 211 (1-2): 97-104. 10.1016/j.imbio.2005.06.004.

    Article  CAS  PubMed  Google Scholar 

  52. Murray J, Gregory WF, Gomez-Escobar N, Atmadja AK, Maizels RM: Expression and immune recognition of Brugia malayi VAL-1, a homologue of vespid venom allergens and Ancylostoma secreted proteins. Mol Biochem Parasitol. 2001, 118 (1): 89-96. 10.1016/S0166-6851(01)00374-7.

    Article  CAS  PubMed  Google Scholar 

  53. Bethony JM, Simon G, Diemert DJ, Parenti D, Desrosiers A, Schuck S, Fujiwara R, Santiago H, Hotez PJ: Randomized, placebo-controlled, double-blind trial of the Na-ASP-2 hookworm vaccine in unexposed adults. Vaccine. 2008, 26 (19): 2408-2417. 10.1016/j.vaccine.2008.02.049.

    Article  CAS  PubMed  Google Scholar 

  54. Goud GN, Zhan B, Ghosh K, Loukas A, Hawdon J, Dobardzic A, Deumic V, Liu S, Dobardzic R, Zook BC, Jin Q, Liu Y, Hoffman L, Chung-Debose S, Patel R, Mendez S, Hotez PJ: Cloning, yeast expression, isolation, and vaccine testing of recombinant Ancylostoma-secreted protein (ASP)-1 and ASP-2 from Ancylostoma ceylanicum. J Infect Dis. 2004, 189 (5): 919-929. 10.1086/381901.

    Article  CAS  PubMed  Google Scholar 

  55. Goud GN, Bottazzi ME, Zhan B, Mendez S, Deumic V, Plieskatt J, Liu S, Wang Y, Bueno L, Fujiwara R, Samuel A, Ahn SY, Solanki M, Asojo OA, Wang J, Bethony JM, Loukas A, Roy M, Hotez PJ: Expression of the Necator americanus hookworm larval antigen Na-ASP-2 in Pichia pastoris and purification of the recombinant protein for use in human clinical trials. Vaccine. 2005, 23 (39): 4754-4764. 10.1016/j.vaccine.2005.04.040.

    Article  CAS  PubMed  Google Scholar 

  56. Harmsen MM, Cornelissen JB, Buijs HE, Boersma WJ, Jeurissen SH, van Milligen FJ: Identification of a novel Fasciola hepatica cathepsin L protease containing protective epitopes within the propeptide. Int J Parasitol. 2004, 34 (6): 675-682. 10.1016/j.ijpara.2003.12.011.

    Article  CAS  PubMed  Google Scholar 

  57. Meemon K, Grams R, Vichasri-Grams S, Hofmann A, Korge G, Viyanant V, Upatham ES, Habe S, Sobhon P: Molecular cloning and analysis of stage and tissue-specific expression of cathepsin B encoding genes from Fasciola gigantica. Mol Biochem Parasitol. 2004, 136 (1): 1-10. 10.1016/j.molbiopara.2004.02.010.

    Article  CAS  PubMed  Google Scholar 

  58. Tkalcevic J, Brandon MR, Meeusen EN: Fasciola hepatica: rapid switching of stage-specific antigen expression after infection. Parasite Immunol. 1996, 18 (3): 139-147. 10.1046/j.1365-3024.1996.d01-65.x.

    Article  CAS  PubMed  Google Scholar 

  59. van Milligen FJ, Cornelissen JB, Bokhout BA: Fasciola hepatica: an antigen fraction derived from newly excysted juveniles, containing an immunoreactive 32-kDa protein, induces strong protective immunity in rats. Exp Parasitol. 2000, 94 (3): 163-171. 10.1006/expr.1999.4476.

    Article  CAS  PubMed  Google Scholar 

  60. Wilson LR, Good RT, Panaccio M, Wijffels GL, Sandeman RM, Spithill TW: Fasciola hepatica: characterization and cloning of the major cathepsin B protease secreted by newly excysted juvenile liver fluke. Exp Parasitol. 1998, 88 (2): 85-94. 10.1006/expr.1998.4234.

    Article  CAS  PubMed  Google Scholar 

  61. Corvo I, Cancela M, Cappetta M, Pi-Denis N, Tort JF, Roche L: The major cathepsin L secreted by the invasive juvenile Fasciola hepatica prefers proline in the S2 subsite and can cleave collagen. Mol Biochem Parasitol. 2009, 167 (1): 41-47. 10.1016/j.molbiopara.2009.04.005.

    Article  CAS  PubMed  Google Scholar 

  62. Beckham SA, Piedrafita D, Phillips CI, Samarawickrema N, Law RH, Smooker PM, Quinsey NS, Irving JA, Greenwood D, Verhelst SH, Bogyo M, Turk B, Coetzer TH, Wijeyewickrema LC, Spithill TW, Pike RN: A major cathepsin B protease from the liver fluke Fasciola hepatica has atypical active site features and a potential role in the digestive tract of newly excysted juvenile parasites. Int J Biochem Cell Biol. 2009, 41 (7): 1601-1612. 10.1016/j.biocel.2009.02.003.

    Article  CAS  PubMed Central  PubMed  Google Scholar 

  63. Brindley PJ, Kalinna BH, Dalton JP, Day SR, Wong JY, Smythe ML, McManus DP: Proteolytic degradation of host hemoglobin by schistosomes. Mol Biochem Parasitol. 1997, 89 (1): 1-9. 10.1016/S0166-6851(97)00098-4.

    Article  CAS  PubMed  Google Scholar 

  64. Sajid M, McKerrow JH, Hansell E, Mathieu MA, Lucas KD, Hsieh I, Greenbaum D, Bogyo M, Salter JP, Lim KC, Franklin C, Kim JH, Caffrey CR: Functional expression and characterization of Schistosoma mansoni cathepsin B and its trans-activation by an endogenous asparaginyl endopeptidase. Mol Biochem Parasitol. 2003, 131 (1): 65-75. 10.1016/S0166-6851(03)00194-4.

    Article  CAS  PubMed  Google Scholar 

  65. Delcroix M, Sajid M, Caffrey CR, Lim KC, Dvorak J, Hsieh I, Bahgat M, Dissous C, McKerrow JH: A multienzyme network functions in intestinal protein digestion by a platyhelminth parasite. J Biol Chem. 2006, 281 (51): 39316-39329. 10.1074/jbc.M607128200.

    Article  CAS  PubMed  Google Scholar 

  66. Dalton JP, Brindley PJ, Donnelly S, Robinson MW: The enigmatic asparaginyl endopeptidase of helminth parasites. Trends Parasitol. 2009, 25 (2): 59-61. 10.1016/j.pt.2008.11.002.

    Article  CAS  PubMed  Google Scholar 

  67. Krautz-Peterson G, Skelly PJ: Schistosome asparaginyl endopeptidase (legumain) is not essential for cathepsin B1 activation in vivo. Mol Biochem Parasitol. 2008, 159 (1): 54-58. 10.1016/j.molbiopara.2007.12.011.

    Article  CAS  PubMed Central  PubMed  Google Scholar 

  68. Gregory WF, Maizels RM: Cystatins from filarial parasites: evolution, adaptation and function in the host-parasite relationship. Int J Biochem Cell Biol. 2008, 40 (6-7): 1389-1398. 10.1016/j.biocel.2007.11.012.

    Article  CAS  PubMed  Google Scholar 

  69. Schierack P, Lucius R, Sonnenburg B, Schilling K, Hartmann S: Parasite-specific immunomodulatory functions of filarial cystatin. Infect Immun. 2003, 71 (5): 2422-2429. 10.1128/IAI.71.5.2422-2429.2003.

    Article  CAS  PubMed Central  PubMed  Google Scholar 

  70. Maizels RM, Gomez-Escobar N, Gregory WF, Murray J, Zang X: Immune evasion genes from filarial nematodes. Int J Parasitol. 2001, 31 (9): 889-898. 10.1016/S0020-7519(01)00213-2.

    Article  CAS  PubMed  Google Scholar 

  71. Manoury B, Gregory WF, Maizels RM, Watts C: Bm-CPI-2, a cystatin homolog secreted by the filarial parasite Brugia malayi, inhibits class II MHC-restricted antigen processing. Curr Biol. 2001, 11 (6): 447-451. 10.1016/S0960-9822(01)00118-X.

    Article  CAS  PubMed  Google Scholar 

  72. Cervi L, Rossi G, Masih DT: Potential role for excretory-secretory forms of glutathione-S-transferase (GST) in Fasciola hepatica. Parasitology. 1999, 119 (Pt 6): 627-633. 10.1017/S003118209900517X.

    Article  CAS  PubMed  Google Scholar 

  73. Salinas G, Selkirk ME, Chalar C, Maizels RM, Fernandez C: Linked thioredoxin-glutathione systems in platyhelminths. Trends Parasitol. 2004, 20 (7): 340-346. 10.1016/j.pt.2004.05.002.

    Article  CAS  PubMed  Google Scholar 

  74. McGonigle S, Curley GP, Dalton JP: Cloning of peroxiredoxin, a novel antioxidant enzyme, from the helminth parasite Fasciola hepatica. Parasitology. 1997, 115 (Pt 1): 101-104. 10.1017/S0031182097001170.

    Article  CAS  PubMed  Google Scholar 

  75. El Ridi R, Tallima H: Schistosoma mansoni ex vivo lung-stage larvae excretory-secretory antigens as vaccine candidates against schistosomiasis. Vaccine. 2009, 27 (5): 666-673. 10.1016/j.vaccine.2008.11.039.

    Article  CAS  PubMed  Google Scholar 

  76. Geldhof P, Visser A, Clark D, Saunders G, Britton C, Gilleard J, Berriman M, Knox D: RNA interference in parasitic helminths: current situation, potential pitfalls and future prospects. Parasitology. 2007, 134 (Pt 5): 609-619. 10.1017/S0031182006002071.

    Article  CAS  PubMed  Google Scholar 

  77. Rinaldi G, Morales ME, Cancela M, Castillo E, Brindley PJ, Tort JF: Development of Functional Genomic Tools in Trematodes: RNA Interference and Luciferase Reporter Gene Activity in Fasciola hepatica. PLoS Negl Trop Dis. 2008, 2 (7): e260-10.1371/journal.pntd.0000260.

    Article  PubMed Central  PubMed  Google Scholar 

  78. McGonigle L, Mousley A, Marks NJ, Brennan GP, Dalton JP, Spithill TW, Day TA, Maule AG: The silencing of cysteine proteases in Fasciola hepatica newly excysted juveniles using RNA interference reduces gut penetration. Int J Parasitol. 2008, 38 (2): 149-155. 10.1016/j.ijpara.2007.10.007.

    Article  CAS  PubMed  Google Scholar 

  79. Schmid R, Blaxter M: EST processing: from trace to sequence. Methods Mol Biol. 2009, 533: 189-220.

    Article  CAS  PubMed  Google Scholar 

  80. Parkinson J, Guiliano DB, Blaxter M: Making sense of EST sequences by CLOBBing them. BMC Bioinformatics. 2002, 3: 31-10.1186/1471-2105-3-31.

    Article  PubMed Central  PubMed  Google Scholar 

  81. Schmid R, Blaxter ML: annot8r: GO, EC and KEGG annotation of EST datasets. BMC Bioinformatics. 2008, 9: 180-10.1186/1471-2105-9-180.

    Article  PubMed Central  PubMed  Google Scholar 

  82. Bendtsen JD, Nielsen H, von Heijne G, Brunak S: Improved prediction of signal peptides: SignalP 3.0. J Mol Biol. 2004, 340 (4): 783-795. 10.1016/j.jmb.2004.05.028.

    Article  PubMed  Google Scholar 

  83. Krogh A, Larsson B, von Heijne G, Sonnhammer EL: Predicting transmembrane protein topology with a hidden Markov model: application to complete genomes. J Mol Biol. 2001, 305 (3): 567-580. 10.1006/jmbi.2000.4315.

    Article  CAS  PubMed  Google Scholar 

  84. Rice P, Longden I, Bleasby A: EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000, 16 (6): 276-277. 10.1016/S0168-9525(00)02024-2.

    Article  CAS  PubMed  Google Scholar 

  85. McInerney JO: GCUA: general codon usage analysis. Bioinformatics. 1998, 14 (4): 372-373. 10.1093/bioinformatics/14.4.372.

    Article  CAS  PubMed  Google Scholar 

  86. Livak KJ, Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods. 2001, 25 (4): 402-408. 10.1006/meth.2001.1262.

    Article  CAS  PubMed  Google Scholar 

  87. Young ND, Hall RS, Jex AR, Cantacessi C, Gasser RB: Elucidating the transcriptome of Fasciola hepatica - a key to fundamental and biotechnological discoveries for a neglected parasite. Biotechnol Adv. 2010, 28 (2): 222-231. 10.1016/j.biotechadv.2009.12.003.

    Article  CAS  PubMed  Google Scholar 

Download references

Acknowledgements

We would like to thank Dr. Henrique Ferreira (UFRGS, Brazil), Dr. Cecilia Fernandez (Fac. Química, UDELAR, Uruguay) and MSc. Daniel Acosta (Fac. Ciencias, UDELAR, Uruguay) for technical expertise and helpful discussions during the course of this work. We thank the Biotechnology Center at UFRGS, Brazil for kindly providing the sequencing facilities for EST generation, and Dr. Edmundo Grisard at the Bioinformatics Laboratory (UFSC, Brazil) for allowing us to use the GARSA pipeline at the initial stage of sequence analysis, Dr. Paul Brindley (George Washington Univ, USA) for critically reading the manuscript, and Dr. Matt Berriman (Wellcome Trust Sanger Institute) for gently allowing us to use the adult F. hepatica ESTs data. These data were generated at the Wellcome Trust Sanger Institute and are available for download from http://www.sanger.ac.uk/Projects/Helminths.

This work was supported by Fundación Manuel Perez, Uruguay, Proy. Binacional DICYT-CNPq, CSIC-Udelar, Pedeciba and INIA-FTPA-252. M.C. and E.S. are recipients of Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq) fellowships.

Author information

Authors and Affiliations

Authors

Corresponding author

Correspondence to José F Tort.

Additional information

Authors' contributions

MC, CC, AZ, & JFT conceived the work. MC, GR, LR & NDO obtained the RNA and generated the libraries. MC, ES, NR & NDO amplified the library and sequenced the clones. NR, PS & FAV organized the analysis pipeline, and MC, NR, NDO & PS processed the sequence data, MC, CC, AZ and JFT wrote the manuscript, which was discussed, improved and corrected by all participant authors. All authors read and approved the final manuscript.

Natalia Ruétalo, Nicolás Dell'Oca contributed equally to this work.

Electronic supplementary material

12864_2009_2821_MOESM1_ESM.TIFF

Additional file 1: Figure S1. cDNA library generation procedure. (A) Diagrammatic representation of the major steps in the cDNA library construction. (B) Details on the full length selection and adapter ligation. (C) Representative PCR products from colonies obtained after size fractionation; left: small size insert library, right: large size insert library. (TIFF 153 KB)

12864_2009_2821_MOESM2_ESM.PDF

Additional file 2: Table S1- Databases used in this study. Details and links to the databases used in this study. (PDF 422 KB)

12864_2009_2821_MOESM3_ESM.PDF

Additional file 3: Table S2- Overview of F. hepatica adult ESTs assembly. Details of the assembly of the available adult stage ESTs with the Partigene pipeline. (PDF 670 KB)

12864_2009_2821_MOESM4_ESM.TIFF

Additional file 4: Figure S2. Three way comparisons of F. hepatica juvenile contigs against early metazoans and model organisms. (A) The complete set of contigs generated by the Partigene compared to ESTs from the early metazoans (non bilaterians) Trichoplax adherens, Porifera (sponges) and Cnidaria (jellyfish and corals). (B) Comparison among the nematode C. elegans, the insect D. melanogaster and the arachnid (thick) I. scapularis. (C) Comparison to the vertebrates D. renio (zebra fish), G. gallus (chicken) and H. sapiens (human). (TIFF 81 KB)

12864_2009_2821_MOESM5_ESM.PDF

Additional file 5: Table S3- Ribosomal proteins detected in NEJ EST assembly. List of ribosomal proteins detected in the juvenile assembly. (PDF 254 KB)

12864_2009_2821_MOESM6_ESM.PDF

Additional file 6: Table S4- Most abundant contigs in the F. hepatica adult EST assembly Details of the contigs containing more reads in the adult stage assembly. (PDF 371 KB)

12864_2009_2821_MOESM7_ESM.TIFF

Additional file 7: Figure S3. Phylogenetic tree of Fasciolidae cathepsins B. Bootstrapped neighbor joining tree of available cathepsin B coding sequences, showing the clustering of juvenile and adult forms. Sequences are color coded by their stage origin: adult stage represented in red rhombs, juveniles in blue triangles and metacercariae in green circles. Contig sequences from ESTs projects (Sanger Center and this study) are unfilled. Sequences from F. gigantica are underlined. Sequences from GeneBank are named following the same criterion of Robinson et al [14], namely the first two characters indicate species (Fh or Fg for F. hepatica or F. gigantica respectively) followed by the cathepsin type, country of origin, accession, stage and P or C for describing partial or complete coding sequences respectively. The "adult" and "juvenile" clusters observed are not due to sample bias since they are maintained when analyzing partial regions corresponding to 5' or 3'ends of the ESTs (data not shown). The nucleotide sequence alignment of the cathepsins B used to generate the tree is available as Additional File 8. (TIFF 208 KB)

12864_2009_2821_MOESM8_ESM.txt

Additional file 8: Supplementary Data S1 - Alignment of cathepsin B sequences. Nucleotide sequence alignment of cathepsin B sequences. (TXT 32 KB)

12864_2009_2821_MOESM9_ESM.TIFF

Additional file 9: Figure S4. Differentially expressed genes in F. hepatica. Transcriptional levels of legumain 1 (A) legumain 3 (B) and Contig FHC00023 (C) were determined by Real time RT-PCR in newly excysted juveniles and adults. Levels were measured by the 2-delta delta CT method using actin as a control for normalization. (TIFF 45 KB)

Authors’ original submitted files for images

Rights and permissions

Open Access This article is published under license to BioMed Central Ltd. This is an Open Access article is distributed under the terms of the Creative Commons Attribution License ( https://creativecommons.org/licenses/by/2.0 ), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Reprints and permissions

About this article

Cite this article

Cancela, M., Ruétalo, N., Dell'Oca, N. et al. Survey of transcripts expressed by the invasive juvenile stage of the liver fluke Fasciola hepatica. BMC Genomics 11, 227 (2010). https://doi.org/10.1186/1471-2164-11-227

Download citation

  • Received:

  • Accepted:

  • Published:

  • DOI: https://doi.org/10.1186/1471-2164-11-227

Keywords