Transcriptomic effects of di-(2-ethylhexyl)-phthalate in Syrian hamster embryo cells: an important role of early cytoskeleton disturbances in carcinogenesis?

  • Yann Landkocz1Email author,

    Affiliated with

    • Pascal Poupin1,

      Affiliated with

      • Franck Atienzar2 and

        Affiliated with

        • Paule Vasseur1

          Affiliated with

          BMC Genomics201112:524

          DOI: 10.1186/1471-2164-12-524

          Received: 11 May 2011

          Accepted: 25 October 2011

          Published: 25 October 2011

          Abstract

          Background

          Di-(2-ethylhexyl)-phthalate (DEHP) is a commonly used plasticizer in polyvinylchloride (PVC) formulations and a potentially non-genotoxic carcinogen. The aim of this study was to identify genes whose level of expression is altered by DEHP by using a global wide-genome approach in Syrian hamster embryo (SHE) cells, a model similar to human cells regarding their responses to this type of carcinogen. With mRNA Differential Display (DD), we analysed the transcriptional regulation of SHE cells exposed to 0, 12.5, 25 and 50 μM of DEHP for 24 hrs, conditions which induced neoplastic transformation of these cells. A real-time quantitative polymerase chain reaction (qPCR) was used to confirm differential expression of genes identified by DD.

          Results

          Gene expression profiling showed 178 differentially-expressed fragments corresponding to 122 genes after tblastx comparisons, 79 up-regulated and 43 down-regulated. The genes of interest were involved in many biological pathways, including signal transduction, regulation of the cytoskeleton, xenobiotic metabolism, apoptosis, lipidogenesis, protein conformation, transport and cell cycle. We then focused particularly on genes involved in the regulation of the cytoskeleton, one of the processes occurring during carcinogenesis and in the early steps of neoplastic transformation. Twenty one cytoskeleton-related genes were studied by qPCR. The down-regulated genes were involved in focal adhesion or cell junction. The up-regulated genes were involved in the regulation of the actin cytoskeleton and this would suggest a role of cellular plasticity in the mechanism of chemical carcinogenesis. The gene expression changes identified in the present study were PPAR-independent.

          Conclusion

          This study identified a set of genes whose expression is altered by DEHP exposure in mammalian embryo cells. This is the first study that elucidates the genomic changes of DEHP involved in the organization of the cytoskeleton. The latter genes may be candidates as biomarkers predictive of early events in the multistep carcinogenic process.

          Background

          Di-(2-ethylhexyl)-phthalate (DEHP) is a commonly used plasticizer in polyvinylchloride (PVC) formulations which have a number of applications, especially in food packaging, medical devices or cosmetics. Phthalates are not chemically bound to PVC and can migrate from PVC-containing products to the environment, resulting in significant environmental contamination and human exposure [1, 2].

          DEHP experiments have revealed toxicities including carcinogenesis and endocrine-disrupting effects, but no genotoxicity has been recorded [3]. DEHP is capable of disturbing the reproductive process by mimicking or antagonizing steroid hormone action [4] and its effects on testosterone, luteinizing hormone or estrogen-like activity have been reported [5, 6]. DEHP has been shown to decrease free testosterone levels in humans after occupational exposure [7] and thyroid hormone levels in adult men otherwise exposed [8].

          DEHP has been classified as a peroxisomal proliferator and as a non-genotoxic carcinogen in animals [9]. Experimental studies using rodents and in vitro assays showed that DEHP and its active metabolite MEHP (mono-(2-ethylhexyl)-phthalate) can interact with nuclear receptors like PPARα [10] or PPARγ [11]. Oxidative stress, as a result of peroxisome proliferation, and DNA damage have been described in the human prostate adenocarcinoma cell line LNCaP [12, 13] and the mouse Leydig tumor cell line MA-10 [14] exposed to high concentrations of DEHP (3 mM). Peroxisome proliferation is one of the mechanisms that produce liver tumors in rats or mice, but this mechanism was not judged to be relevant in humans [15]. The liver is not the sole target for DEHP carcinogenicity: testicular tumors [16] and pancreatic acinar adenomas have also been reported [17]. Other studies have pointed out that peroxisome proliferation is not a necessarily pathway in the carcinogenicity of DEHP [18] and more liver tumors occurred in PPARα-null mice than in wild type animals [19]. Transcriptional changes independent of PPARα were also found in rats and mice exposed to DEHP [20]. Several non-PPARα mechanisms were addressed: activation of p38 mitogen-activated protein kinase not involved in peroxisome proliferations [21]; stimulation of growth regulatory pathways, mitogen-activated protein kinase, extracellular signal-regulated kinase and p38 phosphorylation [22]. Other mechanisms related to non-genotoxic carcinogenicity, like inhibition of gap junctional intercellular communication [23] or inhibition of apoptosis, were reported. Apoptosis was shown to be suppressed by DEHP through different pathways. An interference with the cytokine TGF-β1 (transforming growth factor-β1) [24] or with TNF-α (tumor necrosis factor-α) has been described [25]. An increased level of Bcl-2 and negative regulation of c-Myc expression has been related to inhibition of apoptosis in Syrian hamster embryo cells treated with 50 μM of DEHP [26].

          Several authors have demonstrated that DEHP and its active metabolite MEHP induce morphological transformation of SHE cells [2729], indicating the carcinogenic potency of the two chemicals. Although phthalate toxicity has been extensively investigated over the past 10 years, the mechanisms of DEHP carcinogenicity have not been elucidated. It was recently stated by the International Agency for Research on Cancer (IARC) that PPAR-independent mechanisms of DEHP carcinogenesis are necessary to be studied [http://​monographs.​iarc.​fr/​ENG/​Publications/​techrep42/​TR42-18.​pdf].

          The choice of cellular models and methodologies is critical to the study of the phenomenon of carcinogenesis. Syrian hamster embryo cells are a relevant model for mechanistic studies of chemical carcinogenicity. SHE cells, unlike mouse and rat cells, are less responsive to peroxisomal proliferation and, in this respect, more similar to human cells. SHE cells are normal, diploid, genetically stable and primary cells which are metabolically competent for procarcinogen activation. Therefore they are used to study mechanisms of in vitro carcinogenesis [30]. SHE cells are obtained from embryos after removal of the differentiated tissues, and the population is mainly composed of epithelial and fibroblastic cells [31]. SHE cells from colonies having been morphologically transformed after short exposure to chemical carcinogens induced tumours when transplanted back into hamsters [32]. This validated the model and the cell transformation criteria for in vitro carcinogenicity. Recently, the SHE cell transformation assay has been recommended by OECD in 2007 as in vitro method of screening chemical carcinogens on the basis of its performances to detect non-genotoxic as well as genotoxic carcinogens [http://​www.​oecd.​org/​dataoecd/​56/​5/​37863750.​pdf].

          The aim of this work was to use a global transcriptomic approach to understand the molecular mechanisms of cell transformation induced by DEHP in SHE cells. The objectives were to identify changes in gene expression occurring in the early steps of cell transformation as well as pathway disturbances that may trigger a carcinogenic process. A characterization of the genes expressed in SHE cells at DEHP concentrations inducing cell transformation may give information on PPAR-independent mechanisms and alternative pathways of DEHP carcinogenicity. The transcriptomic changes induced by DEHP in SHE cells were analyzed in the first hours of exposure. We focused secondly on changes of cytoskeleton-related genes underlying morphological transformation in SHE cells. Indeed, cell transformation is expressed by the alteration of cell morphology, a disorganized pattern of colony growth and the acquisition of anchorage-independent growth which is predictive of their ability to induce tumors when injected into syngenic animals [33]. Despite the central role of the actin cytoskeleton throughout the life cycle, little is known about the gene expression changes involved in deregulation of its dynamic in the first stages of tumorigenesis. Cytoskeleton defects in relation to cancer have been mostly studied in the late stages of cell invasion and metastasis.

          Differential Display was chosen to identify differentially-expressed genes in SHE cells and to explore the entire genome. The mRNA differential display described by Liang and Pardee [34] is a powerful approach for transcriptomic analysis. This methodology has become popular as a tool for non-model organisms because of lack of requirement of previous genomic information about the species of interest. As the genome of hamster is partly characterized so far, Differential Display appeared quite appropriate to study DEHP dose-dependent effects in SHE cells. We applied the current methodology that uses a combination of 3 "anchored" oligo-dT primers (to divide the cDNA population in 3 subsets) and 80 "arbitrary" primers of 13-mers. The 240 primer combination allowed us to obtain a level of 95% gene coverage [35].

          DD was applied to cells exposed for 24 hrs to DEHP. Genes corresponding to differentially-expressed fragments were characterized. Differential Display allowed us to screen a set of differentially-expressed fragments in treated cells, among which 122 genes were identified as targeted by a 24 hr-DEHP exposure. These genes were involved in such functions as transcription signalling pathways, cytoskeleton regulation, apoptosis, metabolism. As Differential Display is a semi-quantitative method, the expression changes of the genes we were interested in, were checked by qPCR using hamster specific primers. qPCR was applied to RNAs not only from 24 hr-treated cells, but also from cells treated for 5 hrs in order to study the cell response in the meantime. We particularly focused on changes of cytoskeleton-related genes underlying morphological transformation in SHE cells. The objective was to explain from a mechanistic point of view the gene expression changes after DEHP exposure. To the best of our knowledge, this exercise has never been done previously.

          Results

          Identification of DEHP-responsive genes using Differential Display

          The Differential Display technique was used to identify genes differentially expressed in SHE cells, after 24 hrs of treatment with DEHP. An illustration of differentially-expressed fragments is given in Figure 1 which shows gels obtained after the DD protocol and highlights fragments regulated more than 2-fold by DEHP. Using 3 anchored primers and 80 arbitrary primers, 178 differentially expressed fragments were identified (115 up-regulated and 63 down-regulated). Among these transcripts, 141 (79%) showed homology to known genes in the RefSeq database (mouse or human) of Genbank, while 37 (21%) had no homology or homology to hypothetical proteins. The sequences of the fragments obtained by DD have been deposited in the Genbank dbEST database (LIBEST_027390 Syrian Hamster Embryo cells library). These 141 fragments corresponded to 122 genes that are listed in table 1 with their accession numbers and the tblastx expected (the threshold for tblastx comparison was p ≤ 0.001). These genes were classed according to 8 biological functions with reference to the GO process database. These functions included signal transduction and transcription, cytoskeleton regulation, xenobiotic metabolism, apoptosis, lipidogenesis, protein conformation or transport and cell cycle. The regulation of the cytoskeleton was one of the most impacted pathways. Indeed, 21 genes involved in this function were differentially expressed after DEHP exposure. Ten genes were up-regulated, and 11 were down-regulated.
          http://static-content.springer.com/image/art%3A10.1186%2F1471-2164-12-524/MediaObjects/12864_2011_3673_Fig1_HTML.jpg
          Figure 1

          Representative Differential Display. This figure shows results obtained with control (C), vehicle control (VC) and DEHP-treated (12.5, 25 and 50 μM) SHE cells mRNA, after 24 hrs of exposure. Arrows indicate fragments regulated more than 2-fold and used for the next step of analysis. The DD fragments were generated using the A-anchored primer (H-dT+A) combined with the arbitrary primer H-AP37 (lane a) or H-AP52 (lane b) and the G-anchored primer (H-dt+G) combined with the arbitrary primer H-AP40 (lane c). After characterization by sequencing, we obtained the following genes: a1:Rlp37a/a2:Rlp27a/a3:Col1a1/b1:Cttnbip1/b2: Enah/c1: Coro1C.

          Table 1

          List of genes identified by Differential Display after DEHP exposure and classified by major biological function, according to GO process

          Id

          Official symbol

          Gene Name

          Accession Nr

          Tblastx expect

          Effect of DEHP

          1-Transcription and Signal Transduction

          A0601

          Hsp90

          Heat shock protein 90 kDa protein

          NM_010478

          9E-25

          +

          A0602

          Hsp70

          Heat shock protein 70 kDa protein

          NM_005346

          1E-24

          +

          A3201

          Cebpd

          CCAAT/enhancer binding protein delta

          NM_005195

          9E-10

          -

          A4102

          Ncbp2

          nuclear cap binding protein subunit 2

          NM_007362

          6E-21

          +

          A5101

          Mettl5

          methyltransferase like 5

          NM_029280

          7E-10

          +

          A5102

          Ogt

          O-linked N-acetylglucosamine transferase

          NM_181672

          5E-28

          +

          A6101

          A6102

          Nr1i2

          nuclear receptor subfamily 1I2

          NM_003889

          1E-158

          3E-74

          +

          A6302

          Mapk15

          mitogen-activated protein kinase 15

          NM_177922

          3E-16

          +

          A6801

          Rab1b

          member of RAS oncogene family

          NM_030981

          1E-22

          ++

          A7502

          Mdb1

          methyl-CpG binding domain protein 1

          NM_013594

          2E-16

          --

          C0602

          Gper

          G protein-coupled estrogen receptor 1

          NM_001098201

          6E-68

          +

          C1001

          Hmbox1

          Homeobox 1

          NM_024567

          2E-32

          ++

          C1002

          Mapk3

          mitogen-activated protein kinase 3

          NM_001109891

          9E-60

          -

          C1301

          Usp3

          Ubiquitin peptidase 3

          NM_006537

          9E-34

          +

          C1401

          Psmc5

          26S protease regulatory subunit ATPase 5

          NM_002805

          2E-23

          -

          C4601

          Hsph1

          heat shock 105kDa/110kDa protein

          NM_006644

          5E-07

          +

          C4802

          Irf2

          interferon regulatory factor 2

          NM_008391

          8E-19

          +

          C7101

          Lmo4

          LIM domain only 4

          NM_006769

          7E-09

          +

          G0301

          Smarcc1

          SWI/SNF related actin dependent regulator of chromatin

          NM_003074

          3E-20

          -

          G1001

          Chd4

          ATP dependant hélicase 4

          NM_001273

          1E-45

          -

          G1504

          Foxp1

          Forkhead box P1

          NM_032682

          3E-50

          ++

          G1701

          Creb3l1

          cAMP responsive element binding protein 3-like 1

          NM_052854

          8E-19

          +

          G1902

          Pbrm

          Polybromo domain

          NM_001081251

          8E-49

          +

          G3301

          Rxfp2

          relaxin/insulin-like family peptide receptor 2

          NM_130806

          1E-24

          +

          G3501

          Akap5

          A kinase anchor protein 5

          NM_004857

          1E-05

          +

          G3801

          G7001

          Eif1

          eukaryotic translation initiation factor 1

          NM_005801

          3E-42

          1E-15

          +

          G4801

          Spry3

          sprouty homolog 3

          NM_005840

          0.0002

          +

          G6001

          Foxa3

          forkhead box A3

          NM_008260

          9E-17

          -

          G6201

          Mett5d1

          methyltransferase 5 containing 1

          NM_029790

          0.0038

          +

          2-Regulation of cytoskeleton

          A0201

          Cttnbp2

          Cortactin binding protein 2

          NM_030249

          0.0001

          +

          A1901

          Snx6

          sorting nexin 6

          NM_021249

          8E-10

          -

          A2401

          Lrrc8a

          leucine rich repeat containing 8A

          NM_177725

          5E-32

          -

          A3501

          A3502

          C3501

          G3502

          G3503

          Actb

          beta-actin

          NM_007393

          3E-51

          1E-106

          2E-21

          7E-114

          3E-48

          +

          A3702

          Col1a1

          collagen, type I, alpha 1

          NM_000088

          1E-21

          +

          A3801

          Nrp2

          neuropilin 2

          NM_0010774

          1E-22

          -

          A5201

          Ctnnbip1

          catenin beta interacting protein 1

          NM_020248

          0.0008

          -

          A5202

          Enah

          enabled homolog

          NM_008680

          2E-09

          -

          A5402

          Kif23

          kinesin family member 23

          NM_024245.4

          1E-25

          ++

          A7501

          Cdh3

          cadherin 3

          NM_007665

          0.0007

          -

          C4502

          Nid2

          nidogen 2

          NM_008695

          0.006

          -

          C6603

          C6604

          C6605

          Crip1

          cysteine-rich protein 1

          NM_007763

          1E-31

          9E-08

          3E-61

          +

          G0601

          Thy1

          Thy-1 cell surface antigen

          NM_009382.3

          0.001

          -

          G0801

          Calml3

          calmodulin-like 3

          NM_027416.3

          0.0004

          +

          G1102

          Flrt2

          fibronectin leucine rich transmembrane protein 2

          NM_201518

          2E-08

          -

          G1301

          Has2

          hyaluronan synthase 2

          NM_008216

          8E-18

          -

          G1901

          Plekha5

          Pleckstrin homology domain A5

          NM_019012

          3E-06

          +

          G2301

          Thbs1

          thrombospondin 1

          NM_011580

          3E-20

          -

          G4001

          Coro1C

          coronin, actin binding protein

          NM_014325

          4E-07

          +

          G4802

          Tubb2b

          Tubulin beta

          NM_023716

          0.0001

          +

          G6901

          Dclk1

          doublecortin-like kinase 1

          NM_019978

          1E-06

          +

          3-Xenobiotic metabolism

          A0901

          Cyp2e1

          Cytochrome P450 2e1

          NM_021282

          3E-44

          +

          A2901

          Ephx1

          Epoxide Hydrolase 1

          NM_000120

          4E-21

          +

          A5701

          Gstp1

          glutathione S-transferase, pi 1

          NM_000852

          1E-24

          +

          A6601

          Gstt1

          glutathione S-transferase, theta 1

          NM_008185

          1E-44

          -

          C0101

          C1501

          G1502

          Txnrd1

          Thioredoxin reductase 1

          NM_001042523

          1E-20

          1E-14

          3E-79

          +

          C2901

          Cyp1b1

          Cytochrome P450 1b1

          NM_009994

          0.0

          +

          C3101

          Gstm5

          glutathione S-transferase, mu 5

          NM_010360

          4E-51

          -

          C3701

          Tnfa

          tumor necrosis factor-alpha

          NM_011659

          0.00009

          +

          G0101

          Psme4

          proteasome activator subunit 4

          NM_134013

          4E-87

          +

          G0701

          Mt2a

          metallothionein 2A

          NM_005953

          7E-20

          -

          G1201

          Ggt1

          gamma-glutamyltransferase 1

          NM_013430

          3E-46

          +

          G1501

          Txnrd2

          Thioredoxin reductase 2

          NM_006440

          9E-19

          +

          G2001

          Pdia4

          Disulfite Isomerase 4

          NM_004911

          5E-46

          +

          G2202

          Ahcy

          S-adenosylhomocystein hydrolase

          NM_016661

          1E-10

          -

          G2302

          Cyp2f2

          Cytochrome P450 2f2

          NM_007817

          9E-25

          --

          G3302

          Cytb

          Mesocricetus auratus cytochrome b

          YP_003208313

          9E-86

          ++

          4-Apoptosis

          A4301

          Pik3r1

          phosphatidylinositol 3-kinase

          NM_001024955

          1E-80

          +

          C1701

          Tp53

          tumor supressor p53

          U07182

          6E-83

          -

          C7103

          G3701

          Bcl10

          B-cell CLL/lymphoma 10

          NM_003921

          4E-37

          5E-82

          +

          G1503

          Nfkb1

          NF-κB

          NM_008689

          2E-102

          +

          G2201

          Casp8

          Caspase 8

          NM_009812

          6E-29

          -

          G2305

          Eef1d

          Eukaryotic translation elongation factor 1 delta

          NM_029663

          3E-17

          +

          G3001

          Topors

          topoisomerase I p53-binding

          NM_134097

          4E-10

          -

          G4101

          G4102

          Sh3kbp1

          SH3-domain kinase binding protein 1

          NM_031892

          1E-09

          0.0008

          +

          G5301

          Cmyc

          myelocytomatosis oncogene

          AJ582076

          2E-27

          -

          5-Lipidogenesis

          A0501

          Pla2g2d

          phospholipase A2, group IID

          NM_011109

          0.00003

          +

          A3003

          Dhcr7

          dehydrocholesterol reductase

          NM_007856

          3E-36

          +

          C0701

          Scl27a1

          solute carrier family 27A1

          NM_198580

          0.0

          +

          C0901

          Acaa1

          Acetyl-CoA acyltransferase 1

          NM_130864

          1E-77

          +

          C4602

          Lpl

          lipoprotein lipase

          NM_008509

          1E-37

          -

          G0201

          Star

          steroidogenic acute regulatory protein

          NM_011485

          7E-08

          -

          6-Protein conformation or transport

          A3801

          Rpn1

          ribophorin I

          NM_133933

          3E-14

          -

          A4701

          Ergic3

          ERGIC and golgi 3

          NM_198398

          6E-21

          +

          A5302

          Gxylt1

          glycosyltransferase 8 domain containing 3

          NM_173601

          0.0002

          +

          C0601

          Ppia

          peptidylprolyl isomerase A

          NM_021130

          7E-71

          +

          C2001

          Grpel1

          GrpE-like 1, mitochondrial

          NM_024478

          1E-13

          +

          C2201

          Fxn

          frataxin

          NM_008044

          4E-33

          +

          C3602

          Slc26a9

          solute carrier family 26, member 9

          NM_177243

          1E-9

          +

          C7501

          Slc13a3

          solute carrier family 13 member 3

          NM_054055

          3E-29

          -

          G1801

          Slc15a1

          Solute carrier family 15 member 1

          NM_053079

          0.0002

          -

          G3702

          Rpn2

          ribophorin II

          NM_019642

          3E-26

          -

          G6101

          Nrbp1

          nuclear receptor binding protein 1

          NM_013392

          4E-12

          +

          G6601

          Slc6a8

          solute carrier family 6 member 8

          NM_005629

          0.0001

          -

          7-Cell cycle

          A0401

          Ingap

          Mesocricetus auratus islet neogenesis associated protein

          U41738

          4E-79

          -

          A3002

          Cdkn2b

          cyclin-dependent kinase inhibitor 2B

          NM_004936

          1E-9

          -

          A4801

          Ppp1cc

          protein phosphatase 1, catalytic subunit, gamma

          NM_002710

          2E-78

          +

          A5702

          Sec11a

          SEC11 homolog A

          NM_014300

          1E-19

          +

          C4002

          Mapk4

          mitogen-activated protein kinase 4

          NM_002747

          9E-26

          +

          C4701

          Ccndbp1

          cyclin D-type binding-protein 1

          NM_010761

          1E-17

          +

          C6301

          C6302

          Zw10

          ZW10 homolog centromere/kinetochore protein

          NM_004724

          1E-04

          1E-05

          -

          8-Other functions

          A3903

          Rexo2

          REX2, RNA exonuclease 2 homolog

          NM_015523

          6E-21

          -

          A5403

          Hk2

          hexokinase 2

          NM_000189

          4E-28

          +

          A5602

          Pcbp2

          poly(rC)-binding protein 2

          NM_031989

          1E-34

          +

          A7301

          Lyrm4

          LYR motif containing 4

          NM_201358

          0.0004

          -

          C1801

          Itpripl2

          inositol 1,4,5-triphosphate receptor Interacting protein-like 2

          NM_001033380

          4E-11

          +

          C2401

          Tsn

          translin

          NM_011650

          4E-10

          +

          C4501

          Trip4

          thyroid hormone receptor interactor 4

          NM_016213

          0.0006

          -

          C7102

          Tbrg3

          transforming growth factor beta regulated gene 3

          NR_027799

          0.001

          +

          G0101

          Psme4

          proteasome activator subunit 4

          NM_014614

          4E-87

          +

          G0501

          Gatad2a

          GATA zinc finger domain containing 2A

          NM_001113346

          8E-15

          +

          G0901

          Hoxa10

          Homeobox A10 (HOXA10)

          NM_008263

          1E-47

          +

          G1101

          Iap

          Syrian hamster intracisternal A particle

          M10134

          3E-73

          +

          G2303

          Zc3h12c

          zinc finger CCCH type containing 12C

          NM_001162921

          7E-9

          -

          G6801

          Fst

          follistatin

          NM_006350

          3E-42

          -

          Ribosomal proteins

          A3703

          Rpl37a

          ribosomal protein L37a

          NM_000998

          0.001

          +

          A3901

          C3901

          Mrpl45

          mitochondrial ribosomal protein L45

          NM_025927

          2E-10

          6E-59

          -

          A3902

          Rps21

          ribosomal protein S21

          NM_001024

          7E-14

          +

          A4001

          ./.

          mitochondrial 12S ribosomal RNA

          X84390

          0.0

          +

          G2002

          Rpl27a

          60S ribosomal protein L27a

          NM_000990

          5E-18

          +

          G3504

          Rpl10

          ribosomal protein L10

          NR_026898

          4E-132

          +

          G3601

          G3602

          Rpl28

          ribosomal protein L28

          NM_009081

          3E-22

          8E-180

          +

          G5701

          Rpl22

          ribosomal protein L22

          NM_000983

          0.00009

          +

          The DEHP effect is identified by (+) for 2.0-fold over-expression, (++) for 10-fold over-expression, (-) for 2.0-fold under-expression and (--) for 10.0-fold under-expression for at least one dose of DEHP. The 37 Differential Display fragments showing no match after comparison with the RefSeq database were not listed in the table. Id (Identification Number) represents the internal reference of the sequence used before the identification of Differential Display sequence.

          Transcription and signal transduction is another biological process targeted by DEHP treatment. We found 22 up-regulated genes, among which 3 were up-regulated more than 10-fold (rab1b, a Ras oncogen family member, Homeobox 1 and Forkhead P1). Heat- shock response related genes (hsp90, hsp70 and hsph1) and the genes involved in promoter methylation (mettl5, mett5d1) were up-regulated. On the other hand, 7 genes were down-regulated (CCAAT/enhancer binding protein delta, methyl-CpG binding domain protein 1, Map kinase 3, Protease subunit 5, SWI/SNF related actin dependent regulator of chromatin, ATP dependent helicase 4 and Forkhead A3).

          Xenobiotic metabolism genes such as cytochromes and glutathione S-transferases were also found to be differentially expressed, indicating a mobilization of cellular defence and detoxication systems. An up-regulation of cyp1b1 and cyp2e1 was registered, whereas cyp2f2 was found to be down-regulated. Concerning GST, the Pi family was over-expressed while the Theta and Mu families were down-regulated.

          Differential Display results confirmed the down-regulation of c-myc and showed down-regulation of p53. A down-regulation of pro-apoptotic genes (casp8, topors...) and an over-expression of anti-apoptotic genes (bcl10, nfkb1, sh3kbp1...) were also observed.

          Expression of genes involved in the regulation of the cytoskeleton by qPCR

          The mRNA level of the 21 genes involved in the regulation of the cytoskeleton that were identified as differentially expressed after 24 hrs was confirmed by qPCR. The expression of these genes was also studied after exposure to DEHP for 5 hrs. Out of the 21 genes, four (coro1C, kif23, cdh3 and cttnbip1) were significantly up-regulated by DEHP treatment after 5 hrs of exposure (Figure 2) and one (nrp2) was significantly down-regulated. A clear dose-response relationship was observed for these 5 genes. After 24 hrs, these changes were confirmed for 3 genes (up-regulation of coro1C and kif23, and down-regulation of nrp2; Figure 3). Nevertheless, the down- and up-regulation was more pronounced after 24 hrs than after 5 hrs of DEHP exposure, for nrp2 and kif23 respectively. For instance, in cells exposed to 50 μM of DEHP, Kif23 was up-regulated 17-fold at 24 hrs versus 3-fold at 5 hrs. After 24 hrs, 5 other genes were significantly up-regulated (col1A1, crip1, calml3, dclk, and cttnbp2) by a factor ranging from 2.0 to 4.5 with a dose-related effect (Figure 3). Eight other genes were significantly down-regulated (thbs1, flrt2, cdh3, has2, enah, ctnnbip1, lrrc8a and snx6), with an expression ratio between 0.2 and 0.5 (corresponding to 5 and 2 fold down-regulation respectively). All these genes were down-regulated in a dose-dependent manner, except for cdh3, enah, ctnnbip1, lrrc8a and snx6. A threshold was observed with the latter genes (12.5 μM for cdh3; 50 μM for enah, ctnnbip1, lrrc8a and snx6). Ctnnbip1 was significantly down-regulated only for the lowest dose of DEHP (12.5 μM).
          http://static-content.springer.com/image/art%3A10.1186%2F1471-2164-12-524/MediaObjects/12864_2011_3673_Fig2_HTML.jpg
          Figure 2

          Representative qPCR results of differentially-expressed genes involved in cytoskeleton regulation (according to the GO process), identified by Differential Display after 5 hrs of SHE cell exposure to DEHP. These histograms show the ΔΔCt score normalized by gapdh mRNA level. Error bars represent the standard deviation of the ΔΔCt score. Only mRNA levels showing a two-fold increase or decrease at least, were considered indicative (*) of a change in gene expression.

          http://static-content.springer.com/image/art%3A10.1186%2F1471-2164-12-524/MediaObjects/12864_2011_3673_Fig3_HTML.jpg
          Figure 3

          Representative qPCR results of differentially-expressed genes involved in cytoskeleton regulation (according to the GO process), identified by Differential Display after 24 hrs of SHE cell exposure to DEHP. These histograms show the ΔΔCt score normalized by gapdh mRNA level. Error bars represent the standard deviation of the ΔΔCt score. Only mRNA levels showing a two-fold increase or decrease at least, were considered indicative (*) of a change in gene expression.

          Although they had been identified as differentially expressed in DD, five genes (thy1, tubb2b, β-actin, plekha5 and nid2) were not shown to be significantly over- or under-expressed by qPCR. Yet the expression profiles of these genes indicated a dose-related increase for tubb2b, β-actin and pleckha5 but below the qPCR 2.0-fold threshold. As for thy1 and nid2, the dose-related decrease was inferior to 0.5.

          Expression of apoptosis-related genes, PPARs and CYP4 genes after DEHP treatment

          The expression level of bcl-2 and c-myc mRNA was used as controls of DEHP effects. An increased level of bcl-2 after 5 hrs of exposure and a decreased level of c-myc after 24 hrs (Figure 4) were observed according to qPCR, as expected.
          http://static-content.springer.com/image/art%3A10.1186%2F1471-2164-12-524/MediaObjects/12864_2011_3673_Fig4_HTML.jpg
          Figure 4

          Expression level ofbcl-2, c-myc, p53, pi3kr1, PPARs and CYP4 family gene mRNA after treatment of SHE cells with DEHP, using qPCR. These histograms show the ΔΔCt score normalized by the gapdh mRNA level. Error bars represent the standard deviation of the ΔΔCt score. Only mRNA levels showing a two-fold increase or decrease at least, were considered indicative (*) of a change in the gene expression. We observed a significant increase in the bcl-2 mRNA level after 5 hrs of exposure and a significant decrease in c-myc and p53 mRNA levels after 24 hrs of DEHP exposition. Pi3kr1 was found to be over-expressed for both lengths of exposure. None of PPARs or CYP4 genes was significantly over- or under-expressed after treatment.

          p53 was down-regulated in a dose- and time-dependent manner; a significant decrease of the mRNA level was found after 24 hrs at 50 μM DEHP.

          None of the PPAR genes was identified as being differentially expressed by DD after DEHP exposure. In order to check these results, we measured the mRNA level of PPARα, PPAR β/δ and PPAR γ, by qPCR using hamster specific primers. No change in the expression of these genes was observed by qPCR after 5 or 24 hrs of exposure with DEHP in our study conditions (Figure 4). The same verification was carried out for CYP4 genes. Neither Differential Display nor qPCR allowed us to identify significant expression changes compared to the control.

          Discussion

          The DDRT-PCR (Differential Display RT-PCR) technique was used in the present study to identify the differential mRNA expression patterns between control and DEHP-treated SHE cells. Indeed, this technique is still a method of choice for non-sequenced or partially-sequenced organisms and is able to identify nonabundant, rare or novel transcripts [36].

          Using Differential Display, we found 122 genes whose expression was altered by DEHP treatment (79 up-regulated and 43 down-regulated). The concentrations studied (12.5, 25 and 50 μM) were in the range of concentrations that induced a morphological transformation of SHE cells, i.e. concentrations up to 77 μM for Mikalsen et al. [27] and in the range 25 μM-150 μM for Cruciani et al. [29].

          We measured the mRNA level of genes involved in the regulation of the cytoskeleton using qPCR. This focus is justified by the fact that the modifications of cytoskeleton organization are early events in cell neoplastic process [37] and can be recorded in SHE cells after 7 days of exposure to carcinogenic agents in cell transformation assays. Morphological transformation affects a few percentage of the mixed population of SHE cells and all cell types [31]. From the present work, we can assume that the differentially-expressed genes measured in the first 24 hrs of exposure reflect the first targets of DEHP in the entire SHE cell population. The transcriptomic changes which were recorded correspond to the integrated mean of the cell responses significantly different in the exposed populations (p < 0.01), without consideration of cell specificity and sensitivity to DEHP. These significant expression changes in genes involved in cytoskeleton regulation, can be seen as early indicators of disturbances that will lead to cell transformation further in a few percentage of the most susceptible cells of the SHE population. The role of the cytoskeleton has been extensively studied in relation to invasion and metastasis, but little is known of its implication in the first stages of carcinogenesis. The identification of genomic changes associated with the triggering of cell transformation is useful from a mechanistic point of view and may be valuable in screening.

          Effects on cytoskeleton-related genes

          DEHP was shown to affect several functions related to the cytoskeleton. The genes involved in cytoskeleton regulation and identified by Differential Display are listed in table 2. To summarize, DEHP affects actin polymerisation and stabilization, as well as cell-to-cell and cell-to-matrix adhesion processes. The expression of genes involved in organelle transport, in cytoskeleton remodelling, or adhesion in response to external factors was also modified by DEHP. These results are in line with the recent findings of Posnack et al. [38] who identified disturbances in mechanical adhesion function and protein trafficking in rats cardiomyocytes exposed to DEHP.
          Table 2

          List of genes involved in the regulation of the cytoskeleton and affected by DEHP

           

          5 hrs

          24 hrs

          Up-regulated genes

          coro1C* (25 - 50 μM)

          kif23* (25 - 50 μM)

          cdh3* (12.5 - 25 - 50 μM)

          ctnnbip1* (25 μM)

          coro1C* (25 - 50 μM)

          kif23* (25 - 50 μM)

          col1a1* (50 μM)

          crip1* (25 - 50 μM)

          calml3* (12.5 - 25 - 50 μM)

          dclk1* (25 - 50 μM)

          cttnbp2* (50 μM)

          plekha5

          tubb2b

          β-actin

          Down-regulated genes

          nrp2* (25 - 50 μM)

          nrp2* (25 - 50 μM)

          thbs* (50 μM)

          flrt2* (50 μM)

          cdh3* (12.5 - 25 - 50 μM)

          has2* (50 μM)

          enah* (50 μM)

          lrcc8a* (50 μM)

          snx6* (50 μM)

          ctnnbip1* (12.5 μM)

          nid2

          thy1

          This table summarizes the genes studied using qPCR. (*) indicates significant effects of DEHP (2.0-fold over- or under-expression) at concentration(s) specified in brackets. A trend for up- or down-regulation was found for the other genes (no concentration reported).

          Actin polymerization and stabilization

          To summarize the basic process, actin polymerization requires the Arp2/3 complex that needs to be stabilized by Enable Homolog (Enah) and is regulated by coronins. Enah is involved in the dynamic reorganization of the actin cytoskeleton, and stimulates nucleation and polymerization [39]. Coronins act on F-actin binding and bundling activities, but are able to inhibit the activity of Arp2/3 complex [40]. Actin polymers also require cortactin, which stabilizes nucleation sites for actin branching and elongation [41, 42]. Crip1 facilitates actin filament bundling and stabilizes actin interaction with α-actinin too [43]. Linkage of actin polymers to adherens junctions, mainly composed of the transmembrane proteins cadherins, is insured through binding to α-catenin and β-catenin [44].

          Based on the gene expression data generated, we have tried to synthesize the effects of DEHP on actin organisation and cell adhesion specifically (Figure 5; over-expression in red; under-expression in green). A 5- and 24-hrs exposure to DEHP over-expressed Coronin 1C (Coro1C), resulting in F-actin disassembly [45]. Disorganization was amplified by under-expression of Enah involved in actin nucleation and polymerization, and expression of Cttnbp2 that counteracts cortactin which is known to stabilize the actin network. On the other hand, the binding of actin filaments to cadherins through catenin links appears to be reinforced owing to under-expression of Ctnnbip1 (a β-catenin blocker) and over-expression of Crip1, which intensifies fixation to actinin. Globally, the effects of DEHP on actin cytoskeleton disturb actin polymerization while intensifying binding on actinin and catenins. Posnack et al. [38] explored DEHP effects on rats cardiomyocytes in a range of concentrations two and three orders of magnitude higher than here. They found an over-expression of actinin, α-catenin and N-cadherin in a concentration-dependent manner.
          http://static-content.springer.com/image/art%3A10.1186%2F1471-2164-12-524/MediaObjects/12864_2011_3673_Fig5_HTML.jpg
          Figure 5

          Representative scheme of the genes affected by DEHP and involved in cytoskeleton regulation. Genes in red have been found to be over-expressed using Differential Display (DD) and genes in green under-expressed. Dotted lines represent genes identified by DD but whose expression was not significant in qPCR.

          Cell-cell and cell-matrix adhesion

          Cell-cell adhesion and cell-matrix adhesion were also affected by DEHP treatment. The decrease in the P-Cadherin (Cdh3) mRNA level after 24 hrs of exposure indicates that DEHP weakened cell-cell contact, after a transient increase at 5 hrs of exposure for all doses tested. Weakening of cell-matrix adhesion may result from a decrease in the Hyaluronan synthase 2 (has2) mRNA level [46] and in Thrombospondin (Thbs1), an adhesive protein that interacts with fibronectin, laminin, integrins and collagen [47]. Loss of cell adhesion may also be explained by over-expression of Coro1C because this gene negatively regulates cell-matrix adhesion through focal adhesion kinase (FAK)-mediated signalling [45]. Also, under-expression of Enah, which is known to be involved in the control of cellular adhesion by the recruitment of proteins containing SH3- domain [48], contributes to the loss of cell-cell adhesion.

          In addition, DEHP may lessen extracellular matrix adhesion by reducing the expression level of a number of transmembrane proteins involved in cell-matrix connections: Fibronectin leucine rich 2 (Flrt2) and Leucine rich repeat 8A (Lrrc8a) [49], Nidogen 2, which connects laminin-1 to the matrix [50], and Thy-1, which mediates fibroblastic adhesion [51] and is Thbs1 expression-dependent [52]. On the other hand, DEHP effects reinforce the extra-cellular matrix through an over-expression of col1A1 increasing collagen. This effect may be seen as a compensatory reaction to the weakening of cell-to-matrix link proteins by DEHP. Sobarzo et al. [53] demonstrated an up-regulation of N-cadherin and α-catenin in rat testis after 2 and 7 days of DEHP treatment, suggesting also a deregulation of cell adhesion molecules in seminiferous tubules.

          DEHP decreases the response to external factors, such as the Vascular Endothelial Growth Factor (VEGF) or the Epidermal Growth Factor (EGF) through under-expression of neuropilin 2 (nrp2) and sorting nexin 6 (snx6) respectively. Nrp2 is a membrane receptor capable of binding VEGF and semaphorins, therefore its under-expression may inhibit cell adhesion and migration via the loss of integrins [54]. Snx6 is able to interact with EGF receptor and Transforming Growth Factor (TGF)-β receptor [55]. Under-expression of snx6 and thbs1 may lead to decreased interaction with Latent TGF Binding Protein (LTBP) in the upstream of the TGF-β pathway contributing to the repression of the TGF-β signaling pathway [56, 57]. Under-expression of TGF-β is known to decrease apoptosis in rodent hepatocytes treated with peroxisome proliferators (PPs) [24].

          Organelle transport and cytoskeleton remodelling

          DEHP also interferes with functions of microtubules (composed of α- and β-tubulin). Kif23, which encodes a kinesin protein, was highly over-expressed after 5 hrs and 24 hrs of DEHP exposure. Kif23 has been shown to transport membranous organelles and protein complexes from cell nucleus to cell periphery in a microtubule- and ATP-dependent manner. Doublecortin-like kinase (Dclk) is a microtubule-associated protein encoding a Ca2+/calmodulin-dependent kinase. Its activities on binding and microtubule polymerization facilitate cell motility by remodelling the microtubule cytoskeleton [58]. Over-expression of dclk at 24 hrs of DEHP treatment is in line with an increased trend in β-tubulin (tubb2b).

          Calmoduline-like 3 (calml3) was over-expressed after 24 hrs of DEHP exposure. Calmodulin (CaM) is a calcium-binding protein that translates the Ca2+ signal into a wide variety of cellular processes, including the regulation of cytoskeleton remodelling acting with Caldesmon [59] or with Wnt pathway [60]. Calml3 is a CaM family member protein which increases cell motility by stabilizing and increasing myosin-10 for cell migration [61].

          Other genes involved in signal transduction pathways and cytoskeleton regulation

          We measured an over-expression level of phosphatidylinositol 3-kinase r1 (pi3kr1) using Differential Display and qPCR. Pi3k is a key signalling molecule in the PIP3 signalling transduction pathway and in actin reorganization and cell adhesion [62] and is able to regulate the synthesis of collagen I [63]. An activation of PI3K is also associated with a phosphorylation-dependent activation of Akt which contributes to tumorigenesis and metastasis [39]. The over-expression of pi3kr1 can be related to the under-expression of ctnnbip1 which interacts with β-catenin. In addition to the function of β-catenin in the actin cytoskeleton, its role in the regulation of Akt pathway activation [64] or in Wnt pathway regulation [65] is advanced. This protein forms part of a complex that captures growth and proliferation signals from the cell surface and is then activated to stimulate the expression of genes involved in cell proliferation. It would be worth studying β-catenin-dependent transcription in relation to carcinogenicity.

          DEHP effects in the SHE model compared to rats and mice

          While the expression of cyp1b1 and cyp2e1 was up-regulated and cyp2f2 under-expressed, no change in expression level of CYP4 genes was found using DD and qPCR after DEHP exposure in our experimental conditions. CYP4 genes are said to be involved in peroxisome proliferation [66]. Eveillard et al. [67] who studied the involvement of DEHP in lipidogenesis in rats, found a slight increase in the PPARα level after 21 days of oral exposure to DEHP (200 mg/kg.day). They registered a significant increase in CYP4 levels after 14 days [68] and after 21 days [67] of exposure. On the other hand, we found no increased mRNA level of CYP4 and PPAR genes in DEHP-treated SHE cells. This underlines that the genes expression changes noted in the present study are independent of PPARs induction. Eveillard et al. [67] found that induced expression of cyp2b10 by DEHP was also independent of PPARα induction but CAR dependent. No change in CAR expression was registered in SHE cells, which may explain why no change in cyp2b10 was noted. Our results are consistent with the study of Ren et al. [20] who identified DEHP regulated genes independent of PPARα and CAR in rats and mice.

          In our study, lipogenesis and xenobiotic metabolism pathways were impacted by DEHP, but not in a major prior way. This may be explained by the lower sensitivity of the hamster model compared with rats and mice to peroxisome proliferators [69]. Indeed, the Syrian hamster model presents an intermediate response between rats or mice and humans who are known to be non-responsive to PP induction [24]. The hamster model, like humans, is less responsive to PP induction than rats and mice, which is an advantage for mechanistic studies of PP effects and for screening human chemical carcinogens.

          On the other hand, three genes (Actin β, Lipoprotein lipase, and Acetyl-Coenzyme A acyltransferase 1a) and 5 gene isoforms (Glutathione S-transferase-pi, -mu, -theta, CCAAT/enhancer binding protein and Nuclear receptor subfamily 1) were commonly found in our study and those carried out by Eveillard et al. [67, 68], suggesting a pattern of response specific to DEHP.

          Takashima et al. [70] also found similar responses in DEHP-treated mice. Up-regulation of rab1b, a RAS oncogene family member involved in cellular signal transduction or survival, was found in the latter study and in the present one. β-Tubulin was clearly over-expressed in mice, a trend which was noted in our study. Some gene isoforms of cadherin, nidogen, cyp1 family genes or LIM domain were also impacted in the liver of mice exposed to DEHP [70].

          DEHP effects on transcription factors

          Other genes identified by Differential Display and involved in transcription and signal transduction pathways or apoptosis were also targeted by DEHP. A significant under-expression of p53 was found after 24 hrs of DEHP exposure using Differential Display and qPCR. This under-expression is in line with the anti- apoptotic effects of DEHP.

          We confirmed the over-expression of bcl-2 after 5 hrs and the under-expression of c-myc after 24 hrs, events reported in a previous study on DEHP treated SHE cells in conditions similar to the present ones [26]. Map Kinases such as Mapk3, Mapk4 and Mapk15 were targeted by DEHP. Further investigations of Map Kinase pathways could be relevant due to their involvement in activities of transcription factors.

          The G protein-coupled estrogen receptor (gper) was found to be over-expressed in Differential Display. Gper can be activated by estrogen-like compounds and its effect on cytoskeleton architecture has been reported [71]. Because of its implication in the regulation of MAPK [72] or TGF-β pathways [73], it would be worthwhile to investigate gper further.

          Performances of DD

          The confirmation of differentially-expressed genes by qPCR showed that the expression levels of more than 75% of genes identified by DD were confirmed by qPCR. A comparative table of the sensitivity of DD versus qPCR is given in additional file 1. qPCR is more likely to quantify subtle changes in the expression level of mRNAs at different concentrations while DD seems to be more sensitive but is less discriminating. To summarize, 35% of the genes identified as differentially expressed in DD gave the same response at the same DEHP concentrations with qPCR while 40% were detected by DD at a lower DEHP concentration than with qPCR.

          Conclusion

          Transcriptional responses of SHE cells to DEHP were studied in conditions inducing the cell neoplastic transformation, in order to identify gene expression changes in relation with effects of this non-genotoxic carcinogen. Functions impacted by DEHP were found to be PPAR-independent. Effects on cytoskeleton related genes indicated disturbances on actin polymerization and stabilization, cell-cell and cell-matrix adhesion and protein trafficking.

          This is the first study that elucidates the genomic changes of DEHP on the organization of the cytoskeleton. Whether the expression changes of cytoskeleton-related genes identified here such as coro1C, nrp2, kif23, are specific to DEHP or to cell transforming agents more generally would require further studies. To answer, the gene sets identified as significantly over- or under-expressed in this study must be explored on other non-genotoxic carcinogens to identify biomarkers predictive of early events in the multistep carcinogenic process. Early disturbances in the expression of cytoskeleton-related genes should be considered good candidates.

          Methods

          Chemicals

          DEHP (C.A.S. No. 117-81-7, purity 99%), purchased from Aldrich Chemicals (Gillingham, England) was dissolved in the DMSO solvent (C.A.S. No. 67.68.50). The latter was obtained from Sigma Aldrich (St Quentin Fallavier, France) and was used at a final concentration of 0.1%.

          Nucleic acid stain Gelred purchased from Interchim (Montluçon, France) was used at a final concentration of 1:10000 (v/v).

          All chemicals used for this study were electrophoresis grade or molecular biology grade. Their origin is specified in the following sections.

          SHE cell culture and treatment

          SHE cells were isolated from Syrian hamster embryos at day 13 of gestation using the procedure described by Pienta et al. [74] and in accordance with the modifications suggested by Elias et al. [75]. Differentiated tissues, such as eyes, heart and viscera were removed and the remaining tissues were dissociated by dispase (1.2 U/ml). Stock cells were preserved in liquid nitrogen.

          After thawing, passage-2 primary cells were pre-cultured until they reached 80% confluency. The culture medium was Dulbecco's modified Eagle medium (DMEM) (Gibco, Invitrogen, Cergy Pontoise, France) supplemented with 10% foetal calf serum (FCS) (Hyclone, Brebières, France; lot N°#ASB28835), 1.5 g/L NaHCO3 at 37°C in a 10% CO2 humidified atmosphere and pH 7.0. No phenol red was added to the medium.

          Cells used for the DEHP studies were sampled from a monolayer during the growing phase, 48 hrs after seeding. Cells were trypsinized and treated during replating with DEHP at concentrations of 0 μM (vehicle control), 12.5 μM, 25 μM and 50 μM in DMEM culture medium supplemented with 10% FCS. Cells were then incubated for 5 hrs and 24 hrs at 37°C in a 10% CO2 humidified atmosphere.

          RNA isolation

          Total RNA extractions were performed directly in the dish, using Nucleospin RNA II Extract Kit (Macherey Nagel, Hoerdt, France), according to the manufacturer's instructions. A DNAse I treatment was performed directly through the column used to collect RNAs and before the elution phase of DNA-free RNA.

          RNA was quantified by spectrophotometry (Nanodrop, Labtech) measuring the A260/A280 ratio and its quality was ensured by electrophoresis using a 1% RNase-free agarose gel. Aliquots were stored at -80°C before use for Differential Display and Real-time PCR.

          Anchored Reverse transcription (RT) and Differential Display

          The Differential Display was performed as described by Liang et al. [35], with minor modifications concerning DD fragment revelation with GelRed.

          For Differential Display, three separate RT reactions were performed with a different one-base anchored oligo-dT primer (H-dTA, H-dTC and H-dTG) to produce three different subsets of cDNA pools. The sequences of the anchored and the arbitrary primers are given as additional file 2. The RT reactions were carried out using 2 μL of each primer (50 μM) and 4 μg of total RNA. 8 μL of RevertAid M-MuLV Reverse Transcriptase 5x reaction buffer (Fermentas, Saint-Rémy-lès-Chevreuse, France), 1.5 μL of 10 mM dNTPs (Fermentas, Saint-Rémy-lès-Chevreuse, France) and up to 35 μL Nuclease-free water were added to each tube, mixed, then heated at 70°C for 3 min. Tubes were centrifuged and incubated on ice for 5 min, then 2 μL (40 U) of RNaseOUT Recombinant RNase Inhibitor (Invitrogen, Cergy Pontoise, France), 1 μL (200 U) of RevertAid M-MuLV RT (Fermentas, Saint-Rémy-lès-Chevreuse, France) and 2 μL of Nuclease-free water were added to each tube. Each tube was mixed by gentle pipetting then incubated in a thermocycler at 42°C for 1 h, followed by 95°C for 10 min. The tubes were then centrifuged and stored at -80°C until use.

          Amplification was then performed using combinations of the three original anchored primers from the reverse transcription step and eighty arbitrary 13-mers (H-AP), giving a total of 240 amplification combinations. All reactions contained 2 μL of a 10x PCR buffer containing 25 mM of MgCl2, 1.6 μL of 1 mM dNTP mix, 1 U of Taq Polymerase (Euromedex, Souffelweyersheim, France) and the primer combination at a final concentration of 1 μM. Tubes were incubated for 5 min at 95°C. The next 40 cycles were 95°C for 30 s (denaturation), 40°C for 2 min (annealing), 72°C for 1 min (amplification). A final extension of 72°C for 10 min completed the cycle.

          After thermocycling, PCR-amplified fragments were resolved in a 6% native polyacrylamide gel in 1 × TBE buffer (89 mM Tris base/89 mM boric acid/2 mM EDTA, pH 8.0), using 10 μL of PCR product mixed with 2 μl of loading buffer (0.05% xylene cyanol, 40% sucrose, 20 mM EDTA, pH 8.0). Gels were run at 100 V for 20 hrs, then the fragments were stained with GelRed 1X in water, for 30 min in the dark. Bands on the gel were revealed on a UV-transluminator. PCR products that showed differential expression between control and treated samples were identified with QuantityOne® 1-D analysis software (BioRad, Marne-la-Coquette, France).

          Bands which were up- or down- regulated more than 2-fold, were selected and characterized in the next step of analysis. Differentially-expressed bands were excised, reamplified and their sizes were checked before cloning. To summarize, fragments of interest were recovered using a clean razor blade and extracted from the gel matrix by boiling in 200 μL of buffer (10 mM Tris/1 mM EDTA/1% SDS (w/v), pH 8.0) for 15 min. After overnight precipitation at -80°C, the eluted DNA was reamplified using the same primers and PCR conditions as the ones used in the DD-PCR step. Reamplified DNA was run in a 1.5% agarose gel containing 1X GelRed and recovered using NucleoSpin ® Extract II kit (Macherey Nagel, Hoerdt, France) before cloning.

          Cloning was carried out using a TA Cloning Kit (pGEM-T, Promega, Charbonnières, France), according to the manufacturer's instructions. Plasmid DNA was extracted from the cultures using Nucleospin ® Plasmid QuickPure (Macherey Nagel, Hoerdt, France), according to the manufacturer's instructions and sequenced bidirectionally by the DNA sequencing service of MWG Operon (Ebersberg, Germany), using T7 and SP6 primers.

          Identification of differentially-expressed genes

          Sequences were compared with the National Centre of Biotechnology Information Gene Bank database (http://​www.​ncbi.​nlm.​nih.​gov) using the tBLASTx algorithm and RefSeq mouse or Refseq human as a reference.

          Confirmation of differentially-expressed sequences by Quantitative Real Time PCR (qPCR)

          First-strand cDNA was synthesized from 2 μg of total RNA using VILO-Superscript™ III reverse transcriptase (Invitrogen, Cergy Pontoise, France) and random-hexamer primers. To summarize, 2 μg of total RNA was combined with 4 μL of 5X VILO™ reaction mix (containing RT buffer, MgCl2, dNTPs and random primers) and 2 μL of 10X enzyme mix (containing Superscript® III and RNase inhinitor). The final volume was adjusted to 20 μL and the reaction mix was incubated at 42°C for 60 min. Then, cDNAs were diluted 20-fold, according to the manufacturer's instructions, before qPCR amplifications. The oligonucleotides used as primers in the quantitative real time PCR assay are described in table 3. If possible, at least one primer in each pair spanned an exon-intron boundary. PCR was carried out using Fast SYBR®Green Master Mix (Applied Biosystem, Courtaboeuf, France). Amplifications were performed on a StepOnePlus Real-Time PCR system (Applied Biosystem, Courtaboeuf, France). Each qPCR reaction contained 10 μL of 2X Fast SYBR®Green Master Mix, 5 μL of primers, 2 μL of diluted cDNA and 3 μL of Nuclease-free water. Amplification parameters were set as follows: initial denaturation (95°C, 3 min), and then amplification (95°C, 3 s and 60°C 30s) for 40 cycles. Glyceraldehyde 3-phosphate dehydrogenase (gapdh) mRNA level was used as a housekeeping gene to normalize qPCR data. This gene was chosen because DEHP exposure did not affect its expression unlike β-actin which was also tested (data not shown). qPCR results were analyzed using the software provided with the thermocycler and DataAssist, using the ΔΔCt method [76]. Each validated primer pair used yielded a single peak of dissociation on the melting curve. The efficiency calculated by standard curve with five log-10 dilution points was between 0.95 and 1.05. A 2.0-fold threshold and a p-value of 0.05 were used to determine the significance of differential expression levels according to the standard parameters of DataAssist.
          Table 3

          List of the primers used for real-time qPCR

           

          Genes

          Accession N°

          Primers sequence (5'-3')

          Housekeeping gene

            

          gapdh

          Glyceraldehyde 3-phosphate dehydrogenase

          DQ403055

          F: CAATGACCCCTTCATTGACC

          R: GACAAGCTTCCCGTTCTCAG

          Regulation of cytoskeleton

            

          tubb2b

          β-Tubulin

          NM_023716

          F: GCAACATGAATGACCTGGTG

          R: ACCAGAGACCCAGCACAAAC

          thy1

          Thy1 Antigen

          NM_009382.3

          F: AAGGCCTCTGCCTGTAGTGA

          R: GAAGAGGCAGGTTGCAAGAC

          actin

          β-Actin

          NM_007393

          F: CACCACCACAGCCGAGAG

          R: CCAGGGAGGAAGAGGATGC

          col1a1

          Collagen α1

          NM_000088

          F: GGGTCATTTCCACATGCTTT

          R: TCCGGGTTTCAGAGTACCAC

          thbs1

          Thrombospondin 1

          NM_011580

          F: CCAAAGCCTGCAAGAAAGAC

          R: CCTGCTTGTTGCAAACTTGA

          plekha5

          Plekstrin homology A5

          NM_019012

          F: GTGCATCTGCCTGAAGACAA

          R: TGGGAACCTTTAACGACTGG

          kif23

          Kinesin 23

          NM_024245.4

          F: CCTGAGCTTTCCTGACCAAG

          R: AGTTCCTTCTGGGTGGTGTG

          has2

          Hyaluronan synthase 2

          NM_008216

          F: CGGAGGACGAGTCTATGAGC

          R: TTTTCCGGTGTTCCAAAAAG

          flrt2

          Fibronectin leucine rich 2

          NM_201518

          F: ACCGCACTGTGGAAGATACC

          R: GCAAGACAACGAGCACAAAA

          enah

          Enabled homolog

          NM_008680

          F: GCCTATGCTTCAGCACTTCC

          R: GGGCGATTGTCTTCTGACAT

          dclk1

          Doublecortin like 1

          NM_019978

          F: AGCCTCCACCAGCTCAGTTA

          R: CCATACACATCGCTCCATTG

          ctnnbip1

          Catenin β interacting protein 1

          NM_020248

          F: TTGGCTGCAGAAAGAAACCT

          R: CCAGCCAATCACAACCTTTT

          crip1

          Cystein rich protein

          NM_007763

          F: AGTCCAGAGCCTGCAACCTA

          R: GGAGTAGCAGGGATGATTGC

          coro1c

          Coronin

          NM_014325

          F: GCAGAAGAGTGGTTCGAAGG

          R: TGATCAGGTCGCACTTCTTG

          cdh3

          Cadherin 3

          NM_007665

          F: CACACGACCTCATGTTCACC

          R: CTGTACCTCATGGCCCACTT

          calml3

          Calmodulin like 3

          NM_027416.3

          F: ATCGACAAGGATGGAAACG

          R: ATCTACCTCCTCGTCGCTCA

          cttnbp2

          Cortactin binding protein 2

          NM_030249

          F: GACAAAGAAGGCTGGACTGC

          R: CTCACCCACGGAAATCCTTA

          lrrc8a

          Leucine rich repeat 8A

          NM_177725

          F: AGAGCCCACTTACCCCAACT

          R: GTGTGCAGAAGCACGAGGTA

          snx6

          Sorting nexin 6

          NM_021249

          F: CCAAGACCTGATTTTGATGCTTC

          R: CATGCATCGCAACTGTCTTC

          nrp2

          Neuropilin 2

          NM_0010774

          F: ATAAGCACTGATGTCCCACTG

          R: GAGTTGCTCCAATCTCCTTCA

          nid2

          Nidogen 2

          NM_008695

          F: CTCATTCAGTTGTGCCTGC

          R: ATAGCTGCCTCATGACATCG

          Regulation of apoptosis

            

          pi3kr1

          phosphatidylinositol 3-kinase (p85a)

          NM_001077495

          F: CGAGCCCGACCGGAGGTGAA

          R: CGCACACTGCCGTCCGAGTT

          bcl-2

          B-cell lymphoma 2

          AJ582074

          F: CGCAGAGATGTCCAGTCAGC

          R: CGAACTCAAAGAAGACCACAA

          c-myc

          cellular myelocytomatosis oncogene

          AJ582076

          F: GACCCTGATTCGGACCTCTT

          R: CGACTCCACAGCCTTCTCTC

          p53

          tumor supressor p53

          U07182

          F: ATGACGGAAGTTGTAAGAC

          R: TCGGATAAGATGCTGAGG

          PPARs genes

            

          ppar α

          peroxisome proliferator activated receptor alpha

          AY170844

          F: GTTTCTTTCGGCGAACTATT

          R: ACACGTGAGAATCTCTGCTT

          ppar β/δ

          peroxisome proliferator activated receptor beta/delta

          AF486582

          F: TGCAAGATCCAGAAGAAGAA

          R: GTAGATGTGCTTGGAGAAGG

          ppar γ

          peroxisome proliferator activated receptor gamma

          AB525757

          F: GGACCTCTCTATGATGGATG

          R: GGATGCAGGTTCTACTTTGA

          CYP4 family genes

            

          cyp4a17

          Cytochrome P450 4A17

          AJ555628

          F: ACCAGATGCCCTACACTACC

          R: GTGCGTAAATGGAGAGTACA

          cyp4a18

          Cytochrome P450 4A18

          AJ555629

          F: ACCAGATGCCCTACACTACC

          R: GGCCATAAATGGAGATTGCA

          cyp4a19

          Cytochrome P450 4A19

          AJ555630

          F: ACCAGATGCCCTACACTACC

          R: GTGCATAAATGGAGAGTGTG

          Declarations

          Acknowledgements

          This work was supported by the French Ligue Nationale contre le Cancer, the Region Lorraine, the Contrat Projet Etat-Region, the Ministry of Research and Technology, and the FEDER. The authors would like to acknowledge these sponsors for their support. Ms. C. Rast and M.A. Maire are gratefully acknowledged for assistance with the cell cultures. We warmly thank Tracy Carmona for her help in correcting the English of the paper.

          Authors’ Affiliations

          (1)
          CNRS UMR7146, Laboratoire I.E.B.E., Rue General Delestraint
          (2)
          UCB Pharma SA, Non-Clinical Development, Chemin du Foriest

          References

          1. Heudorf U, Mersch-Sundermann V, Angerer J: Phthalates: Toxicology and exposure. Int J Hyg Environ Health 2007, 210:623–634.PubMedView Article
          2. Becker K, Göen T, Seiwert M, Conrad A, Pick-Fuss H, Müller J, Wittassek M, Schulz C, Kolossa-Gehring M: GerES IV: Phthalates metabolites and Bisphenol A in urine of German Children. Int J Hyg Environ Health 2009,212(6):685–692.PubMedView Article
          3. IARC, Nakajima T, Hopf NB, Schulte PA: Di(2-ethylhexyl) phthalate (DEHP). IARC Monographs 2000., 77:
          4. Sharpe RM: Hormones and testis development and the possible adverse effets on environmental chemicals. Toxicol Lett 2001, 120:221–232.PubMedView Article
          5. Akingbemi BT, Ge R, Klinefelter GR, Zirkin BR, Hardy MP: Phthalate induced Leydig cell hyperplasia is associated with multiple endocrine disturbances. Proc Natl Acad Sci USA 2004, 101:775–780.PubMedView Article
          6. Latini G, Verroti A, De Felice C: Di-ethylhexyl phthalate and endocrine disruption: a review. Curr Drug Targ 2004, 4:37–40.
          7. Pan G, Hanaoka T, Yoshimura M, Zhang S, Wang P, Tsukino H, Inoue K, Nakazawa H, Tsugane S, Takahashi K: Decreased serum free testosterone in workers exposed to high levels of di-n-butyl phthalate (DBP) and di-2-ethylhexyl phthalate (DEHP): a cross-sectional study in China. Environ Health Perspect 2006, 114:1643–1648.PubMed
          8. Meeker JD, Calafat AM, Hauser R: Di-(ethylhexyl)phthalate metabolites may alter thyroid hormone levels in men. Environ Health Perspect 2007,115(7):1029–1034.PubMedView Article
          9. Melnick RL, Morrissey RE, Tomaszewski KE: Studies by the National Toxicology Program on di(2-ethylhexyl)phthalate. Toxicol Ind Health 1987, 3:99–118.PubMed
          10. Lapinskas PJ, Brown S, Leesnitzer LM, Blanchard S, Swanson C, Cattley RC, Corton JC: Role of PPARα in mediating the effects of phthalates and metabolites in the liver. Toxicology 2005, 207:149–163.PubMedView Article
          11. Feige JN, Gelman L, Rossi D, Zoete V, Métivier R, Tudor C, Anghel SI, Grosdidier A, Lathion C, Engelborghs Y, Michielin O, Wahli W, Desvergne B: The endocrine disruptor monoethyl-hexyl-phthalate is a selective peroxisome proliferator-activated receptor γ modulator that promotes adipogenesis. J Biol Chem 2007,282(26):19152–19166.PubMedView Article
          12. Erkekoğlu P, Rachidi W, De Rosa V, Giray B, Favier A, Hincal F: Protective effect of selenium supplementation on the genotoxicity of di(2-ethylhexyl)phthalate and mono(2-ethylhexyl)phthalate treatment in LNCaP cells. Free Radic Biol Med 2010,49(4):559–66.PubMedView Article
          13. Erkekoğlu P, Rachidi W, Yüzügüllü OG, Giray B, Oztürk M, Favier A, Hincal F: Induction of ROS, p53, p21 in DEHP- and MEHP-exposed LNCaP cells-protection by selenium compounds. Food Chem Toxicol 2011,49(7):1565–1571.PubMedView Article
          14. Erkekoğlu P, Rachidi W, Yüzügüllü OG, Giray B, Favier A, Oztürk M, Hincal F: Evaluation of cytotoxicity and oxidative DNA damaging effects of di(2-ethylhexyl)-phthalate (DEHP) and mono(2-ethylhexyl)-phthalate (MEHP) on MA-10 Leydig cells and protection by selenium. Toxicol Appl Pharmacol 2010,248(1):52–62.PubMedView Article
          15. Doull J, Cattley R, Elcombe C, Lake B, Swenberg J, Wilkinson C, Williams G, van Gemert M: A cancer risk assessment of di(2-ethylhexyl)phthalate: application of the New U.S. EPA Risk Assessment Guidelines. Regul Toxicol Pharmacol 1999, 29:327–357.PubMedView Article
          16. Voss C, Zerban H, Bannasch P, Berger MR: Lifelong exposure to di-(2-ethylhexyl)-phthalate induces tumors in liver ans testes of Sprague-Dawley rats. Toxicology 2005,206(3):359–371.PubMedView Article
          17. David RM, Moore MR, Finney DC, Guest D: Chronic toxicity of di(2-ethylhexyl)phthalate in rats. Toxicol Sci 2000, 55:433–443.PubMedView Article
          18. Melnick RL: Is peroxisome proliferation an obligatory precursor step in the carcinogenicity of di(2-ethylhexyl)phthalate (DEHP)? Environ Health Perspect 2001, 109:437–442.PubMedView Article
          19. Ito Y, Yamanoshita O, Asaeda N, Tagawa Y, Lee CH, Aoyama T, Ichihara G, Furuhashi K, Kamijima M, Gonzalez FJ, Nakajima T: Di(2-ethylhexyl)phthalate induces hepatic tumorigenesis through a peroxisome proliferator-activated receptor α-independent pathway. J Occup Health 2007, 49:172–182.PubMedView Article
          20. Ren H, Aleksunes LM, Wood C, Vallanat B, George MH, Klaassen CD, Corton JC: Characterization of peroxisome proliferator-activated receptor α-independent effect of PPARα activators in the rodent liver: di-(2-ethylhexyl) phthalate also activates the constitutive-activated receptor. Tox Sci 2010,113(1):45–59.View Article
          21. Roberts RA: Evidence of cross talk between PPARα and p38 MAP Kinase. Tox Sci 2002, 68:270–274.View Article
          22. Ito Y, Nakajima T: PPARα- and DEHP-induced cancers. PPAR Res 2008, 1–12.
          23. Cruciani V, Rast C, Durant MJ, Alexandre S, Nguyen-Ba G, Vasseur P: Morphological transformation and inhibition of intercellular communication of Syrian hamster embryo cells by hepatic peroxisome proliferators. Mutat Res Fundam Mol Mech Mut 1997,379(Suppl 1):S195.View Article
          24. James NH, Roberts RA: Species differences in response to peroxisome proliferators correlate in vitro with induction of DNA synthesis rather than suppression of apoptosis. Carcinogenesis 1996,17(8):1623–1632.PubMedView Article
          25. Roberts RA, James NH, Hasmall SC, Holden PR, Lambe K, Macdonald N, West D, Woodyatt NJ, Whitcome D: Apoptosis and proliferation in non-genotoxic carcinogenesis: species differences and role of PPARα. Toxicol Lett 2000, 112–113:49–57.PubMedView Article
          26. Maire MA, Rast C, Vasseur P: Di-(ethylhexyl)phthalate (DEHP) increases Bcl-2/Bax ratio and modifies c-myc expression in Syrian hamster embryo (SHE) cells. Toxicol Lett 2005,158(3):237–245.PubMedView Article
          27. Mikalsen SO, Holen I, Sanner T: Morphological transformation and catalase activity of Syrian hamster embryo cells treated with hepatic peroxisome proliferators, TPA and nickel sulphate. Cell Biol Toxicol 1990,6(1):1–14.PubMedView Article
          28. LeBoeuf RA, Kerckaert GA, Aardema MJ, Gibson DP, Brauninger R, Isfort RJ: The pH 6.7 Syrian hamster embryo cell transformation assay assessing the carcinogenic potential of chemicals. Mutat Res 1996,356(1):85–127.PubMedView Article
          29. Cruciani V, Rast C, Alexandre S, Nguyen-Ba G, Vasseur P: Peroxisome proliferator-induced transformation of Syrian hamster embryo cells: influence of experimental procedures. Toxicol In Vitro 1999, 13:445–457.PubMedView Article
          30. Alexandre S, Rast C, Maire MA, Orfila L, Vasseur P: ZnCl 2 induces Syrian hamster embryo (SHE) cell transformation. Toxicol Lett 2003, 143:77–87.View Article
          31. Isfort RJ, Kerckaert G, Anderson NL, LeBoeuf RA: Two-dimensional gel electrophoresis analysis of Syrian hamster embryo cells: morphological transformation is not cell type specific. Electrophoresis 1992,13(11):855–861.PubMedView Article
          32. Berwald Y, Sachs L: In vitro cell transformation with chemicals carcinogens. Nature 1963, 200:1182–1184.PubMedView Article
          33. Combes R, Balls M, Curren R, Fischbach M, Fusenig N, Kirkland D, Lasne C, Landolph J, LeBoeuf R, Marquardt H, McCormick J, Müller L, Rivedal E, Sabbioni E, Tanaka N, Vasseur P, Yamasaki H: Cell transformation assays as predictors of human carcinogenicity. In The report and recommendations of ECVAM Workshop XX Edited by: Balls M. 1999, 27:745–767. ATLA
          34. Liang P, Pardee AB: Differential display of eukaryotic messenger RNA by means of the polymerase chain reaction. Science 1992, 257:967–971.PubMedView Article
          35. Liang P, Meade JD, Pardee AB: A protocol for differential display of mRNA expression using either fluorescent or radioactive labelling. Nat Prot 2007,2(3):457–470.View Article
          36. Liang P, Pardee AB: Recent advances in differential display. Curr Opin Immunol 1995, 7:274–280.PubMedView Article
          37. Pollack R, Osborn M, Weber K: Patterns of organization of actin and myosin in normal and transformed cultured cells. Proc Nat Acad Sci USA 1975,72(3):994–998.PubMedView Article
          38. Posnack NG, Lee NH, Brown R, Sarvazyan N: Gene expression profiling of DEHP-treated cardiomyocytes reveals potential causes of phthalate arrhythmogenicity. Toxicology 2011, 279:54–64.PubMedView Article
          39. Lambrechts A, Van Troys M, Ampe C: The actin cytoskeleton in normal and pathological cell motility. Int J Biochem Cell Biol 2004, 26:1890–1909.View Article
          40. Rosentreter A, Hofmann A, Xavier CP, Stumpf M, Noegel AA, Clemen CS: Coronin 3 involvement in F-actin-dependent processes at the cell cortex. Exp Cell Res 2007, 313:878–895.PubMedView Article
          41. Weed SA, Parsons JT: Cortactin: coupling membrane dynamics to cortical actin assembly. Oncogene 2001, 20:6418–6434.PubMedView Article
          42. Daly RJ: Cortactin signalling and dynamic actin networks. Biochem J 2004, 382:13–25.PubMedView Article
          43. Tran TC, Singleton C, Fraley TS, Greenwood JA: Cystein-rich protein 1 (CRP1) regulates actin filament bundling. BMC Cell Biol 2005, 6:45.PubMedView Article
          44. Cavallaro U, Christofori G: Cell adhesion and signalling by cadherins and Ig-CAMs in cancer. Nat Rev Cancer 2004,4(2):118–132.PubMedView Article
          45. Samarin SN, Koch S, Ivanov AI, Parkos CA, Nusrat A: Coronin 1C negatively regulates cell-matrix adhesion and motility of intestinal epithelial cells. Biochem Biophys Res Commun 2010,391(1):394–400.PubMedView Article
          46. Nishida Y, Knudson W, Knudson CB, Ishiguro N: Antisense inhibition of hyaluronan synthase-2 in human osteosarcoma cells inhibits hyaluronan retention and tumorigenicity. Exp Cell Res 2005, 307:194–203.PubMedView Article
          47. Chandrasekaran S, Guo NH, Rodrigues RG, Kaiser J, Roberts DD: Pro-adhesive and chemotactic activities of thrombospondin-1 for breast carcinoma cells are mediated by α 3 β 1 integrin and regulated insulin-like growth factor-1 and CD98. J Biol Chem 1999,274(16):11408–11416.PubMedView Article
          48. Kwiatkowski AV, Gertler FB, Loureiro JJ: Function and regulation of Ena/VASP proteins. Trends Cell Biol 2003, 13:386–392.PubMedView Article
          49. Lacy SE, Bönnemann CG, Buzney EA, Kunkel LM: Identification of FLRT1, FLRT2 and FLRT3: A novel family of transmembrane leucine-rich repeat proteins. Genomics 1999, 62:417–426.PubMedView Article
          50. Kohfeldt E, Sasaki T, Göhring W, Timpl R: Nidogen-2: A new basement membrane protein with diverse binding properties. J Mol Biol 1998, 282:99–109.PubMedView Article
          51. Barker TH, Grenett HE, MacEwen MW, Tilden SG, Fuller GM, Settleman J, Woods A, Murphy-Ullrich J, Hagood JS: Thy-1 regulates fibroblast focal adhesion, cytoskeletal organization and migration through modulation of p190 ThoGAP and Rho GTPase activity. Exp Cell Res 2004, 295:488–496.PubMedView Article
          52. Rege TA, Hagood JS: Thy-1 as a regulator of cell-cell and cell-matrix interactions in axon regeneration, apoptosis, adhesion, migration, cancer, and fibrosis. FASEB J 2006, 20:1045–1054.PubMedView Article
          53. Sobarzo CM, Lustig L, Ponzio R, Denduchis B: Effect of di-(2-ethylhexyl)phthalate on N-cadherin and catenin protein expression in rat testis. Reprod Tox 2006, 22:77–86.View Article
          54. Bielenberg DR, Pettaway CA, Takashima S, Klagsbrun M: Neuropilins in neoplasms: expression, regulation, and function. Exp Cell Res 2006, 312:584–593.PubMedView Article
          55. Worby CA, Dixon JE: Sorting out the cellular functions of sorting nexins. Nat Rev Mol Cell Biol 2002, 3:919–931.PubMedView Article
          56. Öklu R, Hesketh R: The latent transforming growth factor β binding protein (LTBP) family. Biochem J 2000, 352:601–610.PubMedView Article
          57. Zhou ZQ, Cao WH, Xie JJ, Lin J, Shen ZY, Zhang QY, Shen JH, Xu LY, Li EM: Expression and prognostic significance of THBS1, Cyr61 and CTGF in esophageal squamous cell carcinoma. BMC Cancer 2009, 9:291–299.PubMedView Article
          58. Lin PT, Gleeson JG, Corbo JC, Flanagan L, Walsh CA: DCAMKL1 encodes a protein kinase with homology to doublecortin that regulates microtubule polymerization. J Neurosci 2000,20(24):9152–9161.PubMed
          59. Hai CM, Gu Z: Caldesmon phosphorylation in actin cytoskeletal remodeling. Eur J Cell Biol 2006, 85:305–309.PubMedView Article
          60. Wang Q, Symes AJ, Kane CA, Freeman A, Nariculam J, Munson P, Thrasivoulou C, Masters JR, Ahmed A: A novel role for Wnt/Ca2+ signaling in actin cytoskeleton remodeling and cell motility in prostate cancer. PloS One 2010,5(5):1–11.
          61. Bennett RD, Strehler EE: Calmodulin-like protein enhances myosin-10 translation. Biochem Biophys Res Commun 2008, 369:654–659.PubMedView Article
          62. Vanhaesebroeck B, Leevers SJ, Ahmadi K, Timms J, Katso R, Driscoll PC, Woscholski R, Parker PJ, Waterfield MD: Synthesis and function of 3-phosphorylated inositol lipids. Annu Rev Biochem 2001, 70:535–602.PubMedView Article
          63. Reif S, Lang A, Lindquist JN, Yata Y, Gäbele E, Scanga A, Brenner DA, Rippe RA: The role of focal adhesion kinase-phosphatidylinositol 3-kinase-Akt signaling in hepatic stallate cell proliferation and type I collagen expression. J Biol Chem 2003,278(10):8083–8090.PubMedView Article
          64. Espada J, Galaz S, Sanz-Rodríguez F, Blázquez-Castro A, Stockert JC, Bagazgoitia L, Jaén P, González S, Cano A, Juarranz A: Oncongenic H-Ras and PI3K signaling can inhibit E-Cadherin-dependent apoptosis and promote cell survival after photodynamic therapy in mouse keratinocytes. J Cell Physiol 2009, 219:84–93.PubMedView Article
          65. Wang X, Goode EL, Fredericksen ZS, Vierkant RA, Pankratz VS, Liu-Mares W, Rider DN, Vachon CM, Cerhan JR, Olson JE, Couch FJ: Association of genetic variation in genes implicated in the β-Catenin destruction complex with risk of breast cancer. Cancer Epidemiol Biomarkers Prev 2008,17(8):2101–2108.PubMedView Article
          66. Bell DR, Elcombe CR: Induction of Acyl-Coa oxidase and Cytochrome-P450iva1 Rna in rat primary hepatocyte culture by peroxisome proliferators. Biochem J 1991, 280:249–253.PubMed
          67. Eveillard A, Mselli-Lakhal L, Mogha A, Lasserre F, Polizzi A, Pascussi JM, Guillou H, Martin PGP, Pineau T: Di-(2-ethylhexyl)-phthalate (DEHP) activates the constitutive androstane receptor (CAR): a novel signalling pathway sensitive to phthalates. Biochem Pharmacol 2009, 77:1735–1746.PubMedView Article
          68. Eveillard A, Lasserre F, de Tayrac M, Polizzi A, Claus S, Canlet C, Mselli-Lakhal L, Gotardi G, Paris A, Guillou H, Martin PGP, Pineau T: Identification of potential mechanisms of toxicity after di-(2-ethylhexyl)-phthalate (DEHP) adult exposure in the liver using a system biology approach. Tox App Pharmacol 2009, 236:282–292.View Article
          69. Lake BG, Rumsby PC, Price RJ, Cunninghame ME: Species differences in hepatic peroxisome proliferation, cell replication and transforming growth factor-beta 1 gene expression in the rat, Syrian hamster and guinea pig. Mutat Res Fundam Mol Mech Mut 2000, 448:213–225.View Article
          70. Takashima K, Ito Y, Gonzalez FJ, Nakajima T: Different mechanisms of DEHP-induced hepatocellular adenoma tumorigenesis in Wild-type and Pparα-null mice. J Occup Health 2008, 50:169–180.PubMedView Article
          71. Quinn JA, Graeber T, Frackelton AR Jr, Kim M, Schwarzbauer JE, Filardo EJ: Coordinate regulation of estrogen-mediated fibronectin matrix assembly and epidermal growth factor receptor transactivation by G protein-coupled receptor, GPR30. Endocrinology 2009, 23:1052–1064.
          72. Prossnitz ER, Barton M: Signaling, physiological functions and clinical relevance of the G protein-coupled estrogen receptor GPER. Prostaglandins Other Lipid Mediat 2009,89(3–4):89–97.PubMedView Article
          73. Kleuser B, Malek D, Gust R, Pertz HH, Potteck H: 17-β-estradiol inhibits transforming growth factor-β signaling and function in breast cancer cells via activation of extracellular signal-regulated kinase throught the G protein-coupled receptor 30. Mol Pharmacol 2008, 74:1533–1543.PubMedView Article
          74. Pienta RJ, Poiley JA, Lebherz WB III: Morphological transformation of early passage golden Syrian hamster embryo cells derived from cryopreserved primary cultures as a reliable in vitro bioassay for identifying diverse carcinogens. Int J Cancer 1977, 19:642–655.PubMedView Article
          75. Elias Z, Poirot O, Daniere MC, Terzetti F, Marande AM, Dzwigaj S, Pezerat H, Fenoglio I, Fubini B: Cytotoxic and transforming effects of silica particles with different surface properties in Syrian hamster embryo (SHE) cells. Toxicol In Vitro 1989, 14:409–422.View Article
          76. Livak KJ, Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2 -ΔΔC T Method. Methods 2001, 25:402–408.PubMedView Article

          Copyright

          © Landkocz et al; licensee BioMed Central Ltd. 2011

          This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://​creativecommons.​org/​licenses/​by/​2.​0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

          Advertisement