Open Access

Transcriptome analysis of orange-spotted grouper (Epinephelus coioides) spleen in response to Singapore grouper iridovirus

  • Youhua Huang1,
  • Xiaohong Huang1,
  • Yang Yan1,
  • Jia Cai1,
  • Zhengliang Ouyang1,
  • Huachun Cui2,
  • Peiran Wang2 and
  • Qiwei Qin1Email author
BMC Genomics201112:556

DOI: 10.1186/1471-2164-12-556

Received: 12 July 2011

Accepted: 12 November 2011

Published: 12 November 2011

Abstract

Background

Orange-spotted grouper (Epinephelus coioides) is an economically important marine fish cultured in China and Southeast Asian countries. The emergence of infectious viral diseases, including iridovirus and betanodavirus, have severely affected food products based on this species, causing heavy economic losses. Limited available information on the genomics of E. coioides has hampered the understanding of the molecular mechanisms that underlie host-virus interactions. In this study, we used a 454 pyrosequencing method to investigate differentially-expressed genes in the spleen of the E. coioides infected with Singapore grouper iridovirus (SGIV).

Results

Using 454 pyrosequencing, we obtained abundant high-quality ESTs from two spleen-complementary DNA libraries which were constructed from SGIV-infected (V) and PBS-injected fish (used as a control: C). A total of 407,027 and 421,141 ESTs were produced in control and SGIV infected libraries, respectively. Among the assembled ESTs, 9,616 (C) and 10,426 (V) ESTs were successfully matched against known genes in the NCBI non-redundant (nr) database with a cut-off E-value above 10-5. Gene ontology (GO) analysis indicated that "cell part", "cellular process" and "binding" represented the largest category. Among the 25 clusters of orthologous group (COG) categories, the cluster for "translation, ribosomal structure and biogenesis" represented the largest group in the control (185 ESTs) and infected (172 ESTs) libraries. Further KEGG analysis revealed that pathways, including cellular metabolism and intracellular immune signaling, existed in the control and infected libraries. Comparative expression analysis indicated that certain genes associated with mitogen-activated protein kinase (MAPK), chemokine, toll-like receptor and RIG-I signaling pathway were alternated in response to SGIV infection. Moreover, changes in the pattern of gene expression were validated by qRT-PCR, including cytokines, cytokine receptors, and transcription factors, apoptosis-associated genes, and interferon related genes.

Conclusion

This study provided abundant ESTs that could contribute greatly to disclosing novel genes in marine fish. Furthermore, the alterations of predicted gene expression patterns reflected possible responses of these fish to the virus infection. Taken together, our data not only provided new information for identification of novel genes from marine vertebrates, but also shed new light on the understanding of defense mechanisms of marine fish to viral pathogens.

Background

The orange-spotted grouper (E. coioides), an important cultured marine fish with a high market value, is an ideal model for studying sex differentiation and reproduction [1, 2]. Rapid expansion of aquaculture has, however, led to an increased incidence of disease outbreaks in recent years [3, 4]. Emerging viral infectious diseases, including iridovirus and nodavirus, have caused serious damage to the grouper aquaculture industry with mortality rates due to iridovirus infections ranging from 30% (adult fish) to 100% (fry) [57]. To date, three iridoviruses that were isolated from diseased groupers have been characterized: Singapore grouper iridovirus (SGIV), orange-spotted grouper iridovirus (OSGIV) and Taiwan grouper iridovirus (TGIV) [5, 6, 8]. Nevertheless, the molecular mechanisms associated with iridovirus pathogenesis and virus-host interactions are largely unknown, due to the limited amount of available genomic information on E. coioides.

Rapid progress in next-generation sequencing technologies can be used for large-scale efficient and economical production of ESTs. De novo transcriptome sequencing using 454 pyrosequencing has thus become an important method for studying non-model organisms [912]. Transcriptome sequencing facilitates functional genomic studies, including global gene expression, novel gene discovery, assembly of full-length genes, and single nucleotide polymorphism (SNP) discovery [9, 13]. To our knowledge, the genome sequence of E. coioides is still unavailable, and this has hindered the progress of immunological and developmental research. To overcome this obstacle, the 454 pyrosequencing technology was applied to determine the transcriptome sequence of E. coioides spleen tissue and a comparative analysis of transcriptome data between the control and the SGIV infected group was performed in this study. The data obtained disclosed a great deal of novel gene information in marine fish and suggested that several intracellular immune signaling pathways were involved in virus infection. These results will shed new light on the understanding of marine fish defense mechanisms to viral pathogens.

Results

Sequence analysis of ESTs from different cDNA libraries

Sequencing data from two different libraries was submitted to the NCBI database (accession number is SRA040065.1). In the control (C) and the SGIV (V) infected spleen libraries, a total of 428867 and 446009 ESTs were sequenced, respectively. Following adaptor sequence and low quality sequences trimming 407,027 (C) and 421,141 (V), high-quality ESTs were obtained from the two libraries. After sequence assembly, 60,322 non-redundant ESTs were generated in the control library, including 36,076 singlets and 24,246 contigs with an average length of 504 bp. In the infected library, 66,063 non-redundant ESTs were generated, including 40,527 singlets and 25,536 contigs, with an average length of 547 bp (Table 1).
Table 1

Summary of EST data in mock- and SGIV-infected grouper spleen cDNA libraries.

Categary

spleen Library

 
 

Mock-infected

SGIV infected

Total sequenced cDNA

428867

446009

High quality ESTs

407027

421141

Total bp

10620407

11962121

Number of contigs

24246

25536

Number of singlets

36076

40527

N50 of contigs (bp)

504

547

N50 = median length of the sequences of all the contigs

All the contigs and singlets were designated as unique sequences and used for further comparative sequence analysis between the two libraries. After a homology search in the non-redundant protein database at the National Center for Biotechnology Information (NCBI), a total of 9,616 (C) and 10,426 (V) unique sequences showed significant BLASTX hits of known protein sequences. The distribution of significant BLASTX hits over different organisms was analyzed. Due to the lack of E. coioides genomic information, the majority of sequences in the two libraries matched genes or fragments from Tetraodon nigroviridis (Figure 1).
https://static-content.springer.com/image/art%3A10.1186%2F1471-2164-12-556/MediaObjects/12864_2011_Article_3687_Fig1_HTML.jpg
Figure 1

Characteristics of homology search of ESTs against the nr database. (A) E-value distribution of BLAST hits for each unique sequence with a cut-off E-value of 1.0E-5. (B) Similarity distribution of the top BLAST hits for each sequence. (C) Species distribution is shown as a percentage of the total homologous sequences with an E-value of at least 1.0E-5. We used the first hit of each sequence for analysis.

Functional annotation based on GO, COG and KEGG analysis

The putative functions of unique sequences in two different libraries were analyzed according to Gene Ontology (GO) and Clusters of Orthologous Groups of protein (COGs) classifications. Analysis of GO categories showed that the functional distribution of the genes of the two libraries was similar. A total of 14,166 and 14,352 unique sequences map to biological processes, 15,130 and 14,923 sequences map to cellular components, and 7,137 and 7,252 sequences map to molecular functions in the control and SGIV infected libraries, respectively. In both libraries, most of the corresponding biological process genes were involved in cellular processes, biological regulation and metabolic processes. Most of the cellular component genes encode proteins associated with parts of cells and cell organelles; most of the molecular function genes were associated with binding, catalytic activity, and transporter activity (Figure 2).
https://static-content.springer.com/image/art%3A10.1186%2F1471-2164-12-556/MediaObjects/12864_2011_Article_3687_Fig2_HTML.jpg
Figure 2

GO annotations of non-redundant sequences in mock and SGIV infected libraries. Most non-redundant sequences can be divided into three major categories, including molecular function (A), cellular component (B), and biological process (C).

Classification of the unigenes into COG categories is critical for functional and evolutionary studies [14]. Among the 25 COG categories, the cluster in the control library for "translation, ribosomal structure and biogenesis" represented the largest group (185 ESTs), followed by the "posttranslational modification, protein turnover, chaperones" and "general function prediction" clusters. Similarly, in the SGIV infected library, the cluster for "translation, ribosomal structure and biogenesis" represented the largest group (172 ESTs) followed by "general function prediction" and "posttranslational modification, protein turnover, chaperones" clusters (Figure 3).
https://static-content.springer.com/image/art%3A10.1186%2F1471-2164-12-556/MediaObjects/12864_2011_Article_3687_Fig3_HTML.jpg
Figure 3

Histogram presentation of clusters of orthologous groups (COG) classification in mock and SGIV infected libraries.

KEGG is a pathway-based categorization of orthologous genes that provides useful information for predicting functional profiles of genes [15]. In this study the unique sequences of two libraries were categorized within the KEGG database. The matched sequences were involved in metabolism processes, cellular processes, signal transduction and cell cycles. Partial KEGG pathways associated with immune and inflammation responses are listed in Table 2. The conserved MAPK signaling molecules can be found in control (C) and SGIV-infected libraries (V), which contained 65 and 71 ESTs, respectively (Additional file 1). In addition, a large number of ESTs were involved in RIG-I signaling pathway (C, 21 hits; V, 20 hits), TLR signaling pathway (C, 28 hits; V, 26 hits), chemokine signaling pathway (C, 62 hits; 73 hits) and P53 signaling pathway (C, 22 hits; V, 25 hits) in two different libraries (Additional file 2 and 3). Many ESTs associated with mammalian signaling pathway genes, including MAP Kinase phosphatase 1 (MKP-1), Nur77, stimulator of interferon genes (STING), and tripartite motif protein (finTRIM) were initially disclosed in marine fish.
Table 2

Number of ESTs involved in KEGG pathway (number of ESTs > 10)

Pathway

Pathway Name

Number of ESTs

  

Control library

SGIV infected library

04010

MAPK signaling pathway

65

71

04062

Chemokine signaling pathway

62

73

04120

Ubiquitin mediated proteolysis

57

69

04660

T cell receptor signaling pathway

39

35

03050

Proteasome

39

37

04620

Toll-like receptor signaling pathway

28

26

04662

B cell receptor signaling pathway

28

30

04630

Jak-STAT signaling pathway

26

25

04020

Calcium signaling pathway

25

36

04210

Apoptosis

24

26

04115

p53 signaling pathway

22

25

04622

RIG-I-like receptor pathway

21

20

04350

TGF-beta signaling pathway

17

23

04150

mTOR signaling pathway

13

13

Putative genes involved in up-regulation or down-regulation during SGIV infection

Among unique sequences that shared > 30% identity (E value < 1e-5) to known genes in the NCBI database, 2,057 genes were cross-expressed in both the control and the SGIV-infected libraries. Using the Fisher's exact test based on the number of homologous ESTs, we found that 755 genes were significantly up-regulated, while 695 genes were significantly down-regulated in response to SGIV infection. A large number of genes were only present in either the control library or the SGIV-infected library. The up-regulated and down-regulated partial genes are listed in Tables 3 and 4, respectively. The alternated genes included cytoskeletal genes, enzymes, and other immune-related genes, such as chemokines, interleukins and interferon-induced proteins. These genes have different expression patterns during SGIV infection, which implies that they may play an important role in physiological processes associated with SGIV infection.
Table 3

Unique genes with increased expression in spleen after SGIV infection

Gene name

species

expression in normal

Expression in infection

Fisher p_value

Profilin-2

Rattus norvegicus

305

29051

0

60S ribosomal protein

Homo sapiens

251

23569

0

Eotaxin

Mus musculus

3169

17689

0

Granulins

Rattus norvegicus

1141

15720

0

Leukocyte cell-derived chemotaxin-2

Mus musculus

4809

10637

0

Thioredoxin

Ictalurus punctatus

542

7343

0

Saposin-C

Cavia porcellus

43

5116

0

Cystatin-B 1

Macaca fuscata

92

4388

0

Perforin-1

Mus musculus

105

4097

0

Scavenger receptor cysteine-rich type 1 protein

Canis familiaris

911

3958

0

Eukaryotic translation initiation factor 4 gamma 2

Gallus gallus

573

3829

0

Gamma-glutamyl hydrolase

Homo sapiens

133

2638

0

Legumain

Bos taurus

445

2572

0

Proteasome subunit alpha type-7

Carassius auratus

35

2452

0

Glyceraldehyde 3-phosphate dehydrogenase,

Danio rerio

103

1983

0

Transcription factor BTF3

Mus musculus

83

1770

0

Src-like-adapter

Mus musculus

84

1371

2.02E-303

Keratin 8

Gallus gallus

182

1586

5.86E-283

Galectin-3-binding protein B

Danio rerio

450

2187

8.23E-277

SUMO-conjugating enzyme

Xenopus tropicalis

137

1307

8.94E-243

C-C motif chemokine 18

Macaca mulatta

282

1667

3.00E-242

Galectin-3-binding protein A

Danio rerio

371

1747

3.37E-216

Hemoglobin subunit beta-1

Pseudaphritis urvillii

241

1383

1.38E-197

Keratin 18

Oncorhynchus mykiss

1661

3701

7.37E-180

Eukaryotic translation initiation factor 3

Bos taurus

67

844

4.27E-174

Cytochrome b

Tropheus moorii

6544

9945

1.29E-163

Natural killer cell protease 1

Rattus norvegicus

227

1138

1.95E-148

T-complex protein 1

Gallus gallus

50

669

6.61E-141

RNA-binding protein 5

Xenopus tropicalis

45

605

7.97E-128

Cathepsin H

Sus scrofa

391

1347

3.79E-125

Beta-2-glycoprotein 1

Bos taurus

433

1389

7.97E-119

Dipeptidyl peptidase 1

Bos taurus

55

586

1.36E-114

Proto-oncogene vav

Mus musculus

98

693

8.51E-113

Proteasome subunit alpha type-4

Homo sapiens

684

1761

2.56E-111

Actin-related protein 2/3 complex subunit 5

Mus musculus

90

656

1.35E-108

Proteasome subunit beta type-6-B like

Salmo salar

469

1361

8.49E-103

RING-box protein 2

Mus musculus

42

497

3.76E-101

NADH-ubiquinone oxidoreductase chain 1

Carassius auratus

330

1102

2.68E-99

Phospholipid hydroperoxide glutathione peroxidase

Sus scrofa

590

1527

1.66E-97

Retinol-binding protein 1

Bos taurus

164

767

1.80E-95

NudC domain-containing protein 2

Rattus norvegicus

81

576

3.36E-94

Lysozyme g

Epinephelus coioides

164

742

5.02E-90

Voltage-gated hydrogen channel 1

Danio rerio

217

742

4.09E-69

Ubiquitin-like modifier-activating enzyme 5

Xenopus laevis

179

670

8.17E-69

LRR and PYD domains-containing protein 1

Homo sapiens

205

714

6.02E-68

Cytochrome c oxidase subunit 6B1

Tarsius syrichta

60

395

2.33E-62

Ig lambda chain

Homo sapiens

31

315

2.99E-61

Interleukin-8

Equus caballus

155

572

4.14E-58

Fibroleukin

Homo sapiens

611

1281

3.75E-56

Rho GDP-dissociation inhibitor 1

Macaca fascicularis

325

844

4.69E-55

Ependymin

Notemigonus crysoleucas

70

386

5.52E-55

Fucolectin-4

Anguilla japonica

1519

2434

1.29E-50

Complement factor H

Homo sapiens

131

459

1.88E-44

Eukaryotic initiation factor 4A-III

Xenopus tropicalis

56

282

4.32E-38

Cysteine and glycine-rich protein 2

Mus musculus

61

290

1.68E-37

Proliferating cell nuclear antigen

Haplochromis burtoni

237

575

3.64E-34

Secernin-3

Danio rerio

64

277

2.42E-33

Ubiquitin-conjugating enzyme E2

Mus musculus

74

286

4.09E-31

Heat shock cognate 71 kDa protein

Oryzias latipes

25

181

8.31E-31

Table 4

Unique genes with decreased expression in spleen after SGIV infection

swissprot_annotation

species

Expression in control

Expression in infection

Fisher p_value

H-2 class II histocompatibility antigen

Mus musculus

11365

1044

0

Glutathione peroxidase 1

Bos taurus

3469

509

0

Endothelial differentiation-related factor 1

Xenopus laevis

5830

172

0

Inositol-3-phosphate synthase 1-A

Xenopus laevis

1618

148

0

Palmitoyl-protein thioesterase 1

Mus musculus

6570

92

0

Proteasome subunit beta type-2

Bos taurus

2244

84

0

Cytochrome c oxidase subunit 1

Gadus morhua

7690

66

0

Myosin light polypeptide 6

Rattus norvegicus

1733

65

0

Eukaryotic translation initiation factor 3 subunit

Danio rerio

1765

60

0

Gamma-interferon-inducible lysosomal thiol reductase

Homo sapiens

2962

55

0

Mid1-interacting protein 1-like

Danio rerio

3667

54

0

Elongation factor 1-gamma

Carassius auratus

1821

51

0

Plastin-2

Danio rerio

1777

51

0

ribosomal protein S8

Rattus norvegicus

1737

48

0

Stefin-C

Bos taurus

1991

46

0

Complement C1q subcomponent subunit A

Bos taurus

1511

43

0

ribosomal protein L22

Xenopus tropicalis

2286

33

0

ribosomal protein L18

Oreochromis niloticus

1598

29

0

Nucleolar protein 16

Tetraodon nigroviridis

1949

377

9.53E-251

Transcription initiation factor TFIID

Pongo abelii

2123

469

6.58E-246

Transforming protein RhoA

Rattus norvegicus

1258

202

4.46E-184

Peroxiredoxin

Cynops pyrrhogaster

2563

982

7.87E-157

Myosin regulatory light chain 2

Gallus gallus

5634

3124

2.64E-154

Heat shock 70 kDa protein

Canis familiaris

612

31

7.54E-140

Ras-related C3 botulinum toxin substrate 2

Bos taurus

928

167

1.56E-126

SH3 domain-containing protein

Mus musculus

609

48

1.33E-123

Rab GDP dissociation inhibitor beta

Rattus norvegicus

602

48

9.70E-122

Cystatin-A5

Sus scrofa

2339

994

4.94E-120

Radixin

Mus musculus

675

77

8.53E-119

Interferon-inducible GTPase 1

Homo sapiens

805

181

4.16E-93

C-X-C chemokine receptor type 4

Papio anubis

1929

851

1.51E-92

AIG2-like domain-containing protein

Danio rerio

617

128

1.59E-76

Major complex class I-related gene

Mus musculus

1058

366

1.83E-76

Thioredoxin-dependent peroxide reductase,

Homo sapiens

769

209

1.20E-74

Death-associated protein-like 1-B

Xenopus laevis

1417

638

9.05E-66

RING finger protein 10

Mus musculus

277

24

3.52E-55

Mannan-binding lectin serine protease 2

Mus musculus

2177

1249

6.20E-55

GTP-binding nuclear protein

Salmo salar

3669

2432

9.56E-54

Regulator of G-protein signaling 8

Danio rerio

1206

639

6.61E-39

Matrix metalloproteinase-9

Homo sapiens

199

21

2.33E-37

Bleomycin hydrolase

Gallus gallus

418

125

2.50E-37

Src kinase-associated phosphoprotein 2

Takifugu rubripes

257

47

8.27E-36

Interferon-induced protein 44-like

Mus musculus

352

94

1.44E-35

Protein disulfide-isomerase A4

Rattus norvegicus

191

21

2.56E-35

Macrophage mannose receptor 1

Homo sapiens

257

49

8.14E-35

Prothymosin alpha-B

Danio rerio

186

21

4.75E-34

Ubiquitin-conjugating enzyme E2

Drosophila melanogaster

344

97

6.36E-33

Myosin-8

Canis familiaris

1023

547

1.60E-32

cAMP-responsive element-binding protein

Danio rerio

684

312

8.58E-32

Programmed cell death protein 10

Mus musculus

383

123

1.42E-31

Peroxisomal membrane protein 2

Bos taurus

612

267

3.46E-31

E3 ubiquitin-protein ligase

Homo sapiens

220

41

2.02E-30

Myoferlin

Xenopus tropicalis

262

62

4.71E-30

Ras-related protein Rab7

Gossypium hirsutum

223

50

6.44E-27

Dynactin subunit 6

Homo sapiens

242

61

2.40E-26

protease regulatory subunit 4

Rattus norvegicus

229

55

4.43E-26

Interferon regulatory factor 1

Gallus gallus

446

183

1.06E-25

Hephaestin-like protein 1

Mus musculus

276

88

2.05E-23

Galectin-8

Homo sapiens

158

29

1.39E-22

Apoptosis-associated speck-like protein

Danio rerio

497

233

2.41E-22

Validation of the changes in gene expression by quantitative real-time PCR

To validate whether the up-regulated or down-regulated genes identified by statistical analysis were involved in SGIV infection, we detected the relative expression of partial genes using quantitative real time-PCR (qRT-PCR). As shown in Figure 4, the relative expression of IL-8, Chemokine (C-C motif) ligand 18 (CCL18), g-type lysozyme (g-lysozyme) and cystatin B increased significantly after SGIV infection, compared with the expression of these genes in the control fish. In contrast, the expression of the interferon-inducible GTPase 1 (IIGP1), transcription Factor II D (TFIID), gamma interferon (IFN-γ)-inducible lysosomal thiol reductase (GILT) and C-C chemokine receptor type 4 (CCR4) decreased after SGIV infection. Thus, these results suggested that SGIV infection modulated numerous host gene expressions for the completion its life cycle.
https://static-content.springer.com/image/art%3A10.1186%2F1471-2164-12-556/MediaObjects/12864_2011_Article_3687_Fig4_HTML.jpg
Figure 4

The differential expression of selected genes was validated by qRT-PCR. Relative expression of genes with increased abundance (A) or decreased abundance (B) was detected. The relative gene expression in grouper injected with PBS (control) was defined as 1, and that in SGIV infected grouper (48 h p.i.) was indicated by the fold increase or decrease compared to the control.

Discussion

An increasing number of reports reveal that transcriptome sequencing of cDNA has became an efficient strategy for generating enormous sequences that represent expressed genes [16]. Transcriptomes from a number of species including those from Drosophila melanogaster, yeast, Caenorhabditis elegans and various mammals and plants were carried out for different purposes [1721]. However, genome and transcriptome data for many "lower" vertebrate species, particularly marine fishes, have not been disclosed. To our knowledge, a limited numbers of E. coioides genes were cloned and characterized, based on the bioinformatic analysis, including those involved in immune responses after pathogenic attack, growth and development [2227]. Given that the spleen is one of the most important organs associated with immune responses in fish and is also the main target organ for SGIV infection, the transcriptome sequencing of the E. coioides spleen can be expected to provide a significant number of ESTs for marine fish immune responses and contribute to understanding iridovirus-host interactions [5].

After removal of overlapping sequences between the control and SGIV-infected libraries, we obtained 65374 non-redundant consensus sequences from E. coioides. With the exception of sequences related to cellular structure and metabolism, abundant sequences were found to be homologous to known immune-relevant genes in other species, based on the BLAST, Conserved Domain Database (CDD), and SWISS-PROT annotation [2830]. More than 80 sequences shared homology to signaling molecules of the mammalian mitogen-activated protein kinase (MAPK) pathways, such as critical molecules associated with extracellular signal-regulated kinase (ERK), p38 MAPK, Ras, RSK2, MKK4, MKK7, ASK1, MEK1/2 and Raf1. The mammalian MAPK signaling pathway was activated during virus infection and contributed to virus replication [3133]. Although the MAPK signaling molecules including ERK, c-Jun N-terminal kinase (JNK) and p38 MAPK were activated in the spleens of SGIV-infected fish (EAGS) cells, identifying the exact roles of these molecules during SGIV replication will benefit from the E. coioides EST information [34, 35]. With the exception of homologue components in the MAPK cascade, different members of interferon-related genes were obtained, including the interferon-induced protein viperin, the interferon-stimulated gene 15 (ISG15), interferon-induced protein 35 kD (IFP35), interferon-stimulated gene 56 (ISG56), and interferon regulatory factors (IRF-1, IRF-2, IRF-3, IRF-4, IRF-5, IRF-7, IRF-8 and IRF-9). Interferon-induced, or stimulated, genes were important for the resistance of the host to virus infection, including virus entry, replication and release [3638]. The E. coioides IRF-1, IRF-2 and IRF-7 genes have been cloned and characterized and IRF-7 was confirmed as being vitally important for SGIV replication [39, 40]. Human ISG15 expression is strongly up-regulated during viral infections, such as human cytomegalovirus (HCMV) and herpes simplex virus (HSV), and ISG15 up-regulation was considered to be involved in different strategies relating to the antiviral response [4144]. IFP35 and ISG56 were also involved in the cellular antiviral response against virus infection [38, 45]. A detailed investigation on the functions of E. coioides interferon-related genes during SGIV infection will contribute greatly to understanding how the SGIV exploited, or evaded, the host interferon immune response.

We also obtained sequences that shared homology to SGIV-encoded immune evasion genes, including lipopolysaccharide-induced tumor necrosis factor-α factor (LITAF), tumor necrosis factor receptor (TNFR), ubiquitin and Bcl-2 [4648]. Iridovirus-encoded LITAF and Bcl-2 could mediate the fate of host cells by regulating apoptosis [47, 48]. It has been reported that many viral immune evasion genes are considered as "stolen" mimics from the host and such viruses may interfere with the host response by modulating or disrupting the function of corresponding host genes [4951]. The discovery of these sequences will be helpful in studies on host-virus interactions. In addition, we also found that other molecules such as lectin, hepcidin, lysozyme and antimicrobial peptide are involved in immune responses. The functions of these genes during virus infection will be investigated in the further studies.

Based on results from exploratory statistical analysis, we identified genes that are up-regulated or down-regulated after SGIV infection. The present data from qRT-PCR analysis validated the hypothesis that expression of partial genes is regulated by SGIV infection, including cytokine, cytokine receptor and transcription factor, apoptosis-associated genes, interferon-related genes, and cytoskeleton genes. Previous studies indicated that the expression of different groups of genes relating to cellular structure, apoptosis, gene transcription and immune regulation were altered in response to virus infections or other stimuli [37, 5254]. Further research into the roles of these differentially-expressed genes will contribute to an increased understanding of the critical events that take place during SGIV replication.

Conclusions

In summary, we studied the immune response of marine fish to virus infection using SGIV infected E. coioides as a model. More than 400 000 high-quality ESTs were obtained from the E. coioides spleen cDNA library by 454 sequencing. These unique sequences contribute greatly to the investigation into changes in gene expression patterns and their molecular functions during pathogens infection, and also provide an abundant data source for the identification of novel genes in E. coioides. This gene information can be used to provide further insights into the functions of chemokines, proinflammatory factors, interferon-induced genes and other cytokines and will thus stimulate further study on the immune response of E. coioides to pathogens. The experimental validation of the gene expression alterations during SGIV infection provides new insights into understanding iridovirus-host interactions.

Methods

E. coioides and virus challenge

To construct spleen cDNA libraries, groupers (E. coioides) of 15 cm total length were obtained from a local farm in Guangzhou, China. Sampling detection indicated that these fish tested negative to SGIV infection. All the fish were maintained in a laboratory recirculating seawater system at 25-30°C for 2 weeks. Healthy fish that displayed normal levels of activity were used in this study. The virus suspension used as a challenge was collected from SGIV-infected GS cells. The fish were challenged by injecting with 0.2 ml of the SGIV suspension (1 × 105 TCID50/ml). As a control, an equal volume of PBS was likewise injected. At 48 h post-infection, fish were sacrificed and tissue samples were taken from the spleens. These were stored in liquid nitrogen for later RNA extraction.

RNA extraction, cDNA library construction and 454 sequencing

Total RNA was extracted from the spleens of the control and SGIV-infected fish using an SV total RNA Isolation kit (Promega). The cDNA library preparation and 454-pyrosequencing were performed as described in Salem et al. [11]. This encompassed a number of procedures as described below. In brief, the first and second strand cDNA were synthesized from 1 μg of total RNA using the SMART PCR cDNA Synthesis Kit (Clonetech, USA) with modified 3' primer 5'-AAGCAGTGGTATCAACGCAGAGTGCAG(T20)VN-3' that contained a BsgI cleavage site. Then the double-stranded cDNA was digested with BsgI for 16 h and cleaned with a QIAquick Minelute PCR purification column (Qiagen, CA). The purified cDNA was sheared into fragments ranging from about 400 to 1000 base pairs by nebulization. After the short fragments (< 400 bp) were removed by AMPure bead (Agencourt), samples were processed with GS FLX Titanium General DNA Library Preparation Kit (Roche) following the manufacturer's instructions. Sequencing was carried out using Roche 454 Genome Sequencer FLX instrument. All the obtained data were submitted to NCBI database.

Data analysis

To analyze the data generated by the FLX sequencer, the sequences of adapters, low complexity and low-quality sequences were filtered out by using Seq-clean and LUCY software [55]. The screened high-quality sequences were de novo assembled used CAP3 software under default parameters [56]. ESTs that did not form contigs were designated as singlets. Putative functions of all the unique sequences (contigs and singlets) were predicted using local BLASTall programs against sequences in the NCBI non-redundant (nr) protein database and the swissprot database (E-value < 1e-5). Each unique sequence was used to determine the COG term, GO term, and the involvement of KEGG pathway database [14, 15].

To compare the gene expression profile between two different libraries, EST occurrence was evaluated statistically. The abundance of unique sequence, expressed as an increase or decrease if the number of hits in SGIV-infected library, was classed as "significantly more" or "significantly less" than that of a normal library. The statistical significance of ESTs with different abundance values was determined using Fisher's exact test [57, 58]. A P value of < 0.05 was considered as statistically significant.

Quantitative real-time PCR

Quantitative real-time PCR was carried out using a LightCycler ® 480 Real-Time PCR System (Roche), with SYBR Green as the fluorescent dye, according to the manufacturer's protocol (TOYOBO). Different genes including cytokines (IL-8, CCL18), cytokine receptors (CCR4), transcription factors (TFIID), apoptosis-associated genes (cystatin B), interferon-related genes (GILT, IIGP1) and others (lysozyme G) were used for validation. Primer sequences are listed in Table 5. Reaction conditions were as follows: 95°C for 1 min, followed by 40 cycles at 94°C for 15 s and at 60°C for 1 min; all the reactions were performed in biological triplicates and samples were normalized using β-actin. Results were expressed as relative fold of β-actin in each experiment, as mean ± SD.
Table 5

Primers used in this study.

Name

Sequence of primers (5'→3')

Cystatin-PF

GTGATGAGGTAAAGCCCAGTGCGGAG

Cystatin-PR

TGGCAGTGGTTTGAAAACACGGAGGT

CCL18-PF

TGCTTTCCTCAGTGATCTGCCAG

CCL18-PR

AGATGCGACGACCCTTTTTTGAA

CCR4-PF

ACAACAGCCAAGCCACAGGAAGC

CCR4-PR

CAGGTGAAAAAACAAACAATGAA

IL8-PF

GTGTCAACCCAGTGCTGTATGCCTT

IL8-PR

TTCAAAGTGTCTCTCTGGTCGTCTC

IIGP1-PF

ACCACCTTAGAGGCTACACCATACCCC

IIGP1-PR

TCTCCTGAGCGAGTTTCACATCATTTT

GILT-PF

TGTTCCTAACTGAGATGCTCTTCCCC

GILT-PR

ATGTTGCCCTGACATTCTGGTGGTC

g-lysozyme-PF

CCTATAATACCTACGGGCTGATG

g-lysozyme-PR

TAGGCTGCTATCCCACCTTTCA

TFIID-PF

CCAGGAGGATGAGGAGGAGGAG

TFIID-PR

GCTGTATGGAGGAGAAAGGGTT

Abbreviations

SGIV: 

Singapore grouper iridovirus

GO: 

Gene ontology

COG: 

clusters of orthologous group

KEGG: 

Kyoto Encyclopedia of Genes and Genomes

MAPK: 

mitogen-activated protein kinase

OSGIV: 

orange-spotted grouper iridovirus

TGIV: 

Taiwan grouper iridovirus

TRIM: 

tripartite motif protein

STING: 

stimulator of interferon genes

IIGP1: 

interferon-inducible GTPase 1

TFIID: 

transcription Factor II D

GILT: 

gamma interferon (IFN-γ)-inducible lysosomal thiol reductase

CCR4: 

C-C chemokine receptor type 4

LITAF: 

lipopolysaccharide-induced tumor necrosis factor-α factor

TNFR: 

tumor necrosis factor receptor.

Declarations

Acknowledgements

This work was supported by grants from National Basic Research Program of China (973) (2012CB114402), the Natural Science Foundation of China (30930070, 30800846, 30725027) and the knowledge innovation program of the Chinese Academy of Sciences (SQ200902, KZCX2-EW-Q213, KZCX2-YW-BR-08).

Authors’ Affiliations

(1)
Key Laboratory of Marine Bio-resources Sustainable Utilization, South China Sea Institute of Oceanology, Chinese Academy of Sciences
(2)
State Key Laboratory of Biocontrol, School of Life Sciences, Sun Yat-sen University

References

  1. Zhou L, Gui JF: Molecular mechanisms underlying sex change in hermaphroditic groupers. Fish Physiol Biochem. 2010, 36: 181-193. 10.1007/s10695-008-9219-0.PubMedView Article
  2. Marino G, Azzurro E, Massari A, Finoia MG, Mandich A: Reproduction in the dusky grouper from the southern Mediterranean. J Fish Biol. 2001, 58: 908-927.View Article
  3. Walker PJ, Winton JR: Emerging viral diseases of fish and shrimp. Vet Res. 2010, 41: 51-10.1051/vetres/2010022.PubMed CentralPubMedView Article
  4. Whittington RJ, Becker JA, Dennis MM: Iridovirus infections in finfish - critical review with emphasis on ranaviruses. J Fish Dis. 2010, 33: 95-122. 10.1111/j.1365-2761.2009.01110.x.PubMedView Article
  5. Qin QW, Shi C, Gin KY, Lam TJ: Antigenic characterization of a marine fish iridovirus from grouper, Epinephelus spp. J Virol Methods. 2002, 106: 89-96. 10.1016/S0166-0934(02)00139-8.PubMedView Article
  6. Chao CB, Chen CY, Lai YY, Lin CS, Huang HT: Histological, ultrastructural, and in situ hybridization study on enlarged cells in grouper Epinephelus hybrids infected by grouper iridovirus in Taiwan (TGIV). Dis Aquat Organ. 2004, 58: 127-142.PubMedView Article
  7. Kai YH, Su HM, Tai KT, Chi SC: Vaccination of grouper broodfish (Epinephelus tukula) reduces the risk of vertical transmission by nervous necrosis virus. Vaccine. 2010, 28: 996-1001. 10.1016/j.vaccine.2009.10.132.PubMedView Article
  8. Lü L, Zhou SY, Chen C, Weng SP, Chan SM, He JG: Complete genome sequence analysis of an iridovirus isolated from the orange-spotted grouper, Epinephelus coioides. Virology. 2005, 339: 81-100. 10.1016/j.virol.2005.05.021.PubMedView Article
  9. Vera JC, Wheat CW, Fescemyer HW, Frilander MJ, Crawford DL, Hanski I, Marden JH: Rapid transcriptome characterization for a nonmodel organism using 454 pyrosequencing. Mol Ecol. 2008, 17: 1636-1647. 10.1111/j.1365-294X.2008.03666.x.PubMedView Article
  10. Alagna F, D'Agostino N, Torchia L, Servili M, Rao R, Pietrella M, Giuliano G, Chiusano ML, Baldoni L, Perrotta G: Comparative 454 pyrosequencing of transcripts from two olive genotypes during fruit development. BMC Genomics. 2009, 10: 399-10.1186/1471-2164-10-399.PubMed CentralPubMedView Article
  11. Salem M, Rexroad CE, Wang J, Thorgaard GH, Yao J: Characterization of the rainbow trout transcriptome using Sanger and 454-pyrosequencing approaches. BMC Genomics. 2010, 11: 564-10.1186/1471-2164-11-564.PubMed CentralPubMedView Article
  12. Guo S, Zheng Y, Joung JG, Liu S, Zhang Z, Crasta OR, Sobral BW, Xu Y, Huang S, Fei Z: Transcriptome sequencing and comparative analysis of cucumber flowers with different sex types. BMC Genomics. 2010, 11: 384-10.1186/1471-2164-11-384.PubMed CentralPubMedView Article
  13. Emrich SJ, Barbazuk WB, Li L, Schnable PS: Gene discovery and annotation using LCM-454 transcriptome sequencing. Genome Res. 2007, 17: 69-73.PubMed CentralPubMedView Article
  14. Tatusov RL, Galperin MY, Natale DA, Koonin EV: The COG database: a tool for genome-scale analysis of protein functions and evolution. Nucleic Acids Res. 2000, 28: 33-36. 10.1093/nar/28.1.33.PubMed CentralPubMedView Article
  15. Kanehisa M, Goto S: KEGG: kyoto encyclopedia of genes and genomes. Nucleic Acids Res. 2000, 28: 27-30. 10.1093/nar/28.1.27.PubMed CentralPubMedView Article
  16. Morozova O, Hirst M, Marra MA: Applications of new sequencing technologies for transcriptome analysis. Annu Rev Genomics Hum Genet. 2009, 10: 135-151. 10.1146/annurev-genom-082908-145957.PubMedView Article
  17. Graveley BR, Brooks AN, Carlson JW, Duff MO, Landolin JM, Yang L, Artieri CG, van Baren MJ, Boley N, Booth BW, Brown JB, Cherbas L, Davis CA, Dobin A, Li R, Lin W, Malone JH, Mattiuzzo NR, Miller D, Sturgill D, Tuch BB, Zaleski C, Zhang D, Blanchette M, Dudoit S, Eads B, Green RE, Hammonds A, Jiang L, Kapranov P, Langton L, Perrimon N, Sandler JE, Wan KH, Willingham A, Zhang Y, Zou Y, Andrews J, Bickel PJ, Brenner SE, Brent MR, Cherbas P, Gingeras TR, Hoskins RA, Kaufman TC, Oliver B, Celniker SE: The developmental transcriptome of Drosophila melanogaster. Nature. 2011, 471: 473-479. 10.1038/nature09715.PubMed CentralPubMedView Article
  18. Wilhelm BT, Marguerat S, Watt S, Schubert F, Wood V, Goodhead I, Penkett CJ, Rogers J, Bähler J: Dynamic repertoire of a eukaryotic transcriptome surveyed at single-nucleotide resolution. Nature. 2008, 453: 1239-1243. 10.1038/nature07002.PubMedView Article
  19. Mizrachi E, Hefer CA, Ranik M, Joubert F, Myburg AA: De novo assembled expressed gene catalog of a fast-growing Eucalyptus tree produced by Illumina mRNA-Seq. BMC Genomics. 2010, 11: 681-10.1186/1471-2164-11-681.PubMed CentralPubMedView Article
  20. Fehniger TA, Wylie T, Germino E, Leong JW, Magrini VJ, Koul S, Keppel CR, Schneider SE, Koboldt DC, Sullivan RP, Heinz ME, Crosby SD, Nagarajan R, Ramsingh G, Link DC, Ley TJ, Mardis ER: Next-generation sequencing identifies the natural killer cell microRNA transcriptome. Genome Res. 2010, 20: 1590-1604. 10.1101/gr.107995.110.PubMed CentralPubMedView Article
  21. Li P, Ponnala L, Gandotra N, Wang L, Si Y, Tausta SL, Kebrom TH, Provart N, Patel R, Myers CR, Reidel EJ, Turgeon R, Liu P, Sun Q, Nelson T, Brutnell TP: The developmental dynamics of the maize leaf transcriptome. Nat Genet. 2010, 42: 1060-1067. 10.1038/ng.703.PubMedView Article
  22. Jin JY, Zhou L, Wang Y, Li Z, Zhao JG, Zhang QY, Gui JF: Antibacterial and Antiviral Roles of a Fish β-Defensin Expressed Both in Pituitary and Testis. PLoS One. 2010, 5: e12883-10.1371/journal.pone.0012883.PubMed CentralPubMedView Article
  23. Zhou JG, Wei JG, Xu D, Cui HC, Yan Y, Ou-Yang ZL, Huang XH, Huang YH, Qin QW: Molecular cloning and characterization of two novel hepcidins from orange-spotted grouper, Epinephelus coioides. Fish Shellfish Immunol. 2011, 30: 559-568. 10.1016/j.fsi.2010.11.021.PubMedView Article
  24. Cui H, Yan Y, Wei J, Hou Z, Huang Y, Huang X, Qin Q: Cloning, characterization, and expression analysis of orange-spotted grouper (Epinephelus coioides) ILF2 gene (EcILF2). Fish Shellfish Immunol. 2011, 30: 378-388. 10.1016/j.fsi.2010.11.015.PubMedView Article
  25. Dong H, Zeng L, Duan D, Zhang H, Wang Y, Li W, Lin H: Growth hormone and two forms of insulin-like growth factors I in the giant grouper (Epinephelus lanceolatus): molecular cloning and characterization of tissue distribution. Fish Physiol Biochem. 2010, 36: 201-212. 10.1007/s10695-008-9231-4.PubMedView Article
  26. Shi Y, Zhang Y, Li S, Liu Q, Lu D, Liu M, Meng Z, Cheng CH, Liu X, Lin H: Molecular identification of the Kiss2/Kiss1ra system and its potential function during 17alpha-methyltestosterone-induced sex reversal in the orange-spotted grouper, Epinephelus coioides. Biol Reprod. 2010, 83: 63-74. 10.1095/biolreprod.109.080044.PubMedView Article
  27. Xia W, Zhou L, Yao B, Li CJ, Gui JF: Differential and spermatogenic cell-specific expression of DMRT1 during sex reversal in protogynous hermaphroditic groupers. Mol Cell Endocrinol. 2007, 263: 156-172. 10.1016/j.mce.2006.09.014.PubMedView Article
  28. Junker V, Contrino S, Fleischmann W, Hermjakob H, Lang F, Magrane M, Martin MJ, Mitaritonna N, O'Donovan C, Apweiler R: The role SWISS-PROT and TrEMBL play in the genome research environment. J Biotechnol. 2000, 78: 221-234. 10.1016/S0168-1656(00)00198-X.PubMedView Article
  29. Ye J, McGinnis S, Madden TL: BLAST: improvements for better sequence analysis. Nucleic Acids Res. 2006, 34: W6-9. 10.1093/nar/gkl164.PubMed CentralPubMedView Article
  30. Marchler-Bauer A, Anderson JB, Chitsaz F, Derbyshire MK, DeWeese-Scott C, Fong JH, Geer LY, Geer RC, Gonzales NR, Gwadz M, He S, Hurwitz DI, Jackson JD, Ke Z, Lanczycki CJ, Liebert CA, Liu C, Lu F, Lu S, Marchler GH, Mullokandov M, Song JS, Tasneem A, Thanki N, Yamashita RA, Zhang D, Zhang N, Bryant SH: CDD: specific functional annotation with the Conserved Domain Database. Nucleic Acids Res. 2009, 37: D205-210. 10.1093/nar/gkn845.PubMed CentralPubMedView Article
  31. Xing Z, Cardona CJ, Anunciacion J, Adams S, Dao N: Roles of the ERK MAPK in the regulation of proinflammatory and apoptotic responses in chicken macrophages infected with H9N2 avian influenza virus. J Gen Virol. 2010, 91: 343-351. 10.1099/vir.0.015578-0.PubMedView Article
  32. Regan AD, Cohen RD, Whittaker GR: Activation of p38 MAPK by feline infectious peritonitis virus regulates pro-inflammatory cytokine production in primary blood-derived feline mononuclear cells. Virology. 2009, 384: 135-143. 10.1016/j.virol.2008.11.006.PubMedView Article
  33. Holloway G, Coulson BS: Rotavirus activates JNK and p38 signaling pathways in intestinal cells, leading to AP-1-driven transcriptional responses and enhanced virus replication. J Virol. 2006, 80: 10624-10633. 10.1128/JVI.00390-06.PubMed CentralPubMedView Article
  34. Huang XH, Huang YH, Ouyang ZL, Xu LX, Yan Y, Cui HC, Han X, Qin QW: Singapore grouper iridovirus, a large DNA virus, induces nonapoptotic cell death by a cell type dependent fashion and evokes ERK signaling. Apoptosis. 2011, 16: 831-845. 10.1007/s10495-011-0616-y.PubMedView Article
  35. Huang XH, Huang YH, Ouyang ZL, Cai J, Yan Y, Qin QW: Roles of Stress-Activated Protein Kinases in the replication of Singapore grouper iridovirus and regulation of the inflammatory responses in grouper cells. J Gen Virol. 92: 1292-1301.
  36. Jiang D, Weidner JM, Qing M, Pan XB, Guo H, Xu C, Zhang X, Birk A, Chang J, Shi PY, Block TM, Guo JT: Identification of five interferon-induced cellular proteins that inhibit west nile virus and dengue virus infections. J Virol. 2010, 84: 8332-8341. 10.1128/JVI.02199-09.PubMed CentralPubMedView Article
  37. Wang X, Hinson ER, Cresswell P: The interferon-inducible protein viperin inhibits influenza virus release by perturbing lipid rafts. Cell Host Microbe. 2007, 2: 96-105. 10.1016/j.chom.2007.06.009.PubMedView Article
  38. Li Y, Li C, Xue P, Zhong B, Mao AP, Ran Y, Chen H, Wang YY, Yang F, Shu HB: ISG56 is a negative-feedback regulator of virus-triggered signaling and cellular antiviral response. Proc Natl Acad Sci USA. 2009, 106: 7945-7950. 10.1073/pnas.0900818106.PubMed CentralPubMedView Article
  39. Shi Y, Zhu XP, Yin JK, Zhang QY, Gui JF: Identification and characterization of interferon regulatory factor-1 from orange-spotted grouper (Epinephelus coioides). Mol Biol Rep. 2010, 37: 1483-1493. 10.1007/s11033-009-9544-0.PubMedView Article
  40. Cui H, Yan Y, Wei J, Huang X, Huang Y, Ouyang Z, Qin Q: Identification and functional characterization of an interferon regulatory factor 7-like (IRF7-like) gene from orange-spotted grouper, Epinephelus coioides. Dev Comp Immunol. 2011, 35: 672-684. 10.1016/j.dci.2011.01.021.PubMedView Article
  41. Lenschow DJ, Lai C, Frias-Staheli N, Giannakopoulos NV, Lutz A, Wolff T, Osiak A, Levine B, Schmidt RE, García-Sastre A, Leib DA, Pekosz A, Knobeloch KP, Horak I, Virgin HW: IFN-stimulated gene 15 functions as a critical antiviral molecule against influenza, herpes, and Sindbis viruses. Proc Natl Acad Sci USA. 2007, 104: 1371-1376. 10.1073/pnas.0607038104.PubMed CentralPubMedView Article
  42. Okumura A, Lu G, Pitha-Rowe I, Pitha PM: Innate antiviral response targets HIV-1 release by the induction of ubiquitin-like protein ISG15. Proc Natl Acad Sci USA. 2006, 103: 1440-1445. 10.1073/pnas.0510518103.PubMed CentralPubMedView Article
  43. Nicholl MJ, Robinson LH, Preston CM: Activation of cellular interferon-responsive genes after infection of human cells with herpes simplex virus type 1. J Gen Virol. 2000, 81: 2215-2218.PubMedView Article
  44. Broering R, Zhang X, Kottilil S, Trippler M, Jiang M, Lu M, Gerken G, Schlaak JF: The interferon stimulated gene 15 functions as a proviral factor for the hepatitis C virus and as a regulator of the IFN response. Gut. 2010, 59: 1111-1119. 10.1136/gut.2009.195545.PubMedView Article
  45. Tan J, Qiao W, Wang J, Xu F, Li Y, Zhou J, Chen Q, Geng Y: IFP35 is involved in the antiviral function of interferon by association with the viral tas transactivator of bovine foamy virus. J Virol. 2008, 82: 4275-4283. 10.1128/JVI.02249-07.PubMed CentralPubMedView Article
  46. Song WJ, Qin QW, Qiu J, Huang CH, Wang F, Hew CL: Functional genomics analysis of Singapore grouper iridovirus: complete sequence determination and proteomic analysis. J Virol. 2004, 78: 12576-12590. 10.1128/JVI.78.22.12576-12590.2004.PubMed CentralPubMedView Article
  47. Lin PW, Huang YJ, John JA, Chang YN, Yuan CH, Chen WY, Yeh CH, Shen ST, Lin FP, Tsui WH, Chang CY: Iridovirus Bcl-2 protein inhibits apoptosis in the early stage of viral infection. Apoptosis. 2008, 13: 165-176. 10.1007/s10495-007-0152-y.PubMedView Article
  48. Huang XH, Huang YH, Gong J, Yan Y, Qin QW: Identification and characterization of a putative lipopolysaccharide-induced TNF-alpha factor (LITAF) homolog from Singapore grouper iridovirus. Biochem Biophys Res Commun. 2008, 373: 140-145. 10.1016/j.bbrc.2008.06.003.PubMedView Article
  49. Viswanathan K, Früh K, DeFilippis V: Viral hijacking of the host ubiquitin system to evade interferon responses. Curr Opin Microbiol. 2010, 13: 517-523. 10.1016/j.mib.2010.05.012.PubMed CentralPubMedView Article
  50. Alcami A: Viral mimicry of cytokines, chemokines and their receptors. Nat Rev Immunol. 2003, 3: 36-50. 10.1038/nri980.PubMedView Article
  51. Ploegh HL: Viral strategies of immune evasion. Science. 1998, 280: 248-253. 10.1126/science.280.5361.248.PubMedView Article
  52. Yeh CH, Chen YS, Wu MS, Chen CW, Yuan CH, Pan KW, Chang YN, Chuang NN, Chang CY: Differential display of grouper iridovirus-infected grouper cells by immunostaining. Biochem Biophys Res Commun. 2008, 372: 674-680. 10.1016/j.bbrc.2008.05.126.PubMedView Article
  53. Chen LM, Tran BN, Lin Q, Lim TK, Wang F, Hew CL: iTRAQ analysis of Singapore grouper iridovirus infection in a grouper embryonic cell line. J Gen Virol. 2008, 89: 2869-2876. 10.1099/vir.0.2008/003681-0.PubMedView Article
  54. Xu D, Wei J, Cui H, Gong J, Yan Y, Lai R, Qin Q: Differential profiles of gene expression in grouper Epinephelus coioides, infected with Singapore grouper iridovirus, revealed by suppression subtractive hybridization and DNA microarray. J Fish Biol. 2010, 77: 341-360. 10.1111/j.1095-8649.2010.02676.x.PubMedView Article
  55. Chou HH, Holmes MH: DNA sequence quality trimming and vector removal. Bioinformatics. 2001, 17: 1093-1104. 10.1093/bioinformatics/17.12.1093.PubMedView Article
  56. Huang X, Madan A: CAP3:A DNA sequence assembly program. Genome Res. 1999, 9: 868-877. 10.1101/gr.9.9.868.PubMed CentralPubMedView Article
  57. Leu JH, Chang CC, Wu JL, Hsu CW, Hirono I, Aoki T, Juan HF, Lo CF, Kou GH, Huang HC: Comparative analysis of differentially expressed genes in normal and white spot syndrome virus infected Penaeus monodon. BMC Genomics. 2007, 8: 120-10.1186/1471-2164-8-120.PubMed CentralPubMedView Article
  58. Zhang Z, Wang Y, Wang S, Liu J, Warren W, Mitreva M, Walter RB: Transcriptome analysis of female and male Xiphophorus maculatus Jp 163 A. PLoS One. 2011, 6: e18379-10.1371/journal.pone.0018379.PubMed CentralPubMedView Article

Copyright

© Huang et al; licensee BioMed Central Ltd. 2011

This article is published under license to BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://​creativecommons.​org/​licenses/​by/​2.​0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.