Transcriptome analysis of orange-spotted grouper (Epinephelus coioides) spleen in response to Singapore grouper iridovirus

  • Youhua Huang1,

    Affiliated with

    • Xiaohong Huang1,

      Affiliated with

      • Yang Yan1,

        Affiliated with

        • Jia Cai1,

          Affiliated with

          • Zhengliang Ouyang1,

            Affiliated with

            • Huachun Cui2,

              Affiliated with

              • Peiran Wang2 and

                Affiliated with

                • Qiwei Qin1Email author

                  Affiliated with

                  BMC Genomics201112:556

                  DOI: 10.1186/1471-2164-12-556

                  Received: 12 July 2011

                  Accepted: 12 November 2011

                  Published: 12 November 2011

                  Abstract

                  Background

                  Orange-spotted grouper (Epinephelus coioides) is an economically important marine fish cultured in China and Southeast Asian countries. The emergence of infectious viral diseases, including iridovirus and betanodavirus, have severely affected food products based on this species, causing heavy economic losses. Limited available information on the genomics of E. coioides has hampered the understanding of the molecular mechanisms that underlie host-virus interactions. In this study, we used a 454 pyrosequencing method to investigate differentially-expressed genes in the spleen of the E. coioides infected with Singapore grouper iridovirus (SGIV).

                  Results

                  Using 454 pyrosequencing, we obtained abundant high-quality ESTs from two spleen-complementary DNA libraries which were constructed from SGIV-infected (V) and PBS-injected fish (used as a control: C). A total of 407,027 and 421,141 ESTs were produced in control and SGIV infected libraries, respectively. Among the assembled ESTs, 9,616 (C) and 10,426 (V) ESTs were successfully matched against known genes in the NCBI non-redundant (nr) database with a cut-off E-value above 10-5. Gene ontology (GO) analysis indicated that "cell part", "cellular process" and "binding" represented the largest category. Among the 25 clusters of orthologous group (COG) categories, the cluster for "translation, ribosomal structure and biogenesis" represented the largest group in the control (185 ESTs) and infected (172 ESTs) libraries. Further KEGG analysis revealed that pathways, including cellular metabolism and intracellular immune signaling, existed in the control and infected libraries. Comparative expression analysis indicated that certain genes associated with mitogen-activated protein kinase (MAPK), chemokine, toll-like receptor and RIG-I signaling pathway were alternated in response to SGIV infection. Moreover, changes in the pattern of gene expression were validated by qRT-PCR, including cytokines, cytokine receptors, and transcription factors, apoptosis-associated genes, and interferon related genes.

                  Conclusion

                  This study provided abundant ESTs that could contribute greatly to disclosing novel genes in marine fish. Furthermore, the alterations of predicted gene expression patterns reflected possible responses of these fish to the virus infection. Taken together, our data not only provided new information for identification of novel genes from marine vertebrates, but also shed new light on the understanding of defense mechanisms of marine fish to viral pathogens.

                  Background

                  The orange-spotted grouper (E. coioides), an important cultured marine fish with a high market value, is an ideal model for studying sex differentiation and reproduction [1, 2]. Rapid expansion of aquaculture has, however, led to an increased incidence of disease outbreaks in recent years [3, 4]. Emerging viral infectious diseases, including iridovirus and nodavirus, have caused serious damage to the grouper aquaculture industry with mortality rates due to iridovirus infections ranging from 30% (adult fish) to 100% (fry) [57]. To date, three iridoviruses that were isolated from diseased groupers have been characterized: Singapore grouper iridovirus (SGIV), orange-spotted grouper iridovirus (OSGIV) and Taiwan grouper iridovirus (TGIV) [5, 6, 8]. Nevertheless, the molecular mechanisms associated with iridovirus pathogenesis and virus-host interactions are largely unknown, due to the limited amount of available genomic information on E. coioides.

                  Rapid progress in next-generation sequencing technologies can be used for large-scale efficient and economical production of ESTs. De novo transcriptome sequencing using 454 pyrosequencing has thus become an important method for studying non-model organisms [912]. Transcriptome sequencing facilitates functional genomic studies, including global gene expression, novel gene discovery, assembly of full-length genes, and single nucleotide polymorphism (SNP) discovery [9, 13]. To our knowledge, the genome sequence of E. coioides is still unavailable, and this has hindered the progress of immunological and developmental research. To overcome this obstacle, the 454 pyrosequencing technology was applied to determine the transcriptome sequence of E. coioides spleen tissue and a comparative analysis of transcriptome data between the control and the SGIV infected group was performed in this study. The data obtained disclosed a great deal of novel gene information in marine fish and suggested that several intracellular immune signaling pathways were involved in virus infection. These results will shed new light on the understanding of marine fish defense mechanisms to viral pathogens.

                  Results

                  Sequence analysis of ESTs from different cDNA libraries

                  Sequencing data from two different libraries was submitted to the NCBI database (accession number is SRA040065.1). In the control (C) and the SGIV (V) infected spleen libraries, a total of 428867 and 446009 ESTs were sequenced, respectively. Following adaptor sequence and low quality sequences trimming 407,027 (C) and 421,141 (V), high-quality ESTs were obtained from the two libraries. After sequence assembly, 60,322 non-redundant ESTs were generated in the control library, including 36,076 singlets and 24,246 contigs with an average length of 504 bp. In the infected library, 66,063 non-redundant ESTs were generated, including 40,527 singlets and 25,536 contigs, with an average length of 547 bp (Table 1).
                  Table 1

                  Summary of EST data in mock- and SGIV-infected grouper spleen cDNA libraries.

                  Categary

                  spleen Library

                   
                   

                  Mock-infected

                  SGIV infected

                  Total sequenced cDNA

                  428867

                  446009

                  High quality ESTs

                  407027

                  421141

                  Total bp

                  10620407

                  11962121

                  Number of contigs

                  24246

                  25536

                  Number of singlets

                  36076

                  40527

                  N50 of contigs (bp)

                  504

                  547

                  N50 = median length of the sequences of all the contigs

                  All the contigs and singlets were designated as unique sequences and used for further comparative sequence analysis between the two libraries. After a homology search in the non-redundant protein database at the National Center for Biotechnology Information (NCBI), a total of 9,616 (C) and 10,426 (V) unique sequences showed significant BLASTX hits of known protein sequences. The distribution of significant BLASTX hits over different organisms was analyzed. Due to the lack of E. coioides genomic information, the majority of sequences in the two libraries matched genes or fragments from Tetraodon nigroviridis (Figure 1).
                  http://static-content.springer.com/image/art%3A10.1186%2F1471-2164-12-556/MediaObjects/12864_2011_3687_Fig1_HTML.jpg
                  Figure 1

                  Characteristics of homology search of ESTs against the nr database. (A) E-value distribution of BLAST hits for each unique sequence with a cut-off E-value of 1.0E-5. (B) Similarity distribution of the top BLAST hits for each sequence. (C) Species distribution is shown as a percentage of the total homologous sequences with an E-value of at least 1.0E-5. We used the first hit of each sequence for analysis.

                  Functional annotation based on GO, COG and KEGG analysis

                  The putative functions of unique sequences in two different libraries were analyzed according to Gene Ontology (GO) and Clusters of Orthologous Groups of protein (COGs) classifications. Analysis of GO categories showed that the functional distribution of the genes of the two libraries was similar. A total of 14,166 and 14,352 unique sequences map to biological processes, 15,130 and 14,923 sequences map to cellular components, and 7,137 and 7,252 sequences map to molecular functions in the control and SGIV infected libraries, respectively. In both libraries, most of the corresponding biological process genes were involved in cellular processes, biological regulation and metabolic processes. Most of the cellular component genes encode proteins associated with parts of cells and cell organelles; most of the molecular function genes were associated with binding, catalytic activity, and transporter activity (Figure 2).
                  http://static-content.springer.com/image/art%3A10.1186%2F1471-2164-12-556/MediaObjects/12864_2011_3687_Fig2_HTML.jpg
                  Figure 2

                  GO annotations of non-redundant sequences in mock and SGIV infected libraries. Most non-redundant sequences can be divided into three major categories, including molecular function (A), cellular component (B), and biological process (C).

                  Classification of the unigenes into COG categories is critical for functional and evolutionary studies [14]. Among the 25 COG categories, the cluster in the control library for "translation, ribosomal structure and biogenesis" represented the largest group (185 ESTs), followed by the "posttranslational modification, protein turnover, chaperones" and "general function prediction" clusters. Similarly, in the SGIV infected library, the cluster for "translation, ribosomal structure and biogenesis" represented the largest group (172 ESTs) followed by "general function prediction" and "posttranslational modification, protein turnover, chaperones" clusters (Figure 3).
                  http://static-content.springer.com/image/art%3A10.1186%2F1471-2164-12-556/MediaObjects/12864_2011_3687_Fig3_HTML.jpg
                  Figure 3

                  Histogram presentation of clusters of orthologous groups (COG) classification in mock and SGIV infected libraries.

                  KEGG is a pathway-based categorization of orthologous genes that provides useful information for predicting functional profiles of genes [15]. In this study the unique sequences of two libraries were categorized within the KEGG database. The matched sequences were involved in metabolism processes, cellular processes, signal transduction and cell cycles. Partial KEGG pathways associated with immune and inflammation responses are listed in Table 2. The conserved MAPK signaling molecules can be found in control (C) and SGIV-infected libraries (V), which contained 65 and 71 ESTs, respectively (Additional file 1). In addition, a large number of ESTs were involved in RIG-I signaling pathway (C, 21 hits; V, 20 hits), TLR signaling pathway (C, 28 hits; V, 26 hits), chemokine signaling pathway (C, 62 hits; 73 hits) and P53 signaling pathway (C, 22 hits; V, 25 hits) in two different libraries (Additional file 2 and 3). Many ESTs associated with mammalian signaling pathway genes, including MAP Kinase phosphatase 1 (MKP-1), Nur77, stimulator of interferon genes (STING), and tripartite motif protein (finTRIM) were initially disclosed in marine fish.
                  Table 2

                  Number of ESTs involved in KEGG pathway (number of ESTs > 10)

                  Pathway

                  Pathway Name

                  Number of ESTs

                    

                  Control library

                  SGIV infected library

                  04010

                  MAPK signaling pathway

                  65

                  71

                  04062

                  Chemokine signaling pathway

                  62

                  73

                  04120

                  Ubiquitin mediated proteolysis

                  57

                  69

                  04660

                  T cell receptor signaling pathway

                  39

                  35

                  03050

                  Proteasome

                  39

                  37

                  04620

                  Toll-like receptor signaling pathway

                  28

                  26

                  04662

                  B cell receptor signaling pathway

                  28

                  30

                  04630

                  Jak-STAT signaling pathway

                  26

                  25

                  04020

                  Calcium signaling pathway

                  25

                  36

                  04210

                  Apoptosis

                  24

                  26

                  04115

                  p53 signaling pathway

                  22

                  25

                  04622

                  RIG-I-like receptor pathway

                  21

                  20

                  04350

                  TGF-beta signaling pathway

                  17

                  23

                  04150

                  mTOR signaling pathway

                  13

                  13

                  Putative genes involved in up-regulation or down-regulation during SGIV infection

                  Among unique sequences that shared > 30% identity (E value < 1e-5) to known genes in the NCBI database, 2,057 genes were cross-expressed in both the control and the SGIV-infected libraries. Using the Fisher's exact test based on the number of homologous ESTs, we found that 755 genes were significantly up-regulated, while 695 genes were significantly down-regulated in response to SGIV infection. A large number of genes were only present in either the control library or the SGIV-infected library. The up-regulated and down-regulated partial genes are listed in Tables 3 and 4, respectively. The alternated genes included cytoskeletal genes, enzymes, and other immune-related genes, such as chemokines, interleukins and interferon-induced proteins. These genes have different expression patterns during SGIV infection, which implies that they may play an important role in physiological processes associated with SGIV infection.
                  Table 3

                  Unique genes with increased expression in spleen after SGIV infection

                  Gene name

                  species

                  expression in normal

                  Expression in infection

                  Fisher p_value

                  Profilin-2

                  Rattus norvegicus

                  305

                  29051

                  0

                  60S ribosomal protein

                  Homo sapiens

                  251

                  23569

                  0

                  Eotaxin

                  Mus musculus

                  3169

                  17689

                  0

                  Granulins

                  Rattus norvegicus

                  1141

                  15720

                  0

                  Leukocyte cell-derived chemotaxin-2

                  Mus musculus

                  4809

                  10637

                  0

                  Thioredoxin

                  Ictalurus punctatus

                  542

                  7343

                  0

                  Saposin-C

                  Cavia porcellus

                  43

                  5116

                  0

                  Cystatin-B 1

                  Macaca fuscata

                  92

                  4388

                  0

                  Perforin-1

                  Mus musculus

                  105

                  4097

                  0

                  Scavenger receptor cysteine-rich type 1 protein

                  Canis familiaris

                  911

                  3958

                  0

                  Eukaryotic translation initiation factor 4 gamma 2

                  Gallus gallus

                  573

                  3829

                  0

                  Gamma-glutamyl hydrolase

                  Homo sapiens

                  133

                  2638

                  0

                  Legumain

                  Bos taurus

                  445

                  2572

                  0

                  Proteasome subunit alpha type-7

                  Carassius auratus

                  35

                  2452

                  0

                  Glyceraldehyde 3-phosphate dehydrogenase,

                  Danio rerio

                  103

                  1983

                  0

                  Transcription factor BTF3

                  Mus musculus

                  83

                  1770

                  0

                  Src-like-adapter

                  Mus musculus

                  84

                  1371

                  2.02E-303

                  Keratin 8

                  Gallus gallus

                  182

                  1586

                  5.86E-283

                  Galectin-3-binding protein B

                  Danio rerio

                  450

                  2187

                  8.23E-277

                  SUMO-conjugating enzyme

                  Xenopus tropicalis

                  137

                  1307

                  8.94E-243

                  C-C motif chemokine 18

                  Macaca mulatta

                  282

                  1667

                  3.00E-242

                  Galectin-3-binding protein A

                  Danio rerio

                  371

                  1747

                  3.37E-216

                  Hemoglobin subunit beta-1

                  Pseudaphritis urvillii

                  241

                  1383

                  1.38E-197

                  Keratin 18

                  Oncorhynchus mykiss

                  1661

                  3701

                  7.37E-180

                  Eukaryotic translation initiation factor 3

                  Bos taurus

                  67

                  844

                  4.27E-174

                  Cytochrome b

                  Tropheus moorii

                  6544

                  9945

                  1.29E-163

                  Natural killer cell protease 1

                  Rattus norvegicus

                  227

                  1138

                  1.95E-148

                  T-complex protein 1

                  Gallus gallus

                  50

                  669

                  6.61E-141

                  RNA-binding protein 5

                  Xenopus tropicalis

                  45

                  605

                  7.97E-128

                  Cathepsin H

                  Sus scrofa

                  391

                  1347

                  3.79E-125

                  Beta-2-glycoprotein 1

                  Bos taurus

                  433

                  1389

                  7.97E-119

                  Dipeptidyl peptidase 1

                  Bos taurus

                  55

                  586

                  1.36E-114

                  Proto-oncogene vav

                  Mus musculus

                  98

                  693

                  8.51E-113

                  Proteasome subunit alpha type-4

                  Homo sapiens

                  684

                  1761

                  2.56E-111

                  Actin-related protein 2/3 complex subunit 5

                  Mus musculus

                  90

                  656

                  1.35E-108

                  Proteasome subunit beta type-6-B like

                  Salmo salar

                  469

                  1361

                  8.49E-103

                  RING-box protein 2

                  Mus musculus

                  42

                  497

                  3.76E-101

                  NADH-ubiquinone oxidoreductase chain 1

                  Carassius auratus

                  330

                  1102

                  2.68E-99

                  Phospholipid hydroperoxide glutathione peroxidase

                  Sus scrofa

                  590

                  1527

                  1.66E-97

                  Retinol-binding protein 1

                  Bos taurus

                  164

                  767

                  1.80E-95

                  NudC domain-containing protein 2

                  Rattus norvegicus

                  81

                  576

                  3.36E-94

                  Lysozyme g

                  Epinephelus coioides

                  164

                  742

                  5.02E-90

                  Voltage-gated hydrogen channel 1

                  Danio rerio

                  217

                  742

                  4.09E-69

                  Ubiquitin-like modifier-activating enzyme 5

                  Xenopus laevis

                  179

                  670

                  8.17E-69

                  LRR and PYD domains-containing protein 1

                  Homo sapiens

                  205

                  714

                  6.02E-68

                  Cytochrome c oxidase subunit 6B1

                  Tarsius syrichta

                  60

                  395

                  2.33E-62

                  Ig lambda chain

                  Homo sapiens

                  31

                  315

                  2.99E-61

                  Interleukin-8

                  Equus caballus

                  155

                  572

                  4.14E-58

                  Fibroleukin

                  Homo sapiens

                  611

                  1281

                  3.75E-56

                  Rho GDP-dissociation inhibitor 1

                  Macaca fascicularis

                  325

                  844

                  4.69E-55

                  Ependymin

                  Notemigonus crysoleucas

                  70

                  386

                  5.52E-55

                  Fucolectin-4

                  Anguilla japonica

                  1519

                  2434

                  1.29E-50

                  Complement factor H

                  Homo sapiens

                  131

                  459

                  1.88E-44

                  Eukaryotic initiation factor 4A-III

                  Xenopus tropicalis

                  56

                  282

                  4.32E-38

                  Cysteine and glycine-rich protein 2

                  Mus musculus

                  61

                  290

                  1.68E-37

                  Proliferating cell nuclear antigen

                  Haplochromis burtoni

                  237

                  575

                  3.64E-34

                  Secernin-3

                  Danio rerio

                  64

                  277

                  2.42E-33

                  Ubiquitin-conjugating enzyme E2

                  Mus musculus

                  74

                  286

                  4.09E-31

                  Heat shock cognate 71 kDa protein

                  Oryzias latipes

                  25

                  181

                  8.31E-31

                  Table 4

                  Unique genes with decreased expression in spleen after SGIV infection

                  swissprot_annotation

                  species

                  Expression in control

                  Expression in infection

                  Fisher p_value

                  H-2 class II histocompatibility antigen

                  Mus musculus

                  11365

                  1044

                  0

                  Glutathione peroxidase 1

                  Bos taurus

                  3469

                  509

                  0

                  Endothelial differentiation-related factor 1

                  Xenopus laevis

                  5830

                  172

                  0

                  Inositol-3-phosphate synthase 1-A

                  Xenopus laevis

                  1618

                  148

                  0

                  Palmitoyl-protein thioesterase 1

                  Mus musculus

                  6570

                  92

                  0

                  Proteasome subunit beta type-2

                  Bos taurus

                  2244

                  84

                  0

                  Cytochrome c oxidase subunit 1

                  Gadus morhua

                  7690

                  66

                  0

                  Myosin light polypeptide 6

                  Rattus norvegicus

                  1733

                  65

                  0

                  Eukaryotic translation initiation factor 3 subunit

                  Danio rerio

                  1765

                  60

                  0

                  Gamma-interferon-inducible lysosomal thiol reductase

                  Homo sapiens

                  2962

                  55

                  0

                  Mid1-interacting protein 1-like

                  Danio rerio

                  3667

                  54

                  0

                  Elongation factor 1-gamma

                  Carassius auratus

                  1821

                  51

                  0

                  Plastin-2

                  Danio rerio

                  1777

                  51

                  0

                  ribosomal protein S8

                  Rattus norvegicus

                  1737

                  48

                  0

                  Stefin-C

                  Bos taurus

                  1991

                  46

                  0

                  Complement C1q subcomponent subunit A

                  Bos taurus

                  1511

                  43

                  0

                  ribosomal protein L22

                  Xenopus tropicalis

                  2286

                  33

                  0

                  ribosomal protein L18

                  Oreochromis niloticus

                  1598

                  29

                  0

                  Nucleolar protein 16

                  Tetraodon nigroviridis

                  1949

                  377

                  9.53E-251

                  Transcription initiation factor TFIID

                  Pongo abelii

                  2123

                  469

                  6.58E-246

                  Transforming protein RhoA

                  Rattus norvegicus

                  1258

                  202

                  4.46E-184

                  Peroxiredoxin

                  Cynops pyrrhogaster

                  2563

                  982

                  7.87E-157

                  Myosin regulatory light chain 2

                  Gallus gallus

                  5634

                  3124

                  2.64E-154

                  Heat shock 70 kDa protein

                  Canis familiaris

                  612

                  31

                  7.54E-140

                  Ras-related C3 botulinum toxin substrate 2

                  Bos taurus

                  928

                  167

                  1.56E-126

                  SH3 domain-containing protein

                  Mus musculus

                  609

                  48

                  1.33E-123

                  Rab GDP dissociation inhibitor beta

                  Rattus norvegicus

                  602

                  48

                  9.70E-122

                  Cystatin-A5

                  Sus scrofa

                  2339

                  994

                  4.94E-120

                  Radixin

                  Mus musculus

                  675

                  77

                  8.53E-119

                  Interferon-inducible GTPase 1

                  Homo sapiens

                  805

                  181

                  4.16E-93

                  C-X-C chemokine receptor type 4

                  Papio anubis

                  1929

                  851

                  1.51E-92

                  AIG2-like domain-containing protein

                  Danio rerio

                  617

                  128

                  1.59E-76

                  Major complex class I-related gene

                  Mus musculus

                  1058

                  366

                  1.83E-76

                  Thioredoxin-dependent peroxide reductase,

                  Homo sapiens

                  769

                  209

                  1.20E-74

                  Death-associated protein-like 1-B

                  Xenopus laevis

                  1417

                  638

                  9.05E-66

                  RING finger protein 10

                  Mus musculus

                  277

                  24

                  3.52E-55

                  Mannan-binding lectin serine protease 2

                  Mus musculus

                  2177

                  1249

                  6.20E-55

                  GTP-binding nuclear protein

                  Salmo salar

                  3669

                  2432

                  9.56E-54

                  Regulator of G-protein signaling 8

                  Danio rerio

                  1206

                  639

                  6.61E-39

                  Matrix metalloproteinase-9

                  Homo sapiens

                  199

                  21

                  2.33E-37

                  Bleomycin hydrolase

                  Gallus gallus

                  418

                  125

                  2.50E-37

                  Src kinase-associated phosphoprotein 2

                  Takifugu rubripes

                  257

                  47

                  8.27E-36

                  Interferon-induced protein 44-like

                  Mus musculus

                  352

                  94

                  1.44E-35

                  Protein disulfide-isomerase A4

                  Rattus norvegicus

                  191

                  21

                  2.56E-35

                  Macrophage mannose receptor 1

                  Homo sapiens

                  257

                  49

                  8.14E-35

                  Prothymosin alpha-B

                  Danio rerio

                  186

                  21

                  4.75E-34

                  Ubiquitin-conjugating enzyme E2

                  Drosophila melanogaster

                  344

                  97

                  6.36E-33

                  Myosin-8

                  Canis familiaris

                  1023

                  547

                  1.60E-32

                  cAMP-responsive element-binding protein

                  Danio rerio

                  684

                  312

                  8.58E-32

                  Programmed cell death protein 10

                  Mus musculus

                  383

                  123

                  1.42E-31

                  Peroxisomal membrane protein 2

                  Bos taurus

                  612

                  267

                  3.46E-31

                  E3 ubiquitin-protein ligase

                  Homo sapiens

                  220

                  41

                  2.02E-30

                  Myoferlin

                  Xenopus tropicalis

                  262

                  62

                  4.71E-30

                  Ras-related protein Rab7

                  Gossypium hirsutum

                  223

                  50

                  6.44E-27

                  Dynactin subunit 6

                  Homo sapiens

                  242

                  61

                  2.40E-26

                  protease regulatory subunit 4

                  Rattus norvegicus

                  229

                  55

                  4.43E-26

                  Interferon regulatory factor 1

                  Gallus gallus

                  446

                  183

                  1.06E-25

                  Hephaestin-like protein 1

                  Mus musculus

                  276

                  88

                  2.05E-23

                  Galectin-8

                  Homo sapiens

                  158

                  29

                  1.39E-22

                  Apoptosis-associated speck-like protein

                  Danio rerio

                  497

                  233

                  2.41E-22

                  Validation of the changes in gene expression by quantitative real-time PCR

                  To validate whether the up-regulated or down-regulated genes identified by statistical analysis were involved in SGIV infection, we detected the relative expression of partial genes using quantitative real time-PCR (qRT-PCR). As shown in Figure 4, the relative expression of IL-8, Chemokine (C-C motif) ligand 18 (CCL18), g-type lysozyme (g-lysozyme) and cystatin B increased significantly after SGIV infection, compared with the expression of these genes in the control fish. In contrast, the expression of the interferon-inducible GTPase 1 (IIGP1), transcription Factor II D (TFIID), gamma interferon (IFN-γ)-inducible lysosomal thiol reductase (GILT) and C-C chemokine receptor type 4 (CCR4) decreased after SGIV infection. Thus, these results suggested that SGIV infection modulated numerous host gene expressions for the completion its life cycle.
                  http://static-content.springer.com/image/art%3A10.1186%2F1471-2164-12-556/MediaObjects/12864_2011_3687_Fig4_HTML.jpg
                  Figure 4

                  The differential expression of selected genes was validated by qRT-PCR. Relative expression of genes with increased abundance (A) or decreased abundance (B) was detected. The relative gene expression in grouper injected with PBS (control) was defined as 1, and that in SGIV infected grouper (48 h p.i.) was indicated by the fold increase or decrease compared to the control.

                  Discussion

                  An increasing number of reports reveal that transcriptome sequencing of cDNA has became an efficient strategy for generating enormous sequences that represent expressed genes [16]. Transcriptomes from a number of species including those from Drosophila melanogaster, yeast, Caenorhabditis elegans and various mammals and plants were carried out for different purposes [1721]. However, genome and transcriptome data for many "lower" vertebrate species, particularly marine fishes, have not been disclosed. To our knowledge, a limited numbers of E. coioides genes were cloned and characterized, based on the bioinformatic analysis, including those involved in immune responses after pathogenic attack, growth and development [2227]. Given that the spleen is one of the most important organs associated with immune responses in fish and is also the main target organ for SGIV infection, the transcriptome sequencing of the E. coioides spleen can be expected to provide a significant number of ESTs for marine fish immune responses and contribute to understanding iridovirus-host interactions [5].

                  After removal of overlapping sequences between the control and SGIV-infected libraries, we obtained 65374 non-redundant consensus sequences from E. coioides. With the exception of sequences related to cellular structure and metabolism, abundant sequences were found to be homologous to known immune-relevant genes in other species, based on the BLAST, Conserved Domain Database (CDD), and SWISS-PROT annotation [2830]. More than 80 sequences shared homology to signaling molecules of the mammalian mitogen-activated protein kinase (MAPK) pathways, such as critical molecules associated with extracellular signal-regulated kinase (ERK), p38 MAPK, Ras, RSK2, MKK4, MKK7, ASK1, MEK1/2 and Raf1. The mammalian MAPK signaling pathway was activated during virus infection and contributed to virus replication [3133]. Although the MAPK signaling molecules including ERK, c-Jun N-terminal kinase (JNK) and p38 MAPK were activated in the spleens of SGIV-infected fish (EAGS) cells, identifying the exact roles of these molecules during SGIV replication will benefit from the E. coioides EST information [34, 35]. With the exception of homologue components in the MAPK cascade, different members of interferon-related genes were obtained, including the interferon-induced protein viperin, the interferon-stimulated gene 15 (ISG15), interferon-induced protein 35 kD (IFP35), interferon-stimulated gene 56 (ISG56), and interferon regulatory factors (IRF-1, IRF-2, IRF-3, IRF-4, IRF-5, IRF-7, IRF-8 and IRF-9). Interferon-induced, or stimulated, genes were important for the resistance of the host to virus infection, including virus entry, replication and release [3638]. The E. coioides IRF-1, IRF-2 and IRF-7 genes have been cloned and characterized and IRF-7 was confirmed as being vitally important for SGIV replication [39, 40]. Human ISG15 expression is strongly up-regulated during viral infections, such as human cytomegalovirus (HCMV) and herpes simplex virus (HSV), and ISG15 up-regulation was considered to be involved in different strategies relating to the antiviral response [4144]. IFP35 and ISG56 were also involved in the cellular antiviral response against virus infection [38, 45]. A detailed investigation on the functions of E. coioides interferon-related genes during SGIV infection will contribute greatly to understanding how the SGIV exploited, or evaded, the host interferon immune response.

                  We also obtained sequences that shared homology to SGIV-encoded immune evasion genes, including lipopolysaccharide-induced tumor necrosis factor-α factor (LITAF), tumor necrosis factor receptor (TNFR), ubiquitin and Bcl-2 [4648]. Iridovirus-encoded LITAF and Bcl-2 could mediate the fate of host cells by regulating apoptosis [47, 48]. It has been reported that many viral immune evasion genes are considered as "stolen" mimics from the host and such viruses may interfere with the host response by modulating or disrupting the function of corresponding host genes [4951]. The discovery of these sequences will be helpful in studies on host-virus interactions. In addition, we also found that other molecules such as lectin, hepcidin, lysozyme and antimicrobial peptide are involved in immune responses. The functions of these genes during virus infection will be investigated in the further studies.

                  Based on results from exploratory statistical analysis, we identified genes that are up-regulated or down-regulated after SGIV infection. The present data from qRT-PCR analysis validated the hypothesis that expression of partial genes is regulated by SGIV infection, including cytokine, cytokine receptor and transcription factor, apoptosis-associated genes, interferon-related genes, and cytoskeleton genes. Previous studies indicated that the expression of different groups of genes relating to cellular structure, apoptosis, gene transcription and immune regulation were altered in response to virus infections or other stimuli [37, 5254]. Further research into the roles of these differentially-expressed genes will contribute to an increased understanding of the critical events that take place during SGIV replication.

                  Conclusions

                  In summary, we studied the immune response of marine fish to virus infection using SGIV infected E. coioides as a model. More than 400 000 high-quality ESTs were obtained from the E. coioides spleen cDNA library by 454 sequencing. These unique sequences contribute greatly to the investigation into changes in gene expression patterns and their molecular functions during pathogens infection, and also provide an abundant data source for the identification of novel genes in E. coioides. This gene information can be used to provide further insights into the functions of chemokines, proinflammatory factors, interferon-induced genes and other cytokines and will thus stimulate further study on the immune response of E. coioides to pathogens. The experimental validation of the gene expression alterations during SGIV infection provides new insights into understanding iridovirus-host interactions.

                  Methods

                  E. coioides and virus challenge

                  To construct spleen cDNA libraries, groupers (E. coioides) of 15 cm total length were obtained from a local farm in Guangzhou, China. Sampling detection indicated that these fish tested negative to SGIV infection. All the fish were maintained in a laboratory recirculating seawater system at 25-30°C for 2 weeks. Healthy fish that displayed normal levels of activity were used in this study. The virus suspension used as a challenge was collected from SGIV-infected GS cells. The fish were challenged by injecting with 0.2 ml of the SGIV suspension (1 × 105 TCID50/ml). As a control, an equal volume of PBS was likewise injected. At 48 h post-infection, fish were sacrificed and tissue samples were taken from the spleens. These were stored in liquid nitrogen for later RNA extraction.

                  RNA extraction, cDNA library construction and 454 sequencing

                  Total RNA was extracted from the spleens of the control and SGIV-infected fish using an SV total RNA Isolation kit (Promega). The cDNA library preparation and 454-pyrosequencing were performed as described in Salem et al. [11]. This encompassed a number of procedures as described below. In brief, the first and second strand cDNA were synthesized from 1 μg of total RNA using the SMART PCR cDNA Synthesis Kit (Clonetech, USA) with modified 3' primer 5'-AAGCAGTGGTATCAACGCAGAGTGCAG(T20)VN-3' that contained a BsgI cleavage site. Then the double-stranded cDNA was digested with BsgI for 16 h and cleaned with a QIAquick Minelute PCR purification column (Qiagen, CA). The purified cDNA was sheared into fragments ranging from about 400 to 1000 base pairs by nebulization. After the short fragments (< 400 bp) were removed by AMPure bead (Agencourt), samples were processed with GS FLX Titanium General DNA Library Preparation Kit (Roche) following the manufacturer's instructions. Sequencing was carried out using Roche 454 Genome Sequencer FLX instrument. All the obtained data were submitted to NCBI database.

                  Data analysis

                  To analyze the data generated by the FLX sequencer, the sequences of adapters, low complexity and low-quality sequences were filtered out by using Seq-clean and LUCY software [55]. The screened high-quality sequences were de novo assembled used CAP3 software under default parameters [56]. ESTs that did not form contigs were designated as singlets. Putative functions of all the unique sequences (contigs and singlets) were predicted using local BLASTall programs against sequences in the NCBI non-redundant (nr) protein database and the swissprot database (E-value < 1e-5). Each unique sequence was used to determine the COG term, GO term, and the involvement of KEGG pathway database [14, 15].

                  To compare the gene expression profile between two different libraries, EST occurrence was evaluated statistically. The abundance of unique sequence, expressed as an increase or decrease if the number of hits in SGIV-infected library, was classed as "significantly more" or "significantly less" than that of a normal library. The statistical significance of ESTs with different abundance values was determined using Fisher's exact test [57, 58]. A P value of < 0.05 was considered as statistically significant.

                  Quantitative real-time PCR

                  Quantitative real-time PCR was carried out using a LightCycler ® 480 Real-Time PCR System (Roche), with SYBR Green as the fluorescent dye, according to the manufacturer's protocol (TOYOBO). Different genes including cytokines (IL-8, CCL18), cytokine receptors (CCR4), transcription factors (TFIID), apoptosis-associated genes (cystatin B), interferon-related genes (GILT, IIGP1) and others (lysozyme G) were used for validation. Primer sequences are listed in Table 5. Reaction conditions were as follows: 95°C for 1 min, followed by 40 cycles at 94°C for 15 s and at 60°C for 1 min; all the reactions were performed in biological triplicates and samples were normalized using β-actin. Results were expressed as relative fold of β-actin in each experiment, as mean ± SD.
                  Table 5

                  Primers used in this study.

                  Name

                  Sequence of primers (5'→3')

                  Cystatin-PF

                  GTGATGAGGTAAAGCCCAGTGCGGAG

                  Cystatin-PR

                  TGGCAGTGGTTTGAAAACACGGAGGT

                  CCL18-PF

                  TGCTTTCCTCAGTGATCTGCCAG

                  CCL18-PR

                  AGATGCGACGACCCTTTTTTGAA

                  CCR4-PF

                  ACAACAGCCAAGCCACAGGAAGC

                  CCR4-PR

                  CAGGTGAAAAAACAAACAATGAA

                  IL8-PF

                  GTGTCAACCCAGTGCTGTATGCCTT

                  IL8-PR

                  TTCAAAGTGTCTCTCTGGTCGTCTC

                  IIGP1-PF

                  ACCACCTTAGAGGCTACACCATACCCC

                  IIGP1-PR

                  TCTCCTGAGCGAGTTTCACATCATTTT

                  GILT-PF

                  TGTTCCTAACTGAGATGCTCTTCCCC

                  GILT-PR

                  ATGTTGCCCTGACATTCTGGTGGTC

                  g-lysozyme-PF

                  CCTATAATACCTACGGGCTGATG

                  g-lysozyme-PR

                  TAGGCTGCTATCCCACCTTTCA

                  TFIID-PF

                  CCAGGAGGATGAGGAGGAGGAG

                  TFIID-PR

                  GCTGTATGGAGGAGAAAGGGTT

                  Abbreviations

                  SGIV: 

                  Singapore grouper iridovirus

                  GO: 

                  Gene ontology

                  COG: 

                  clusters of orthologous group

                  KEGG: 

                  Kyoto Encyclopedia of Genes and Genomes

                  MAPK: 

                  mitogen-activated protein kinase

                  OSGIV: 

                  orange-spotted grouper iridovirus

                  TGIV: 

                  Taiwan grouper iridovirus

                  TRIM: 

                  tripartite motif protein

                  STING: 

                  stimulator of interferon genes

                  IIGP1: 

                  interferon-inducible GTPase 1

                  TFIID: 

                  transcription Factor II D

                  GILT: 

                  gamma interferon (IFN-γ)-inducible lysosomal thiol reductase

                  CCR4: 

                  C-C chemokine receptor type 4

                  LITAF: 

                  lipopolysaccharide-induced tumor necrosis factor-α factor

                  TNFR: 

                  tumor necrosis factor receptor.

                  Declarations

                  Acknowledgements

                  This work was supported by grants from National Basic Research Program of China (973) (2012CB114402), the Natural Science Foundation of China (30930070, 30800846, 30725027) and the knowledge innovation program of the Chinese Academy of Sciences (SQ200902, KZCX2-EW-Q213, KZCX2-YW-BR-08).

                  Authors’ Affiliations

                  (1)
                  Key Laboratory of Marine Bio-resources Sustainable Utilization, South China Sea Institute of Oceanology, Chinese Academy of Sciences
                  (2)
                  State Key Laboratory of Biocontrol, School of Life Sciences, Sun Yat-sen University

                  References

                  1. Zhou L, Gui JF: Molecular mechanisms underlying sex change in hermaphroditic groupers. Fish Physiol Biochem 2010, 36:181–193.PubMedView Article
                  2. Marino G, Azzurro E, Massari A, Finoia MG, Mandich A: Reproduction in the dusky grouper from the southern Mediterranean. J Fish Biol 2001, 58:908–927.View Article
                  3. Walker PJ, Winton JR: Emerging viral diseases of fish and shrimp. Vet Res 2010, 41:51.PubMedView Article
                  4. Whittington RJ, Becker JA, Dennis MM: Iridovirus infections in finfish - critical review with emphasis on ranaviruses. J Fish Dis 2010, 33:95–122.PubMedView Article
                  5. Qin QW, Shi C, Gin KY, Lam TJ: Antigenic characterization of a marine fish iridovirus from grouper, Epinephelus spp. J Virol Methods 2002, 106:89–96.PubMedView Article
                  6. Chao CB, Chen CY, Lai YY, Lin CS, Huang HT: Histological, ultrastructural, and in situ hybridization study on enlarged cells in grouper Epinephelus hybrids infected by grouper iridovirus in Taiwan (TGIV). Dis Aquat Organ 2004, 58:127–142.PubMedView Article
                  7. Kai YH, Su HM, Tai KT, Chi SC: Vaccination of grouper broodfish (Epinephelus tukula) reduces the risk of vertical transmission by nervous necrosis virus. Vaccine 2010, 28:996–1001.PubMedView Article
                  8. Lü L, Zhou SY, Chen C, Weng SP, Chan SM, He JG: Complete genome sequence analysis of an iridovirus isolated from the orange-spotted grouper, Epinephelus coioides. Virology 2005, 339:81–100.PubMedView Article
                  9. Vera JC, Wheat CW, Fescemyer HW, Frilander MJ, Crawford DL, Hanski I, Marden JH: Rapid transcriptome characterization for a nonmodel organism using 454 pyrosequencing. Mol Ecol 2008, 17:1636–1647.PubMedView Article
                  10. Alagna F, D'Agostino N, Torchia L, Servili M, Rao R, Pietrella M, Giuliano G, Chiusano ML, Baldoni L, Perrotta G: Comparative 454 pyrosequencing of transcripts from two olive genotypes during fruit development. BMC Genomics 2009, 10:399.PubMedView Article
                  11. Salem M, Rexroad CE, Wang J, Thorgaard GH, Yao J: Characterization of the rainbow trout transcriptome using Sanger and 454-pyrosequencing approaches. BMC Genomics 2010, 11:564.PubMedView Article
                  12. Guo S, Zheng Y, Joung JG, Liu S, Zhang Z, Crasta OR, Sobral BW, Xu Y, Huang S, Fei Z: Transcriptome sequencing and comparative analysis of cucumber flowers with different sex types. BMC Genomics 2010, 11:384.PubMedView Article
                  13. Emrich SJ, Barbazuk WB, Li L, Schnable PS: Gene discovery and annotation using LCM-454 transcriptome sequencing. Genome Res 2007, 17:69–73.PubMedView Article
                  14. Tatusov RL, Galperin MY, Natale DA, Koonin EV: The COG database: a tool for genome-scale analysis of protein functions and evolution. Nucleic Acids Res 2000, 28:33–36.PubMedView Article
                  15. Kanehisa M, Goto S: KEGG: kyoto encyclopedia of genes and genomes. Nucleic Acids Res 2000, 28:27–30.PubMedView Article
                  16. Morozova O, Hirst M, Marra MA: Applications of new sequencing technologies for transcriptome analysis. Annu Rev Genomics Hum Genet 2009, 10:135–151.PubMedView Article
                  17. Graveley BR, Brooks AN, Carlson JW, Duff MO, Landolin JM, Yang L, Artieri CG, van Baren MJ, Boley N, Booth BW, Brown JB, Cherbas L, Davis CA, Dobin A, Li R, Lin W, Malone JH, Mattiuzzo NR, Miller D, Sturgill D, Tuch BB, Zaleski C, Zhang D, Blanchette M, Dudoit S, Eads B, Green RE, Hammonds A, Jiang L, Kapranov P, Langton L, Perrimon N, Sandler JE, Wan KH, Willingham A, Zhang Y, Zou Y, Andrews J, Bickel PJ, Brenner SE, Brent MR, Cherbas P, Gingeras TR, Hoskins RA, Kaufman TC, Oliver B, Celniker SE: The developmental transcriptome of Drosophila melanogaster. Nature 2011, 471:473–479.PubMedView Article
                  18. Wilhelm BT, Marguerat S, Watt S, Schubert F, Wood V, Goodhead I, Penkett CJ, Rogers J, Bähler J: Dynamic repertoire of a eukaryotic transcriptome surveyed at single-nucleotide resolution. Nature 2008, 453:1239–1243.PubMedView Article
                  19. Mizrachi E, Hefer CA, Ranik M, Joubert F, Myburg AA: De novo assembled expressed gene catalog of a fast-growing Eucalyptus tree produced by Illumina mRNA-Seq. BMC Genomics 2010, 11:681.PubMedView Article
                  20. Fehniger TA, Wylie T, Germino E, Leong JW, Magrini VJ, Koul S, Keppel CR, Schneider SE, Koboldt DC, Sullivan RP, Heinz ME, Crosby SD, Nagarajan R, Ramsingh G, Link DC, Ley TJ, Mardis ER: Next-generation sequencing identifies the natural killer cell microRNA transcriptome. Genome Res 2010, 20:1590–1604.PubMedView Article
                  21. Li P, Ponnala L, Gandotra N, Wang L, Si Y, Tausta SL, Kebrom TH, Provart N, Patel R, Myers CR, Reidel EJ, Turgeon R, Liu P, Sun Q, Nelson T, Brutnell TP: The developmental dynamics of the maize leaf transcriptome. Nat Genet 2010, 42:1060–1067.PubMedView Article
                  22. Jin JY, Zhou L, Wang Y, Li Z, Zhao JG, Zhang QY, Gui JF: Antibacterial and Antiviral Roles of a Fish β-Defensin Expressed Both in Pituitary and Testis. PLoS One 2010, 5:e12883.PubMedView Article
                  23. Zhou JG, Wei JG, Xu D, Cui HC, Yan Y, Ou-Yang ZL, Huang XH, Huang YH, Qin QW: Molecular cloning and characterization of two novel hepcidins from orange-spotted grouper, Epinephelus coioides. Fish Shellfish Immunol 2011, 30:559–568.PubMedView Article
                  24. Cui H, Yan Y, Wei J, Hou Z, Huang Y, Huang X, Qin Q: Cloning, characterization, and expression analysis of orange-spotted grouper (Epinephelus coioides) ILF2 gene (EcILF2). Fish Shellfish Immunol 2011, 30:378–388.PubMedView Article
                  25. Dong H, Zeng L, Duan D, Zhang H, Wang Y, Li W, Lin H: Growth hormone and two forms of insulin-like growth factors I in the giant grouper (Epinephelus lanceolatus): molecular cloning and characterization of tissue distribution. Fish Physiol Biochem 2010, 36:201–212.PubMedView Article
                  26. Shi Y, Zhang Y, Li S, Liu Q, Lu D, Liu M, Meng Z, Cheng CH, Liu X, Lin H: Molecular identification of the Kiss2/Kiss1ra system and its potential function during 17alpha-methyltestosterone-induced sex reversal in the orange-spotted grouper, Epinephelus coioides. Biol Reprod 2010, 83:63–74.PubMedView Article
                  27. Xia W, Zhou L, Yao B, Li CJ, Gui JF: Differential and spermatogenic cell-specific expression of DMRT1 during sex reversal in protogynous hermaphroditic groupers. Mol Cell Endocrinol 2007, 263:156–172.PubMedView Article
                  28. Junker V, Contrino S, Fleischmann W, Hermjakob H, Lang F, Magrane M, Martin MJ, Mitaritonna N, O'Donovan C, Apweiler R: The role SWISS-PROT and TrEMBL play in the genome research environment. J Biotechnol 2000, 78:221–234.PubMedView Article
                  29. Ye J, McGinnis S, Madden TL: BLAST: improvements for better sequence analysis. Nucleic Acids Res 2006, 34:W6–9.PubMedView Article
                  30. Marchler-Bauer A, Anderson JB, Chitsaz F, Derbyshire MK, DeWeese-Scott C, Fong JH, Geer LY, Geer RC, Gonzales NR, Gwadz M, He S, Hurwitz DI, Jackson JD, Ke Z, Lanczycki CJ, Liebert CA, Liu C, Lu F, Lu S, Marchler GH, Mullokandov M, Song JS, Tasneem A, Thanki N, Yamashita RA, Zhang D, Zhang N, Bryant SH: CDD: specific functional annotation with the Conserved Domain Database. Nucleic Acids Res 2009, 37:D205–210.PubMedView Article
                  31. Xing Z, Cardona CJ, Anunciacion J, Adams S, Dao N: Roles of the ERK MAPK in the regulation of proinflammatory and apoptotic responses in chicken macrophages infected with H9N2 avian influenza virus. J Gen Virol 2010, 91:343–351.PubMedView Article
                  32. Regan AD, Cohen RD, Whittaker GR: Activation of p38 MAPK by feline infectious peritonitis virus regulates pro-inflammatory cytokine production in primary blood-derived feline mononuclear cells. Virology 2009, 384:135–143.PubMedView Article
                  33. Holloway G, Coulson BS: Rotavirus activates JNK and p38 signaling pathways in intestinal cells, leading to AP-1-driven transcriptional responses and enhanced virus replication. J Virol 2006, 80:10624–10633.PubMedView Article
                  34. Huang XH, Huang YH, Ouyang ZL, Xu LX, Yan Y, Cui HC, Han X, Qin QW: Singapore grouper iridovirus, a large DNA virus, induces nonapoptotic cell death by a cell type dependent fashion and evokes ERK signaling. Apoptosis 2011, 16:831–845.PubMedView Article
                  35. Huang XH, Huang YH, Ouyang ZL, Cai J, Yan Y, Qin QW: Roles of Stress-Activated Protein Kinases in the replication of Singapore grouper iridovirus and regulation of the inflammatory responses in grouper cells. J Gen Virol 92:1292–1301.
                  36. Jiang D, Weidner JM, Qing M, Pan XB, Guo H, Xu C, Zhang X, Birk A, Chang J, Shi PY, Block TM, Guo JT: Identification of five interferon-induced cellular proteins that inhibit west nile virus and dengue virus infections. J Virol 2010, 84:8332–8341.PubMedView Article
                  37. Wang X, Hinson ER, Cresswell P: The interferon-inducible protein viperin inhibits influenza virus release by perturbing lipid rafts. Cell Host Microbe 2007, 2:96–105.PubMedView Article
                  38. Li Y, Li C, Xue P, Zhong B, Mao AP, Ran Y, Chen H, Wang YY, Yang F, Shu HB: ISG56 is a negative-feedback regulator of virus-triggered signaling and cellular antiviral response. Proc Natl Acad Sci USA 2009, 106:7945–7950.PubMedView Article
                  39. Shi Y, Zhu XP, Yin JK, Zhang QY, Gui JF: Identification and characterization of interferon regulatory factor-1 from orange-spotted grouper (Epinephelus coioides). Mol Biol Rep 2010, 37:1483–1493.PubMedView Article
                  40. Cui H, Yan Y, Wei J, Huang X, Huang Y, Ouyang Z, Qin Q: Identification and functional characterization of an interferon regulatory factor 7-like (IRF7-like) gene from orange-spotted grouper, Epinephelus coioides. Dev Comp Immunol 2011, 35:672–684.PubMedView Article
                  41. Lenschow DJ, Lai C, Frias-Staheli N, Giannakopoulos NV, Lutz A, Wolff T, Osiak A, Levine B, Schmidt RE, García-Sastre A, Leib DA, Pekosz A, Knobeloch KP, Horak I, Virgin HW: IFN-stimulated gene 15 functions as a critical antiviral molecule against influenza, herpes, and Sindbis viruses. Proc Natl Acad Sci USA 2007, 104:1371–1376.PubMedView Article
                  42. Okumura A, Lu G, Pitha-Rowe I, Pitha PM: Innate antiviral response targets HIV-1 release by the induction of ubiquitin-like protein ISG15. Proc Natl Acad Sci USA 2006, 103:1440–1445.PubMedView Article
                  43. Nicholl MJ, Robinson LH, Preston CM: Activation of cellular interferon-responsive genes after infection of human cells with herpes simplex virus type 1. J Gen Virol 2000, 81:2215–2218.PubMed
                  44. Broering R, Zhang X, Kottilil S, Trippler M, Jiang M, Lu M, Gerken G, Schlaak JF: The interferon stimulated gene 15 functions as a proviral factor for the hepatitis C virus and as a regulator of the IFN response. Gut 2010, 59:1111–1119.PubMedView Article
                  45. Tan J, Qiao W, Wang J, Xu F, Li Y, Zhou J, Chen Q, Geng Y: IFP35 is involved in the antiviral function of interferon by association with the viral tas transactivator of bovine foamy virus. J Virol 2008, 82:4275–4283.PubMedView Article
                  46. Song WJ, Qin QW, Qiu J, Huang CH, Wang F, Hew CL: Functional genomics analysis of Singapore grouper iridovirus: complete sequence determination and proteomic analysis. J Virol 2004, 78:12576–12590.PubMedView Article
                  47. Lin PW, Huang YJ, John JA, Chang YN, Yuan CH, Chen WY, Yeh CH, Shen ST, Lin FP, Tsui WH, Chang CY: Iridovirus Bcl-2 protein inhibits apoptosis in the early stage of viral infection. Apoptosis 2008, 13:165–176.PubMedView Article
                  48. Huang XH, Huang YH, Gong J, Yan Y, Qin QW: Identification and characterization of a putative lipopolysaccharide-induced TNF-alpha factor (LITAF) homolog from Singapore grouper iridovirus. Biochem Biophys Res Commun 2008, 373:140–145.PubMedView Article
                  49. Viswanathan K, Früh K, DeFilippis V: Viral hijacking of the host ubiquitin system to evade interferon responses. Curr Opin Microbiol 2010, 13:517–523.PubMedView Article
                  50. Alcami A: Viral mimicry of cytokines, chemokines and their receptors. Nat Rev Immunol 2003, 3:36–50.PubMedView Article
                  51. Ploegh HL: Viral strategies of immune evasion. Science 1998, 280:248–253.PubMedView Article
                  52. Yeh CH, Chen YS, Wu MS, Chen CW, Yuan CH, Pan KW, Chang YN, Chuang NN, Chang CY: Differential display of grouper iridovirus-infected grouper cells by immunostaining. Biochem Biophys Res Commun 2008, 372:674–680.PubMedView Article
                  53. Chen LM, Tran BN, Lin Q, Lim TK, Wang F, Hew CL: iTRAQ analysis of Singapore grouper iridovirus infection in a grouper embryonic cell line. J Gen Virol 2008, 89:2869–2876.PubMedView Article
                  54. Xu D, Wei J, Cui H, Gong J, Yan Y, Lai R, Qin Q: Differential profiles of gene expression in grouper Epinephelus coioides, infected with Singapore grouper iridovirus, revealed by suppression subtractive hybridization and DNA microarray. J Fish Biol 2010, 77:341–360.PubMedView Article
                  55. Chou HH, Holmes MH: DNA sequence quality trimming and vector removal. Bioinformatics 2001, 17:1093–1104.PubMedView Article
                  56. Huang X, Madan A: CAP3:A DNA sequence assembly program. Genome Res 1999, 9:868–877.PubMedView Article
                  57. Leu JH, Chang CC, Wu JL, Hsu CW, Hirono I, Aoki T, Juan HF, Lo CF, Kou GH, Huang HC: Comparative analysis of differentially expressed genes in normal and white spot syndrome virus infected Penaeus monodon. BMC Genomics 2007, 8:120.PubMedView Article
                  58. Zhang Z, Wang Y, Wang S, Liu J, Warren W, Mitreva M, Walter RB: Transcriptome analysis of female and male Xiphophorus maculatus Jp 163 A. PLoS One 2011, 6:e18379.PubMedView Article

                  Copyright

                  © Huang et al; licensee BioMed Central Ltd. 2011

                  This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://​creativecommons.​org/​licenses/​by/​2.​0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

                  Advertisement