Skip to main content

Table 3 Putative glycosyltransferase genes of H.somni strains

From: Horizontal gene transfer in Histophilus somni and its role in the evolution of pathogenic strain 2336, as determined by comparative genomic analyses

Strain 2336 locus tag, protein,1(SSR, if present)n

Strain 129Pt locus tag, protein,1(SSR, if present)n

SWISS-PROT accession number

Closest Pasteurellaceae homolog Bacterium, locus tag, protein size,2identity

Closest GT homolog (Outside Pasteurellaceae) locus tag, protein,2identity

[GenBank:HSM_0148], 260 aa, (G)9

[GenBank:HS_0275], 259 aa, (G)6

[Swiss-Prot:B0UVK9/Q0I1L8]

None

Acinetobacter johnsonii, [GenBank:EEY94992], 281 aa, 44%

[GenBank:HSM_0164], 522 aa, (G)9

None

[Swiss-Prot:B0UVM5]

Actinobacillus succinogenes, [GenBank:Asuc_0521], 522 aa, 63

Neisseria mucosa, [GenBank:EFC88975], 517 aa, 53%

3[GenBank:HSM_0398], 346 aa

[GenBank:HS_1612], 346 aa

[Swiss-Prot BOUWU4/Q01570]

Mannheimia, succiniciproducens [GenBank:MS2260], 346 aa, 78%

Yersinia pseudotuberculosis, [GenBank:YPTB0054], 354 aa, 64%

3[GenBank:HSM_0399], 321 aa

[GenBank:HS_1611], 321 aa

[Swiss-Prot B0UWU5/Q0I571]

Mannheimia succiniciproducens

Providencia rettgeri, [GenBank:EFE51471], [GenBank:MS2259], 321 aa, 67% 322 aa, 63%

4[GenBank:HSM_0856], 314 aa

None

[Swiss-Prot:B0UST9]

None

Rhodopirellula baltica, [GenBank:RB9243], 326 aa, 35%

5[GenBank:HSM_0975a], 157 aa, (CAGT)18

5[GenBank:HS_0636], 354 aa, (CAGT)29

[Swiss-Prot:Q0I2Z7]

Haemophilus influenzae, [GenBank:NTHI0365], 312 aa, 38%

Neisseria meningitidis, [GenBank:AF355193_3], 311 aa, 35%

[GenBank:HSM_0975], 231 aa, (AGA)3

None

[Swiss-Prot:B0UT56]

Pasteurella dagmatis, [GenBank:EEX51329], 334 aa, 40%

Neisseria lactamica, [GenBank:AAN08512], 251aa, 32%

6[GenBank:HSM_0976], 63 aa

[GenBank:HS_0636a]

[Swiss-Prot:B0UT57]

Pasteurella multocida, [GenBank:PM1140], 337 aa, 61%

Streptococcus parasanguinis, [GenBank:ACF35266], 297 aa, 59%

7[GenBank:HSM_0977], 277 aa, (GAGA)11

None

[Swiss-Prot:B0UT58]

Aggregatibacter actinomycetemcomitans GenBank:D11S_0429], 282 aa, 43%

Neisseria meningitidis, [GenBank:NMC1901], 275 aa, 41%

8[GenBank:HSM_0978], 271 aa, (GA)20

[GenBank:HS_0637], 158 aa

[Swiss-Prot:B0UT59]

Aggregatibacter actinomycetemcomitans [GenBank:D11S_0429], 282 aa, 43%

Neisseria meningitidis, [GenBank:CAX50883], 280 aa, 39%

9[GenBank:HSM_0979], 293 aa, (CAAT)33

[GenBank:HS_0638], 297 aa, (CAAT)36

[Swiss-Prot:B0UT60/Q0I2Z5]

Actinobacillus succinogenes, [GenBank:Asuc_0526], 265 aa, 52%

Photobacterium profundum, [GenBank:PBPRA0217], 253 aa, 41%

[GenBank:HSM_1426], 300 aa

None

[Swiss-Prot:B0UUE7]

Haemophilus influenzae, [GenBank:HI0871], 306 aa, 42%

Fusobacterium nucleatum, [GenBank:EDK88896], 326 aa, 38%

[GenBank:HSM_1552], 196 aa, (G)9

[GenBank:HS_1067], 194 aa, (G)6

[Swiss-Prot:B0UUS9/Q0I479]

None

Edwardsiella ictaluri, [GenBank:NT01EI_2547], 247 aa, 27%

10[GenBank:HSM_1794], 311 aa

None

[Swiss-Prot:B0UWB1]

Mannheimia haemolytica, [GenBank:MHA_0104], 312 aa, 47%

Streptococcus agalactiae [GenBank:AAR29926], 299 aa, 39%

[GenBank:HSM_2001], 242 aa, (GGT)3

[GenBank:HS_0116], 242 aa, (GGT)3

[Swiss-Prot:B0URS6/Q0I108]

Aggregatibacter aphrophilus, [GenBank:NT05HA_1706], 240 aa, 61%

[GenBank:EER56028], 241 aa, 55%

None

[GenBank:HS_0291], 256 aa

[Swiss-Prot:Q0I1K2]

Mannheimia succiniciproducens [GenBank:MS0438], 253 aa, 76%

Vibrio shilonii [GenBank:EDL53925], 259 aa, 62%

None

[GenBank:HS_0292], 348 aa

[Swiss-Prot:Q0I1K1]

Actinobacillus minor NM305, [GenBank:EER47697], 340 aa, 57%

Vibrio parahaemolyticus, [GenBank:EED27646], 341 aa, 39%

  1. 1Simple sequence repeats identified within the predicted ORF.
  2. 2Identity at the predicted protein level as compared to strain 2336 or strain 129Pt full-length or partial homolog.
  3. 3HSM_0398 and 0399 are predicted to encode lipopolysaccharide heptosyltransferases II and I, respectively.
  4. 4HSM_0856 contains 28 copies of CAGT 67 bp upstream of the predicted start codon.
  5. 5HS_0636 (lob2D), encoding a putative glycosyl transferase [13], is truncated in strain 2336 (HSM_0975a).
  6. 6HSM_0976 (lob2C), encoding a putative glycosyltransferase-like protein, has an 117 bp homolog in strain 129Pt (HS_0636a).
  7. 7HSM_0977 (lob2B) has been predicted to encode an N-acetylglucosamine transferase [5].
  8. 8HSM_0978 (lob2A), encoding a putative glycosyl transferase, had 66% identity to HSM_0977 (lob2B) at the predicted protein level.
  9. 9HSM_0979/HS_0638 (lob1) has been predicted to encode a galactosyl transferase [7].
  10. 10HSM_1794 contains 4 copies of CAAGCCTACAAGCCTACAAGCCTA 262 bp upstream of the predicted start codon.
Back to article page

BMC Genomics

ISSN: 1471-2164

Contact us