AlliumMap-A comparative genomics resource for cultivated Allium vegetables

  • John McCallum1Email author,

    Affiliated with

    • Samantha Baldwin1,

      Affiliated with

      • Masayoshi Shigyo2,

        Affiliated with

        • Yanbo Deng3,

          Affiliated with

          • Sjaak van Heusden4,

            Affiliated with

            • Meeghan Pither-Joyce1 and

              Affiliated with

              • Fernand Kenel1

                Affiliated with

                BMC Genomics201213:168

                DOI: 10.1186/1471-2164-13-168

                Received: 21 September 2011

                Accepted: 4 May 2012

                Published: 4 May 2012

                Abstract

                Background

                Vegetables of the genus Allium are widely consumed but remain poorly understood genetically. Genetic mapping has been conducted in intraspecific crosses of onion (Allium cepa L.), A. fistulosum and interspecific crosses between A. roylei and these two species, but it has not been possible to access genetic maps and underlying data from these studies easily.

                Description

                An online comparative genomics database, AlliumMap, has been developed based on the GMOD CMap tool at http://​alliumgenetics.​org. It has been populated with curated data linking genetic maps with underlying markers and sequence data from multiple studies. It includes data from multiple onion mapping populations as well as the most closely related species A. roylei and A. fistulosum. Further onion EST-derived markers were evaluated in the A. cepa x A. roylei interspecific population, enabling merging of the AFLP-based maps. In addition, data concerning markers assigned in multiple studies to the Allium physical map using A. cepa-A. fistulosum alien monosomic addition lines have been compiled. The compiled data reveal extensive synteny between onion and A. fistulosum.

                Conclusions

                The database provides the first online resource providing genetic map and marker data from multiple Allium species and populations. The additional markers placed on the interspecific Allium map confirm the value of A. roylei as a valuable bridge between the genetics of onion and A. fistulosum and as a means to conduct efficient mapping of expressed sequence markers in Allium. The data presented suggest that comparative approaches will be valuable for genetic and genomic studies of onion and A. fistulosum. This online resource will provide a valuable means to integrate genetic and sequence-based explorations of Allium genomes.

                Background

                The large monocot genus Allium comprises hundreds of species and includes several with great economic, culinary and health value. Onion and shallot (Allium cepa L.; 2n = 2X = 16) are among the most economically significant monocot species outside the commelinoid grasses [1]. A. fistulosum (Japanese Bunching or Welsh Onion; 2n = 2X = 16), leek (A. porrum; (2n = 4X = 32) and garlic (A. sativum; 2n = 2X = 16) are widely grown and traded, with many other species being locally significant as spices and flavorings. Allium species are notable for their very large genomes, typically in the range 10–20 Gbp [2], which have complicated genomic studies and precluded genome sequencing to date. Genetic map development in onion and other Allium has been limited by difficulty in developing, maintaining and exchanging genetic stocks, high degrees of heterozygosity, and a dearth of sequence data [3].

                The first published genetic map of an Allium species was that developed by King and colleagues [4] in the intraspecific onion cross 'BYG15-23 x AC43'. Constructed initially using RFLP markers, this map was subsequently augmented with SNP and SSR markers derived from EST sequencing [5, 6]. These more portable markers enabled partial map construction in other intraspecific onion crosses to enable map-based genetic analysis of fertility restoration [7], color [8] and other bulb traits [9, 10].

                The breeding systems of A. fistulosum have facilitated development of several larger mapping pedigrees and detailed genetic maps based initially on SSR and AFLP markers [11, 12]. These maps were used to conduct QTL analysis for seedling vigor [13]. More recently Tsukazaki and colleagues [14] reported a further A. fistulosum map based on A. fistulosum genomic SSR markers and onion EST-derived SNP and SSR markers, providing further scope for comparative studies between onion and A. fistulosum genomes. The only Allium relative known to readily produce fertile hybrids with onion is A. roylei[15], which has been used to develop an interspecific map [16] and backcross progenies with valuable disease resistance [17, 18]. Since A. roylei also crosses with A. fistulosum, this has enabled development of bridge crosses containing all three genomes [19], thus enabling a potential path for introgression of A. fistulosum genetics into onion.

                The key resource that has enabled alignment of Allium genetic maps to physical chromosomes and facilitated comparison among species is the sets of A. fistulosum A. cepa alien monosomic addition lines (AMALs) developed by Shigyo and colleagues [20]. These were initially applied to anchor AFLP-based maps in the interspecific A. cepa x A. roylei cross [21] and subsequently to anchor the 'BYG15-23 x AC43' map [6]. Subsequently they were used to anchor SSR-based maps in A. fistulosum[12] to physical chromosomes, and more recently to assign many more onion EST-derived anchor markers used in A. fistulosum maps [14].

                In other studies, a large number of phenotypic and molecular markers, including many candidate genes relating to economic traits, have also been assigned to chromosomes [6, 2226], providing a valuable guide for functional and QTL studies. These findings have been reported in diverse publications but have not to date been available in an accessible or integrated manner.

                Genome sequence, map and marker data from Allium species have to date been limited and difficult to access. Marker assays from the 'BYG15-23 x AC43' population have been accessible through Genbank [27] and garlic EST data have been presented through a web database [28]. Recently, Bhasi and colleagues [29] presented RobustDb, a generic online genomics database most notably containing garlic map and marker data. The VegMarks database [30] contains detailed information concerning A. fistulosum markers. Neither of these databases provides comparative data. Increasing development of doubled haploid stocks [31, 32] and availability of next-generation sequencing mean that Allium marker and map resources will expand rapidly in the near future. Therefore it is important to provide existing map and marker data in an accessible form with links to underlying sequence, to enable integration of new data with past studies.

                Comparative genomic approaches have been widely used and proven in crop genetics, and are of growing interest as improved sequencing technologies enable ever broader and more detailed surveys of germplasm [33]. Online databases integrating genetic map, marker, sequence and germplasm data such as Gramene [34] and GDR [35] are now key tools for publishing and exploiting such data from the monocot grasses and the Rosaceae family respectively. Given their economic significance, there is a clear and pressing need for such resources in Allium.

                The use of many common onion EST-derived markers and the extensive use of AMALs to anchor both onion and A. fistulosum maps provide the potential for similar comparative approaches to be used in Allium genetics and genomics. In this study we present an integrated view of genetic maps in onion and A. roylei and an online database in which these can be explored.

                Construction and content

                Interspecific allium map integration

                The interspecific A. cepa x A. roylei interspecific map was augmented with additional genetic markers to increase correspondences among Allium maps. A total of 107 markers comprising 73 additional onion EST-SSRs, 3 A. fistulosum genomic SSRs and 31 SNP markers derived from onion ESTs were evaluated in the population previously used to construct an AFLP-based linkage map [16] using previously published methods [9]. Previously unpublished markers are shown in Table 1. Revised genetic maps were calculated using JoinMap 4.0 software [36]. Linkage groups were first formed using LOD 5 cutoff from two data sets each containing co-dominant markers plus dominant markers from one parental phase. These were then merged and linkage maps constructed using default settings and Kosambi distances.
                Table 1

                Previously unpublished primer sets mapped in the interspecific Allium cepa x A. roylei population

                Primer Set

                Genbank Accession

                FORWARD PRIMER

                REVERSE PRIMER

                ACABE58

                CF447676

                TCTTCGAGAACTATCCCGACAT

                ACTCAACCGCTGTTACAAGGAT

                ACI017

                AY585678

                CCGACTACATGTAAGTTGCATTAAC

                TCTTGCATAATTTCACTGCACA

                ACM005

                BI095610

                CGCTTCAGCAGTGAGTTGTT

                TGTTGTCCGATACAGAGTTGCT

                ACM021

                CF448154

                AAAACCCTCAACATCTCACTCC

                TCTCTTCTTCCTCGTCCTGC

                ACM037

                CF438925

                GACCGACTCCAAAGCCATA

                CTCTCCCGTTCTCAAAATGC

                ACM049

                CF447728

                TAACGACATCCCTACCGC

                GCTTCTTCTTCCACTTTCGG

                ACM050

                CF447828

                GGTTCTCTGTTTGGGACA

                CCGTTTCGGCTACCTTGTAT

                ACM052

                CF441811

                CAGCAGCAACAAAGAATGC

                CTGGGGAGAATGAGAAGCAC

                ACM053

                CF437211

                CTGGGCTCTTTTGTTCATCC

                ATGGTGGAGGTATGTGAGGG

                ACM058

                CF435771

                GGAGTCACACAACAGAAACACAA

                AAGAAGGAATAGAGATGTAGCCGA

                ACM060

                CF435985

                ATCAGCAGCCTTCCCAGTAA

                ATCACACCCGCAAAAGAAT

                ACM065

                CF449328

                GCTCTGATGGAGGATGGTTC

                CTTGCCATCTTTGTCGGT

                ACM072

                CF441584

                TGAATTCAGGCCAAACATGA

                GAGGAAAGCCTGAAGAGTAGCA

                ACM076

                CF449018

                ATTAGAAACATCCATCGCCG

                CGCGATCATCATTTTCCATA

                ACM080

                CF449761

                GCATTATGCAGTAACGGGCT

                GCAGCAGCATTTGATTGAAC

                ACM081

                CF447998

                CTGAAAAGAAACCCGCAGAG

                TCAGGATGCACTTGCTTCAG

                ACM082

                CF436620

                CACCGTTCCTCAGCTCACTT

                AGAGGGACGAAATGAAAGCA

                ACM092

                CF451134

                GTGATTTGAAGCCACCACCT

                TGAATGGTGGTTATTCGGGT

                ACM096

                CF446191

                TGTGGGCAATTCACGTTATG

                AAAAGTTGTGAACGGCATCC

                ACM105

                CF441894

                CAAGTGGAGCGGGTATTTGT

                GAGGCACAACTTCCTCTTCG

                ACM107

                CF449837

                CCTTCATTCCCAAAGCACAT

                GCGATAAAGAGGGACAGCAG

                ACM114

                CF436720

                TAAGTTTTGCCTCCACCACC

                GCTCCACTTCAAGGCTGTTT

                ACM129

                CF442903

                CTAGGTTTCCGTGCTCCAAG

                CAGTTGGAGATCAACAGGCA

                ACM140

                CF442000

                TTGAAGCTATTCTCCGCAGC

                AGGGGGTCATTGATCCTAGC

                ACM144

                CF441789

                GCAACGGTAGAAGAACCTGC

                AACCTCTTTTGGTGCCTCCT

                ACM149

                CF440830

                GAAGATGGGTTTGAGTGGGA

                CAAGCCTGCCCTTACTCTTG

                ACM174

                CF451831

                TGCCCAATTATCGTTTCCAT

                GATGAGGCGAGTTTAGAGCG

                ACM183

                CF443106

                GATGATGGTGATGGCATTGA

                GTTTGCAGGCTCCATTGATT

                ACM231

                CF441488

                AAAGCTTCTACCCTGGCGAT

                TCCCTACGAACTCGTCATCC

                ACM238

                CF443464

                TGATAGCCAGTTGATTGCGA

                TTCCCCAGTACACACCTTCC

                ACM240

                CF444554

                GTGCAACTCCAAGAGAAGGG

                AATATAAAGGCGTTGGCCTG

                ACM245

                CF445289

                GGATCTGATCGGAGATTGGA

                GCGCACCTCTCTGCTAGACT

                ACM255

                CF449065

                AAATTCCCAAAACGAAACCC

                GGGTTTCAGGAACAGTCAGC

                ACM295

                CF445600

                AGATCCGTCCCATGAAACT

                GATCCGCTTCTGAAATCTCG

                ACM304

                DQ273270

                GAATTTAGGCCCATTTCAAGG

                TGATTTGCCTAATGTTTTTACG

                ACM322

                ES449660

                TTCTTCTCCTATCCAGCTATCG

                GTGATTTGGGAGGGGATTTT

                ACM340

                CF437547

                AAGTCTGGTGGTTGGTCCAG

                GGTGCCCAAGAAGTTGGTTA

                ACP002

                AA451591

                AAGCTTCTTTCGATCCTTTGTG

                GCTTCGATTCCATTTCAAGTTC

                ACP003

                BE205590

                AAGCTCTTAAAGCTGCTGATGG

                ATGCACGATAGCACAAGACATC

                ACP034

                BQ580357

                CAGTCTTGTGGTCATTGGTCA

                AACCCATGCGTATTTGAAGG

                ACP052

                CF445805

                TTCCCTCCTCACTCCCTACA

                CGACCACAAACACAAGCAAC

                APSR

                AF212155

                CAGCTGCAGACTTTTCCTAC

                CCACGTGATCGAGTAGATCGT

                GGCS

                AF401621

                CTGGAGTCACACCTGCAGAG

                TCGCCTTCGGAACTGTTATT

                GGT

                AF401622

                TGTTGCTACCGATGATGGTC

                ATGCAACCCTGCAATTTCTC

                SPS3'UTR

                EU164758

                AAAGGGAGATACAGACCAT

                ATTATACATCTCATCATGTCACT

                SUCS

                CF440928

                TTTGAAGTGTGGCCTTACCTTGAG

                TGATGAAGTCTGTTCGATCATGGC

                Database configuration and curation

                Map and marker data provided by authors of previously published linkage mapping studies [4, 8, 12, 14, 16, 37] were compiled in a MySQL relational database and reformatted in a form suitable for import into CMAP [38]. Marker data from the `BYG15-23 x AC43' cross [6] were reformatted in cross-pollinator format for JoinMap 4 and linkage maps were recalculated using default settings. Correspondences between loci with identical names were added using the cmap_admin.pl utility provided in CMap, or manually added based on use of common underlying sequences, as identified through information provided by authors and/or identified in the MySQL database. Further correspondences were identified by cross-checking primer sets against the Onion Gene Index [39] using the primersearch tool from the EMBOSS suite [40] and creating correspondences for any marker pairs amplifying the same sequence. AMAL data were compiled into a Google® spreadsheet and published in searchable form using Simile Widgets http://​www.​simile-widgets.​org[41]. Sequences used for marker design were re-formatted to include marker names in fasta header lines and formatted to provide a BLAST [42] database. Information concerning PCR primer sets used to reveal SNP and SSR markers is provided via custom SQL queries to an external database included in modifications to the distributed CMAP feature information templates. QTL information was compiled from published data and manually added as map features using the CMAP administrator interface, or bulk uploads with the cmap_admin.pl tool.

                Utility

                The resources provided at http://​alliumgenetics.​org may be browsed through direct links to maps organized by species and publication, or through the standard CMAP interface. Markers or any other features may be searched using the built-in feature search option in CMAP, or through a simple form interface provided to enable searching for details of specific markers or primer sets. A BLAST facility is provided to enable querying any sequences of interest against targets of existing markers.

                The markers assigned using AMALs may be browsed and filtered through a web page and the RDF data source may be used as input for other Web2.0 mashups [43].

                AlliumMap currently contains 1,776 markers from 10 Allium maps and 512 correspondences between markers. Genetic maps may be browsed through a standard CMAP interface, and marker hyperlinks provide access to marker information including links to GenBank sequences and other marker assay details.

                Discussion

                Integration of the interspecific allium map

                The addition of 74 co-dominant markers to the A. cepa x A. roylei interspecific map has enabled integration of male and female maps previously constructed primarily with dominant AFLP markers. The map comprises 11 linkage groups spanning 1 Morgan (Figure 1) compared with a length of 660 cM (Kosambi) reported observed for the original AFLP-based map [16]. This is the expected map length for onion based on chiasma frequency [44] and suggests that this map spans most of the genome. The combination of anchor loci assigned using AMALs and mapped in the interspecific cross has provided many additional landmarks for aligning genetic linkage maps in A. cepa and A. fistulosum. Alignment of linkage groups in this cross with the 'BYG15-23 x AC43' onion map [6] reveals useful synteny, as reported previously in studies of onion chromosome 8 [9].
                http://static-content.springer.com/image/art%3A10.1186%2F1471-2164-13-168/MediaObjects/12864_2011_4087_Fig1_HTML.jpg
                Figure 1

                Isozyme and PCR-based marker anchor loci on integrated A. cepa ‘Jumbo’ x A. roylei interspecific map. Numerals at top denote chromosome number based on AMAL assignments. Scale denotes distance in Haldane units (cM). AFLP markers are omitted for clarity.

                Approximately 30 % of onion EST-derived PCR-based markers do not amplify in A. roylei, but may nevertheless be mapped as dominant markers in the A. cepa x A. roylei cross. This high degree of polymorphism means that this cross is extremely useful for developing detailed genetic maps. Development of additional crosses of this type for mapping with new SNP and other marker resources developed with next-generation sequencing in onion would be desirable to provide highly informative stocks for researchers mapping new genes of interest.

                Consensus maps in allium

                The present database contains 512 correspondences between markers on different Allium maps. Map comparison reveals useful degrees of expressed marker portability and suggests considerable potential for comparative methods to resolve common questions of crop evolution, biological function and economic trait regulation across these major cultivated Allium species. A comparative view of Allium chromosome 2 is shown in Figure 2. The Ms locus conditioning restoration of male-fertility in S cytoplasm is the basis for most F1 hybrid production in onion, and has been mapped to this chromosome [7], and we observed association of markers in this region with seed yield from selfed F2, due to segregation at Ms, plants (McCallum et al., unpublished observations) in the 'W202A x Texas Grano 438' family used to map bulb composition QTL [9, 10]. QTL have been reported in an adjacent chromosomal region for onion bulb composition [45] and A. fistulosum seedling vigor [13]. This comparative view allows ready comparison between the QTL locations and linked markers from these studies and provides potential markers for more detailed studies of these regions in these or other genetic backgrounds. Comparison of the onion and interspecific maps for this linkage group illustrates the typically good agreement between marker order and map length in these maps. The relatively small population sizes used to date in these studies do not yet allow conclusive identification of inversions or other major rearrangements in Allium maps.
                http://static-content.springer.com/image/art%3A10.1186%2F1471-2164-13-168/MediaObjects/12864_2011_4087_Fig2_HTML.jpg
                Figure 2

                AlliumMap comparative view of Allium chromosome 2, based on genetic maps from onion [6],[8],[10] and A. fistulosum[12].

                Conclusions

                Previous comparative studies have shown no microsynteny of asparagus with rice or onion [46], suggesting that comparative genomic studies must focus within the genus Allium. AlliumMap provides an integrated point to access details of the genetic markers and sequence resources employed across multiple studies in cultivated Allium. New denser linkage maps and underlying marker resources currently under development using next-generation transcriptome sequencing will be deposited in AlliumMap in the near future and ongoing curation will ensure integration with past studies. Despite the rapid advances in sequencing technologies, the enormous size of Allium nuclear genomes will preclude full sequencing in the short term. However, reduced representation approaches are already practical and the data contained in AlliumMap will be valuable for aligning contigs from such studies with genetic and physical maps.

                The resource will enable comparative genomics approaches, particularly for basic studies of plant physiology, metabolism and bioprotection in onion and A. fistulosum. Current transcriptome sequencing initiatives in onion will provide a rapidly expanding resource of anchor loci to expand the correspondences reported in this paper.

                Availability and requirements

                The database and associated tools may be freely accessed at http://​alliumgenetics.​org. Data concerning AMAL assignments can be accessed as an RDF data sources at http://​spreadsheets.​google.​com/​pub?​key=​pUofr7CKURDMvUcU​lAecgPQ&​hl=​en

                Abbreviations

                AFLP: 

                Amplified Fragment Length Polymorphism

                AMAL: 

                Alien monosomic addition line

                EST: 

                Expressed Sequence Tags

                QTL: 

                Quantitative Trait Loci

                RFLP: 

                Restriction fragment length polymorphism

                SNP: 

                Single-nucleotide polymorphism

                SSR: 

                Simple Sequence Repeat.

                Declarations

                Acknowledgements

                AlliumMap development was funded by the New Zealand Foundation for Research Science and Technology contracts C02X0203 and C02X0803. Travel funding to support collaborations was provided by the International Science and Technology (ISAT) Linkages Fund and the Japanese Society for the Promotion of Science. We thank Michael Havey (USDA-ARS) for providing marker data from onion mapping populations, Hikaru Tsukazaki and Tadayuki Wako (NIVTS, NARO, Japan) for providing marker and sequence data from A. fistulosum mapping populations and Akiko Kamoi (House Foods Ltd, Japan) for technical assistance.

                Authors’ Affiliations

                (1)
                The New Zealand Institute for Plant & Food Research Ltd
                (2)
                Department of Biological and Environmental Sciences, Faculty of Agriculture, Yamaguchi University
                (3)
                Applied Computing Group, Faculty of Environment, Society and Design, Lincoln University
                (4)
                Wageningen University and Research Centre

                References

                1. Shigyo M, Kik C: Onion. In Vegetables II, Volume 2 of Handbook of Plant Breeding. Edited by: Prohens J, Nuez F. Springer New York, ; 2008:121–159.
                2. Ricroch A, Yockteng R, Brown S, Nadot S: Evolution of genome size across some cultivated Allium species. Genome 2005,48(3):511–520.PubMedView Article
                3. McCallum J: Onion. In Vegetables, Volume 5 of Genome Mapping and Molecular Breeding in Plants. Edited by: Kole C, Kole C. Springer, Berlin Heidelberg; 2007:331–347.
                4. King J, Bradeen J, Bark O, McCallum J, Havey M: A low-density genetic map of onion reveals a role for tandem duplication in the evolution of an extremely large diploid genome. Theor Appl Genet 1998, 96:52–62.View Article
                5. Kuhl J, Cheung F, Yuan Q, Martin W, Zewdie Y, McCallum J, Catanach A, Rutherford P, Sink K, Jenderek M, et al.: A unique set of 11,008 onion expressed sequence tags reveals expressed sequence and genomic differences between the monocot orders Asparagales and Poales. Plant Cell 2004, 16:114.PubMedView Article
                6. Martin W, McCallum J, Shigyo M, Jakse J, Kuhl J, Yamane N, Pither-Joyce M, Gokce A, Sink K, Town C, et al.: Genetic mapping of expressed sequences in onion and in silico comparisons with rice show scant colinearity. Mol Genet Genom 2005,274(3):197–204.View Article
                7. Gokce A, McCallum J, Sato Y, Havey M: Molecular tagging of the Ms locus in onion. J Am Soc Hortic Sci 2002,127(4):576–582.
                8. Khar A, Jakse J, Havey M: Segregations for Onion-Bulb Colors Reveal that Red is Controlled by at Least Three Loci. J Am Soc Hortic Sci 2008, 133:42–47.
                9. McCallum J, Clarke A, Pither-Joyce M, Shaw M, Butler R, Brash D, Scheffer J, Sims I, van Heusden S, Shigyo M, et al.: Genetic mapping of a major gene affecting onion bulb fructan content. Theor Appl Genet 2006,112(5):958–967.PubMedView Article
                10. McCallum J, Pither-Joyce M, Shaw M, Kenel F, Davis S, Butler R, Scheffer J, Jakse J, Havey M: Genetic mapping of sulfur assimilation genes reveals a QTL for onion bulb pungency. Theor Appl Genet 2007,114(5):815–822.PubMedView Article
                11. Ohara T, Song Y, Tsukazaki H, Wako T, Nunome T, Kojima A: Genetic mapping of AFLP markers in Japanese bunching onion (Allium fistulosum). Euphytica 2005,144(3):255–263.View Article
                12. Tsukazaki H, Yamashita K, Yaguchi S, Masuzaki S, Fukuoka H, Yonemaru J, Kanamori H, Kono I, Hang T, Shigyo M, et al.: Construction of SSR-based chromosome map in bunching onion (Allium fistulosum). Theor Appl Genet 2008,117(8):1213–1223.PubMedView Article
                13. Ohara T, Tsukazaki H, YeonSang S, Wako T, Yamashita K, Kojima A: Mapping of quantitative trait loci controlling seedling growth in bunching onion (Allium fistulosum L.). J Jpn Soc Horticultural Sci 2009,78(4):436–442.View Article
                14. Tsukazaki H, Yamashita K, Yaguchi S, Yamashita K, Hagihara T, Shigyo M, Kojima A, Wako T: Direct determination of the chromosomal location of bunching onion and bulb onion markers using bunching onion-shallot monosomic additions and allotriploid-bunching onion single alien deletions. Theor Appl Genet 2010,122(3):501–510.PubMedView Article
                15. Meer Q, Vries J: An interspecific cross between Allium roylei Stearn and Allium cepa L., and its backcross to A. cepa. Euphytica 1990, 47:29–31.View Article
                16. Van Heusden A, Van Ooijen J, Vrielink-van Ginkel R, Verbeek W, Wietsma W, Kik C: A genetic map of an interspecic cross in Allium based on amplified fragment length polymorphism (AFLP ™) markers. Theor Appl Genet 2000, 100:118–126.View Article
                17. Scholten O, Van Heusden A, Khrustaleva L, Burger-Meijer K, Mank R, Antonise R, Harrewijn J, Van Haecke W, Oost E, Peters R, et al.: The long and winding road leading to the successful introgression of downy mildew resistance into onion. Euphytica 2007,156(3):345–353.View Article
                18. Goldschmied P: Improvement of onion traits: the creation of Botrytis leaf blight resistant and synthetic onion varieties through alternate breeding approaches. PhD thesis. Cornell University, Department of Horticulture, ; 2006.
                19. Khrustaleva L, Kik C: Cytogenetical studies in the bridge cross Allium cepa (A. fistulosum A. roylei). Theor Appl Genet 1998, 96:8–14.View Article
                20. Shigyo M, Tashiro Y, Isshiki S, Miyazaki S: Establishment of a series of alien monosomic addition lines of Japanese bunching onion (Allium fistulosum L.) with extra chromosomes from shallot (A. cepa L. Aggregatum group). Gene Genet Syst 1996,71(6):363–371.View Article
                21. Heusden AV, Shigyo M, Tashiro Y, van Ginkel RV, Kik C: AFLP linkage group assignment to the chromosomes of Allium cepa L. via monosomic addition lines. Theor Appl Genet 2000,100(3):480–486.View Article
                22. Masuzaki S, Shigyo M, Yamauchi N: Complete assignment of structural genes involved in flavonoid biosynthesis influencing bulb color to individual chromosomes of the shallot (Allium cepa L.). Gene Genet Syst 2006,81(4):255–263.View Article
                23. Masuzaki S, Araki N, Yamauchi N, Yamane N, Wako T, Kojima A, Shigyo M: Chromosomal locations of microsatellites in onion. HortSci 2006,41(2):315–318.
                24. Yaguchi S, Yamauchi N, Shigyo M: Single alien chromosome additions from shallot (Allium cepa L. Aggregatum group) increase endogenous polyphenol contents in Japanese bunching onion. J Jpn Soc Horticultural Sci 2009,78(4):431–435.View Article
                25. Yaguchi S, Nakajima T, Sumi T, Yamauchi N, Shigyo M: Profling of nondigestible carbohydrate products in a complete set of alien monosomic addition lines explains genetic controls of its metabolisms in Allium cepa. J Am Soc Hortic Sci 2009,134(5):521–528.
                26. Yaguchi S, McCallum J, Shaw M, Pither-Joyce M, Onodera S, Shiomi N, Yamauchi N, Shigyo M: Biochemical and genetic analysis of carbohydrate accumulation in Allium cepa L. Plant Cell Physiol 2008,49(5):730.PubMedView Article
                27. Havey M: NCBIAlliumcepa Genome: Build 0 version 1. [http://​www.​ncbi.​nlm.​nih.​gov/​mapview/​mapnsearch.​cgi?​taxid=​4679] 2008.
                28. Kim D, Jung T, Nam S, Kwon H, Kim A, Chae S, Choi S, Kim D, Kim R, Park H: GarlicESTdb: an online database and mining tool for garlic EST sequences. BMC Plant Biol 2009, 9:61.PubMedView Article
                29. Bhasi A, Simon P, Senalik D, Kumar B, Manikandan V, Philip P, Senapathy P: RoBuST: An Integrated Resource of Genomics Information for Plants in the Root and Bulb Crop Families Apiaceae and Alliaceae. BMC Plant Biol 2010, 10:161.PubMedView Article
                30. VegMarks, a DNA database for vegetables [http://​vegmarks.​nivot.​affrc.​go.​jp/​]
                31. Alan A, Brants A, Cobb E, Goldschmied P, Mutschler M, Earle E: Fecund gynogenic lines from onion (Allium cepa L.) breeding materials. Plant Sci 2004,167(5):1055–1066.View Article
                32. Duangjit J, Bohanec B, Havey MJ: Development Of A Haploid Mapping Family For Onion. In Plant and Animal Genomes XIX Conference, January 15–19, 2011. Town and Country Center, San Diego, CA; 2011.
                33. Paterson A: Comparative Genomics in Crop Plants. Mol Tech Crop Improv 2009, 1:23–61.
                34. Liang C, Jaiswal P, Hebbard C, Avraham S, Buckler E, Casstevens T, Hurwitz B, McCouch S, Ni J, Pujar A, et al.: Gramene: a growing plant comparative genomics resource. Nucleic Acids Res 2008, 36:D947. Database issuePubMedView Article
                35. Jung S, Staton M, Lee T, Blenda A, Svancara R, Abbott A, Main D: GDR (Genome Database for Rosaceae): integrated web-database for Rosaceae genomics and genetics data. Nucleic Acids Res 2007,36(Database issue):D1034-D1040.PubMedView Article
                36. Van Ooijen J: JoinMap 4.0, Software for the calculation of genetic linkage maps in experimental populations. In . Edited by: Kyazma BV. Wageningen, Netherlands; 2006.
                37. Zewdie Y, Havey M, Prince J, Jenderek M: The first genetic linkages among expressed regions of the garlic genome. J Am Soc Hortic Sci 2005,130(4):569.
                38. Youens-Clark K, Faga B, Yap I, Stein L, Ware D: CMap 1.01: a comparative mapping application for the Internet. Bioinformatics 2009,25(22):3040.PubMedView Article
                39. Onion Gene Index Release 2.0 [http://​compbio.​dfci.​harvard.​edu/​tgi/​cgi-bin/​tgi/​gimain.​pl?​gudb=​onion]
                40. Rice P, Longden I, Bleasby A, et al.: EMBOSS: the European molecular biology open software suite. Trends Genet 2000,16(6):276–277.PubMedView Article
                41. Huynh D, Karger D, Miller R: Exhibit: lightweight structured data publishing. In Proceedings of the 16th international conference on World Wide Web. ACM; 2007:737–746.View Article
                42. Altschul S, Gish W, Miller W, Myers E, Lipman D: Basic local alignment search tool. J Mol Biol 1990,215(3):403–410.PubMed
                43. Belleau F, Nolin M, Tourigny N, Rigault P, Morissette J: Bio2RDF: Towards a mashup to build bioinformatics knowledge systems. J Biomed Informat 2008,41(5):706–716.View Article
                44. Labani R, Elkington T: Nuclear DNA variation in the genus Allium L.(Liliaceae). Heredity 1987, 59:119–128.View Article
                45. Galmarini C, Goldman I, Havey M: Genetic analyses of correlated solids, flavor, and health-enhancing traits in onion (Allium cepa L.). Mol Genet Genom 2001,265(3):543–551.View Article
                46. Jakse J, Telgmann A, Jung C, Khar A, Melgar S, Cheung F, Town C, Havey M: Comparative sequence and genetic analyses of asparagus BACs reveal no microsynteny with onion or rice. Theor Appl Genet 2006, 114:31–39.PubMedView Article

                Copyright

                © McCallum et al; licensee BioMed Central Ltd. 2012