Open Access

Visualizing spatiotemporal dynamics of apoptosis after G1 arrest by human T cell leukemia virus type 1 Tax and insights into gene expression changes using microarray-based gene expression analysis

BMC Genomics201213:275

DOI: 10.1186/1471-2164-13-275

Received: 6 March 2012

Accepted: 7 June 2012

Published: 22 June 2012

Abstract

Background

Human T cell leukemia virus type 1 (HTLV-1) Tax is a potent activator of viral and cellular gene expression that interacts with a number of cellular proteins. Many reports show that Tax is capable of regulating cell cycle progression and apoptosis both positively and negatively. However, it still remains to understand why the Tax oncoprotein induces cell cycle arrest and apoptosis, or whether Tax-induced apoptosis is dependent upon its ability to induce G1 arrest. The present study used time-lapse imaging to explore the spatiotemporal patterns of cell cycle dynamics in Tax-expressing HeLa cells containing the fluorescent ubiquitination-based cell cycle indicator, Fucci2. A large-scale host cell gene profiling approach was also used to identify the genes involved in Tax-mediated cell signaling events related to cellular proliferation and apoptosis.

Results

Tax-expressing apoptotic cells showed a rounded morphology and detached from the culture dish after cell cycle arrest at the G1 phase. Thus, it appears that Tax induces apoptosis through pathways identical to those involved in G1 arrest. To elucidate the mechanism(s) by which Tax induces cell cycle arrest and apoptosis, regulation of host cellular genes by Tax was analyzed using a microarray containing approximately 18,400 human mRNA transcripts. Seventeen genes related to cell cycle regulation were identified as being up or downregulated > 2.0-fold in Tax-expressing cells. Several genes, including SMAD3, JUN, GADD45B, DUSP1 and IL8, were involved in cellular proliferation, responses to cellular stress and DNA damage, or inflammation and immune responses. Additionally, 23 pro- and anti-apoptotic genes were deregulated by Tax, including TNFAIP3, TNFRS9, BIRC3 and IL6. Furthermore, the kinetics of IL8, SMAD3, CDKN1A, GADD45A, GADD45B and IL6 expression were altered following the induction of Tax, and correlated closely with the morphological changes observed by time-lapse imaging.

Conclusions

Taken together, the results of this study permit a greater understanding of the biological events affected by HTLV-1 Tax, particularly the regulation of cellular proliferation and apoptosis. Importantly, this study is the first to demonstrate the dynamics of morphological changes during Tax-induced apoptosis after cell cycle arrest at the G1 phase.

Background

Human T cell leukemia virus type 1 (HTLV-1) causes adult T cell leukemia (ATL), a severe and fatal lymphoproliferative disease of helper T cells [1], and a separate neurodegenerative disease called tropical spastic paraparesis/HTLV-1-associated myelopathy (TSP/HAM) [2]. HTLV-1 encodes a 40 kDa regulatory protein, Tax, which is necessary and sufficient for cellular transformation and is, therefore, considered to be the viral oncoprotein. Tax is a potent activator of both viral and cellular gene expression, and the oncogenic potential of Tax is thought to depend on its ability to alter the expression of cellular genes involved in cell growth and proliferation, and its direct interactions with cell cycle regulators [3, 4]. Tax-mediated transcriptional activation of cellular gene expression requires direct contact with components of the cyclic AMP-response element binding protein (CREB), nuclear factor-κB (NF-κB), and the serum response factor (SRF) signaling pathways [5]. Moreover, Tax is thought to be involved in other cellular processes including DNA repair, cell cycle progression, and apoptosis [6, 7].

Tax stimulates cell growth via cell cycle dysregulation [3, 4, 7]. A major mitogenic activity of Tax is stimulation of the G1-to-S-phase transition [812], and several different mechanisms have been proposed to explain the dysregulation of the G1 phase and the accelerated progression into S phase. In mammalian cells, G1 progression is controlled by the sequential activation of the cyclin-dependent kinases (Cdks) Cdk4, Cdk6, and Cdk2. Activation of these Cdks by Tax leads to hyperphosphorylation of Retinoblastoma (Rb) and the liberation of E2F, which is essential for cell cycle progression [12, 13]. Tax interacts with cyclins D1, D2, and D3, but not with Cdk1 or Cdk2 [11, 1416]. By binding to cyclins, Tax stabilizes the cyclin D/Cdk complex, thereby enhancing its kinase activity and leading to the hyperphosphorylation of Rb. Moreover, Tax activates the transcription of cyclin D1 and D2 [17, 18] by deregulating the NF-κB pathway [18, 19]. By contrast, there is evidence that Tax induces cell cycle arrest at the G1 phase [20]. HTLV-1 infection and Tax expression in human cells have been observed to induce cell cycle arrest at the G1 phase by inducing p27/kip1 and p21/waf1 [20], and the sharp rise in p27 induced by Tax is often associated with premature activation of the anaphase-promoting complex (APC) [21]. Indeed, cells infected with HTLV-1 expressing wild-type Tax arrest at the G1/S boundary when subjected to cellular stress [22, 23].

Interestingly, Tax induces apoptosis in a variety of systems [2426], consistent with its ability to inhibit DNA repair. Indeed, HTLV-1-infected cells undergo increased apoptosis upon cellular stress [2228]; however, other reports show that Tax inhibits apoptosis [2931], supporting its role as a transforming protein and an inducer of T cell proliferation. Therefore, it seems likely that Tax is capable of stimulating both pro- and anti-apoptotic pathways.

Tax regulates cell cycle progression and apoptosis both positively and negatively; however, the molecular mechanism(s) underlying the regulation of these processes by Tax remain obscure. In this study, we examined the regulation of cell cycle progression and apoptosis by Tax and demonstrated the following: (i) a high level of transient Tax expression arrests the cell cycle at the G1 phase and induces apoptosis in HeLa cells; (ii) based on a microarray containing approximately 18,400 human mRNA transcripts, genes related to cell cycle progression and apoptosis were deregulated by Tax in HeLa cells; (iii) time-lapse imaging of a fluorescent ubiquitination-based cell cycle indicator (Fucci2) in HeLa cells allows for dual-color imaging and can be used to distinguish between live cells in the G1 and S/G2/M phases. Using this system for the in vivo analysis of the spatial and temporal patterns of cell cycle dynamics [32, 33], we demonstrated that Tax-expressing cells arrest in the G1 phase of the cell cycle and proceeded to apoptosis; and (iv) we found that Tax-induced changes in the expression of genes related to cell cycle regulation and apoptosis correlated well with the morphological changes observed in the cells.

Results

Tax induces cell cycle arrest and apoptosis in transfected HeLa cells

To examine whether Tax induces cell cycle arrest at the G1 phase and promotes apoptosis in HeLa cells, chimeric Tax carrying a Flag tag at the carboxyl terminus was transfected into HeLa cells. At 24 h post transfection, the expression of Tax protein was assessed by immunoblot analysis of cell extracts using the monoclonal antibody (MAb) M2, which recognizes the Flag tag (Figure 1A). A single band with an apparent molecular mass consistent with the predicted sequences was observed. As shown in Figure 1B, Tax was detected in both the nucleus and cytoplasm of transfected HeLa cells. This result correlates well with previous studies indicating that Tax is able to shuttle between the nucleus and the cytoplasm but predominantly localizes in the nucleus [34]. As shown in Figure 1C, Tax showed considerable transactivation activity toward the HTLV-1 enhancer, indicating that chimeric Tax with a C-terminal Flag tag was fully functional.
https://static-content.springer.com/image/art%3A10.1186%2F1471-2164-13-275/MediaObjects/12864_2012_Article_4548_Fig1_HTML.jpg
Figure 1

Tax induces G 1 cell cycle arrest and apoptosis. HeLa cells were transiently transfected with a pCAGGS-Tax Flag-tagged vector or the control pCAGGS vector (A, B and E) together with either the reporter plasmid pGV-HL21 (HTLV-1 enhancer) and the reference plasmid pRL-SV40 (C), or the GFP expression vector pEGFP-NI (D and G) or the pSV-β-galactosidase vector (F). (A) At 24 h post-transfection, cells were lysed and subjected to immunoblot analysis with an anti-Flag MAb and an anti-actin MAb (as a control). (B) At 24 h post-transfection, cells were fixed, permeabilized, and immunostained with an anti-Flag MAb followed by an Alexa 488-conjugated anti-mouse IgG antibody. Cells were analyzed by confocal laser scanning microscopy (Olympus FV1000). (C) At 48 h after transfection, cells were recovered and the activities of firefly and Renilla luciferases were measured in lysates. For each sample, the firefly luciferase activity (pGV-HL21) was normalized by reference to Renilla luciferase activity (pRL-SV40). (D) At 48 h post-transfection, cells were fixed and stained with propidium iodide for the analysis of DNA content. GFP-positive cells were analyzed by flow cytometry using Cell Quest for acquisition and ModFit LT. The peaks of the cells at G1 and G2/M phase are indicated. (E) At 48 h post-transfection, cells were collected, lysed, and analyzed for phosphorylation of Rb by immunoblotting with an anti-Rb MAb using an anti-actin MAb as a control. ppRb, hyperphosphorylated forms of Rb; pRb, hypo- and unphosphorylated forms of Rb. (F) At 48 h post-transfection, cells were collected, lysed, β-galactosidase activity was measured. Caspase-3 activity was measured in the cell lysates with an equal amount of β-galactosidase activity. Each of the columns and its associated error bar represent the mean ± standard deviation (SD) of results from four different experiments. The asterisk (*) represents a p-value of < 0.01. (G) At 48 h post-transfection, cells were stained with PE-Annexin V and 7-AAD to identify apoptotic cells. GFP was used as a reporter to discriminate between transfected and untransfected cells. The percentage of Annexin V-positive and 7-AAD-negative cells relative to GFP-positive cells indicates the level of apoptosis.

Next, the cell cycle distribution of Tax-expressing HeLa cells was analyzed. Cells were stained with propidium iodide (PI) and analyzed by flow cytometry 48 h after co-transfection with the Tax expression vector or the control vector and a green fluorescence protein (GFP) expression vector, pEGFP-N1, which served as a marker plasmid. The histograms show representative data from one of three independent experiments. As shown in Figure 1D, flow cytometry analysis revealed that there was a marked increase in the percentage of cells in the G1 phase in cells transfected with Tax (approximately 92% ± 4.5%) compared with cells transfected with the control vector (approximately 58% ± 4.3%), strongly indicating that G1 cell cycle arrest was induced in Tax-expressing cells (p < 0.001). To confirm this result, total cell extracts were collected 48 h post-transfection and the phosphorylation status of Rb was determined by immunoblotting with an anti-Rb MAb, which detects all forms of Rb. The phosphorylation status of Rb serves as a marker of cells in the G0/G1 phase of the cell cycle, since Rb is progressively phosphorylated throughout the G1 phase and is hyperphosphorylated upon transition into the S phase [35]. As shown in Figure 1E, hyperphosphorylated form (ppRb) migrated more slowly than the hypo- and unphosphorylated forms (pRb). The majority of Rb was hyperphosphorylated (upper major band) in cells transfected with the control vector; however, a decrease in the level of hyperphosphorylated form (ppRb) and an increase in the levels of hypo- and/or unphosphorylated form (pRb) were observed in extracts prepared from Tax-expressing cells. These results confirmed that Tax prevents hyperphosphorylation of Rb and blocks cell cycle progression at the G1 phase.

To analyze whether Tax induced apoptosis, HeLa cells were transfected with a Tax expression vector or a control vector, and the activity of caspase-3, which plays an essential role in apoptosis, was measured. Caspase-3 activity was significantly higher in Tax-expressing cells than in control cells (Figure 1F; p < 0.01). Next, the apoptotic activity of Tax was further quantified using flow cytometry by co-staining transfected cells with phycoerythrin (PE)-Annexin V and 7-amino-actinomycin D (7-AAD) (Figure 1G). A prominent event in early apoptosis is the exposure of phosphatidylserine (PS) on the outer leaflet of the cell membrane. Cell surface-exposed PS is specifically detected by PE-Annexin V, and during the late stages of apoptosis or necrosis, cell membrane integrity is lost, allowing entry of the DNA-binding dye 7-AAD. The population of Annexin V-positive and 7-AAD-negative apoptotic cells was much higher in Tax-expressing cells (19.9%) than in cells transfected with the control vector (3.5%). Because the same trends were observed for caspase-3 activity (Figure 1F) and apoptotic activity (Figure 1G), it was concluded that Tax induces apoptosis in HeLa cells.

Large-scale expression profiling of cellular genes after transfection with tax

To analyze the mechanism(s) underlying the regulation of cell cycle progression and apoptosis by Tax, total RNA was isolated from HeLa cells transfected with Tax or a control vector, and each RNA sample was subjected to microarray analysis (GEO accession number GSE34750). Data sets were analyzed using GeneSpring GX 11.0 software for gene expression, clustering, gene ontology, and significant signaling pathways. Using microarrays containing approximately 18,400 mRNA transcripts, 342 genes were identified (269 upregulated and 73 downregulated) that showed statistically significant levels of differential regulation by Tax (p < 0.05) (Tables 1 and 2).
Table 1

Genes upregulated by Tax (fold change ≥ 2.0, p < 0.05)

Gene symbol

Gene description

Gene ID

Fold change

 

Transcription/Translation/RNA processing

  

FOXF1

forkhead box F1

2294

2.0

NFKB2

nuclear factor of kappa light polypeptide gene enhancer in B-cells 2 (p49/p100)

4791

2.0

NR6A1

nuclear receptor subfamily 6, group A, member 1

2649

2.0

CEBPD

CCAAT/enhancer binding protein (C/EBP), delta

1052

2.1

ETV5

ets variant 5

2119

2.1

FST

follistatin

10468

2.2

KLF6

Kruppel-like factor 6

1316

2.2

CEBPD

CCAAT/enhancer binding protein (C/EBP), delta

1052

2.3

EGR3

early growth response 3

1960

2.3

SAMD4A

sterile alpha motif domain containing 4A

23034

2.3

ELL2

elongation factor, RNA polymerase II, 2

22936

2.4

HIVEP2

human immunodeficiency virus type I enhancer binding protein 2

3097

2.4

MAFB

v-maf musculoaponeurotic fibrosarcoma oncogene homolog B (avian)

9935

2.4

FOSL2

FOS-like antigen 2

2355

2.5

ID2

inhibitor of DNA binding 2, dominant negative helix-loop-helix protein

3398

2.5

KLF2

Kruppel-like factor 2 (lung)

10365

2.5

RELB

v-rel reticuloendotheliosis viral oncogene homolog B

5971

2.5

MAFF

v-maf musculoaponeurotic fibrosarcoma oncogene homolog F (avian)

23764

2.8

LARP6

La ribonucleoprotein domain family, member 6

55323

3.1

REL

v-rel reticuloendotheliosis viral oncogene homolog (avian)

5966

3.1

FOSB

FBJ murine osteosarcoma viral oncogene homolog B

2354

3.2

HES1

hairy and enhancer of split 1 (Drosophila)

3280

3.2

SOD2

superoxide dismutase 2, mitochondrial

6648

3.4

ATF3

activating transcription factor 3

467

3.6

FOSL1

FOS-like antigen 1

8061

4.1

ZFP36

zinc finger protein 36, C3H type, homolog (mouse)

7538

4.2

ZNF331

zinc finger protein 331

55422

4.4

BACH2

BTB and CNC homology 1, basic leucine zipper transcription factor 2

60468

4.4

NFKBIE

nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, epsilon

4794

4.4

EGR1

early growth response 1

1958

6.2

FOS

FBJ murine osteosarcoma viral oncogene homolog

2353

8.4

NR4A2

nuclear receptor subfamily 4, group A, member 2

4929

10.9

 

Signal Transduction

  

EDN2

endothelin 2

1907

2.0

EPHA2

EPH receptor A2

1969

2.1

RIT1

Ras-like without CAAX 1

6016

2.1

SH2D3A

SH2 domain containing 3A

10045

2.1

KLRC1

killer cell lectin-like receptor subfamily C, member 1///killer cell lectin-like receptor subfamily C, member 2

3821

2.2

PSD4

pleckstrin and Sec7 domain containing 4

23550

2.5

ADM

adrenomedullin

133

2.7

GPRC5C

G-protein-coupled receptor, family C, group 5, member C

55890

2.7

BDKRB2

bradykinin receptor B2

624

2.8

GDF15

growth differentiation factor 15

9518

3.0

GPR87

G protein-coupled receptor 87

53836

3.4

RASA4

RAS p21 protein activator 4///RAS p21 protein activator 4 pseudogene

10156

8.8

GEM

GTP binding protein overexpressed in skeletal muscle

2669

14.1

GABBR1

gamma-aminobutyric acid (GABA) B receptor, 1///ubiquitin D

10537

24.5

RRAD

Ras-related associated with diabetes

6236

115.2

 

Inflammatory response/Immune response

  

KLRC1

killer cell lectin-like receptor subfamily C, member 1

3821

2.2

PTGS2

prostaglandin-endoperoxide synthase 2 (prostaglandin G/H synthase and cyclooxygenase)

5743

2.3

CCL22

chemokine (C-C motif) ligand 22

6367

3.0

IL6R

interleukin 6 receptor

3570

3.0

TNIP1

TNFAIP3 interacting protein 1

10318

3.2

EBI3

Epstein-Barr virus induced 3

10148

3.2

IL27RA

interleukin 27 receptor, alpha

9466

3.5

TRIM22

tripartite motif-containing 22

10346

3.8

IL32

interleukin 32

9235

3.8

TNFAIP6

tumor necrosis factor, alpha-induced protein 6

7130

4.0

GBP2

guanylate binding protein 2, interferon-inducible

2634

5.2

GBP2

guanylate binding protein 2, interferon-inducible

2634

5.4

CCL19

chemokine (C-C motif) ligand 19

6363

6.2

CXCL1

chemokine (C-X-C motif) ligand 1 (melanoma growth stimulating activity, alpha)

2919

11.7

CXCL11

chemokine (C-X-C motif) ligand 11

6373

13.1

CXCL3

chemokine (C-X-C motif) ligand 3

2921

19.1

CCL20

chemokine (C-C motif) ligand 20

6364

20.1

PTX3

pentraxin-related gene, rapidly induced by IL-1 beta

5806

81.1

CXCL2

chemokine (C-X-C motif) ligand 2

2920

87.0

 

Apoptosis regulation

  

ZMAT3

zinc finger, matrin type 3

64393

2.0

JMJD6

jumonji domain containing 6

23210

2.0

AEN

apoptosis enhancing nuclease

64782

2.1

ADORA2A

adenosine A2a receptor

135

2.2

CD70

CD70 molecule

970

2.2

FAS

Fas (TNF receptor superfamily, member 6)

355

2.3

BAG3

BCL2-associated athanogene 3

9531

2.4

BIK

BCL2-interacting killer (apoptosis-inducing)

638

2.4

BCL6

B-cell CLL/lymphoma 6

604

2.7

TNFRSF1B

tumor necrosis factor receptor superfamily, member 1B

7133

3.3

ZC3H12A

zinc finger CCCH-type containing 12A

80149

4.1

NFKBIA

nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, alpha

4792

5.2

NR4A1

nuclear receptor subfamily 4, group A, member 1

3164

5.4

IER3

immediate early response 3

8870

5.7

TNFAIP3

tumor necrosis factor, alpha-induced protein 3

7128

6.4

BTG2

BTG family, member 2

7832

7.0

TNFRSF9

tumor necrosis factor receptor superfamily, member 9

3604

8.2

BIRC3

baculoviral IAP repeat-containing 3

330

14.8

IL6

interleukin 6 (interferon, beta 2)

3569

18.0

 

Cell cycle regulation

  

GADD45A

growth arrest and DNA-damage-inducible, alpha

1647

2.2

RGS2

regulator of G-protein signaling 2, 24 kDa

5997

2.2

MAP3K8

mitogen-activated protein kinase kinase kinase 8

1326

2.3

SESN1

sestrin 1

27244

2.6

CDKN1A

cyclin-dependent kinase inhibitor 1A (p21, Cip1)

1026

2.8

CYLD

cylindromatosis (turban tumor syndrome)

1540

2.9

PLK2

polo-like kinase 2 (Drosophila)

10769

3.0

SMAD3

SMAD family member 3

4088

4.4

JUN

jun oncogene

3725

4.6

GADD45B

growth arrest and DNA-damage-inducible, beta

4616

4.8

DUSP1

dual specificity phosphatase 1

1843

8.5

IL8

interleukin 8

3576

41.7

 

Regulation of cell growth/Regulation of cell proliferation

  

ZMAT3

zinc finger, matrin type 3

64393

2.0

CSF1

colony stimulating factor 1 (macrophage)

1435

2.1

FGFR2

fibroblast growth factor receptor 2

2263

2.1

ABTB2

ankyrin repeat and BTB (POZ) domain containing 2

25841

2.4

SOCS2

suppressor of cytokine signaling 2

8835

2.4

PGF

placental growth factor

5228

2.6

HBEGF

heparin-binding EGF-like growth factor

1839

2.7

LIF

leukemia inhibitory factor (cholinergic differentiation factor)

3976

2.9

FGF18

fibroblast growth factor 18

8817

4.9

CCL2

chemokine (C-C motif) ligand 2

6347

6.7

IL11

interleukin 11

3589

7.4

RARRES1

retinoic acid receptor responder (tazarotene induced) 1

5918

7.5

IGFBP1

insulin-like growth factor binding protein 1

3484

32.2

DLGAP4

discs, large (Drosophila) homolog-associated protein 4

22839

2.5

EFNA1

ephrin-A1

1942

2.5

WNT4

wingless-type MMTV integration site family, member 4

54361

9.3

 

Cell adhesion

  

LYPD3

LY6/PLAUR domain containing 3

27076

2.0

PDZD2

PDZ domain containing 2

23037

2.1

FERMT2

fermitin family homolog 2 (Drosophila)

10979

2.2

NINJ1

ninjurin 1

4814

2.2

SIRPA

signal-regulatory protein alpha

140885

2.2

COL7A1

collagen, type VII, alpha 1

1294

2.3

LAMB3

laminin, beta 3

3914

2.6

CDH5

cadherin 5, type 2 (vascular endothelium)

1003

4.4

CTGF

connective tissue growth factor

1490

4.4

SAA1

serum amyloid A1///serum amyloid A2

6288

10.3

ICAM1

intercellular adhesion molecule 1

3383

10.8

 

Transport

  

SLC37A1

solute carrier family 37 (glycerol-3-phosphate transporter), member 1

54020

2.0

SLC1A3

solute carrier family 1 (glial high affinity glutamate transporter), member 3

6507

2.2

C19orf28

chromosome 19 open reading frame 28

126321

2.6

NPTX1

neuronal pentraxin I

4884

2.6

SLC2A6

solute carrier family 2 (facilitated glucose transporter), member 6

11182

3.5

HBA1

hemoglobin, alpha 1

3039

5.4

 

Metabolic process

  

HMGCS1

3-hydroxy-3-methylglutaryl-Coenzyme A synthase 1 (soluble)

3157

2.0

PTGS1

prostaglandin-endoperoxide synthase 1 (prostaglandin G/H synthase and cyclooxygenase)

5742

2.0

IDS

iduronate 2-sulfatase

3423

2.2

PI4K2A

phosphatidylinositol 4-kinase type 2 alpha

55361

2.2

PLA2G4C

phospholipase A2, group IVC (cytosolic, calcium-independent)

8605

2.2

C12orf5

chromosome 12 open reading frame 5

57103

2.3

PANX1

pannexin 1

24145

2.3

ABCA1

ATP-binding cassette, subfamily A (ABC1), member 1

19

2.4

AMPD3

adenosine monophosphate deaminase (isoform E)

272

2.4

SAT1

spermidine/spermine N1-acetyltransferase 1

6303

2.5

AKR1B1

aldo-keto reductase family 1, member B1 (aldose reductase)

231

2.6

GCNT3

glucosaminyl (N-acetyl) transferase 3, mucin type

9245

2.6

PITPNM1

phosphatidylinositol transfer protein, membrane-associated 1

9600

2.6

MICAL2

microtubule-associated monoxygenase, calponin and LIM domain containing 2

9645

3.2

PPAP2B

phosphatidic acid phosphatase type 2B

8613

3.2

ARG2

arginase, type II

384

4.1

PTGES

prostaglandin E synthase

9536

4.7

GFPT2

glutamine-fructose-6-phosphate transaminase 2

9945

5.0

 

Phosphorylation/Dephosphorylation

  

DUSP6

dual specificity phosphatase 6

1848

2.0

FAM129A

family with sequence similarity 129, member A

116496

2.3

DUSP13

dual specificity phosphatase 13

51207

2.6

DUSP5

dual specificity phosphatase 5

1847

4.1

PTPRE

protein tyrosine phosphatase, receptor type, E

5791

4.1

 

Response to stress

  

HSPA2

heat shock 70 kDa protein 2

3306

2.3

HSPA1A

heat shock 70 kDa protein 1A

3303

2.9

HSPB8

heat shock 22 kDa protein 8

26353

3.1

HSPB3

heat shock 27 kDa protein 3

8988

4.0

HSPB7

heat shock 27 kDa protein family, member 7 (cardiovascular)

27129

4.0

DNAJB1

DnaJ (Hsp40) homolog, subfamily B, member 1

3337

4.2

HSPA6

heat shock 70 kDa protein 6

3310

7.6

 

Ubiquitin

  

ENC1

ectodermal-neural cortex (with BTB-like domain)

8507

2.3

MAP1LC3C

microtubule-associated protein 1 light chain 3 gamma

440738

3.4

 

Others/Unknown

  

OLR1

oxidized low density lipoprotein (lectin-like) receptor 1

4973

2.0

TRIB1

tribbles homolog 1 (Drosophila)

10221

2.0

UNC13A

unc-13 homolog A (C. elegans)

23025

2.0

SNAI1

snail homolog 1 (Drosophila)

6615

2.1

FSTL3

follistatin-like 3 (secreted glycoprotein)

10272

2.2

GAB2

GRB2-associated binding protein 2

9846

2.2

PDLIM3

PDZ and LIM domain 3

27295

2.2

PMEPA1

prostate transmembrane protein, androgen induced 1

56937

2.2

SLC1A3

solute carrier family 1 (glial high affinity glutamate transporter), member 3

6507

2.2

FNDC3B

fibronectin type III domain containing 3B

64778

2.3

PHLDA3

pleckstrin homology-like domain, family A, member 3

23612

2.3

SLC25A4

solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator), member 4

291

2.3

TPM4

tropomyosin 4

7171

2.3

DSE

dermatan sulfate epimerase

29940

2.5

VEGFC

vascular endothelial growth factor C

7424

2.5

CSTA

cystatin A (stefin A)

1475

2.6

ZDHHC18

zinc finger, DHHC-type containing 18

84243

2.6

CDK2AP2

cyclin-dependent kinase 2 associated protein 2

10263

2.7

TIPARP

TCDD-inducible poly(ADP-ribose) polymerase

25976

2.7

CSTA

cystatin A (stefin A)

1475

2.8

TNFAIP2

tumor necrosis factor, alpha-induced protein 2

7127

2.8

PSD4

pleckstrin and Sec7 domain containing 4

23550

3.1

KRT17

keratin 17

3872

3.7

ARC

activity-regulated cytoskeleton-associated protein

23237

5.4

LXN

latexin

56925

5.5

TRIM31

tripartite motif-containing 31

11074

20.1

Table 2

Genes downregulated by Tax (fold change ≥ 2.0, p < 0.05)

Gene symbol

Gene description

Gene ID

Fold change

 

Transcription/Translation/RNA processing

  

ANP32A

Cerebellar leucine rich acidic nuclear protein (LANP)

8125

2.0

EID1

EP300 interacting inhibitor of differentiation 1

23741

2.0

PAIP1

poly(A) binding protein interacting protein 1

10605

2.0

RBM4

RNA binding motif protein 4

5936

2.0

SFRS7

splicing factor, arginine/serine-rich 7, 35 kDa

6432

2.0

SR140

U2-associated SR140 protein

23350

2.0

BCLAF1

BCL2-associated transcription factor 1

9774

2.1

IMPACT

Impact homolog (mouse)

55364

2.3

LSM5

LSM5 homolog, U6 small nuclear RNA associated (S. cerevisiae)

23658

2.3

MRPS14

mitochondrial ribosomal protein S14

63931

2.3

SUB1

SUB1 homolog (S. cerevisiae)

10923

2.3

ZNF623

zinc finger protein 623

9831

2.3

BRIP1

BRCA1 interacting protein C-terminal helicase 1

83990

2.4

TTF2

transcription termination factor, RNA polymerase II

8458

2.6

 

Signal transduction

  

PDE1A

phosphodiesterase 1A, calmodulin-dependent

5136

2.0

PDE3A

phosphodiesterase 3A, cGMP-inhibited

5139

2.0

PRKCI

protein kinase C, iota

5584

2.1

SRI

sorcin

6717

2.8

 

Immune response/Response to virus

  

DDX58

DEAD (Asp-Glu-Ala-Asp) box polypeptide 58

23586

2.2

IFI44

interferon-induced protein 44

10561

2.2

DDX60

DEAD (Asp-Glu-Ala-Asp) box polypeptide 60

55601

3.0

IFIT3

interferon-induced protein with tetratricopeptide repeats 3

3437

4.1

IFIT2

interferon-induced protein with tetratricopeptide repeats 2

3433

4.4

IFIT1

interferon-induced protein with tetratricopeptide repeats 1

3434

6.0

OASL

2'-5'-oligoadenylate synthetase-like

8638

6.4

 

Apoptosis

  

CARD10

caspase recruitment domain family, member 10

29775

2.0

BCLAF1

BCL2-associated transcription factor 1

9774

2.1

 

Cell cycle

  

MAD2L1

MAD2 mitotic arrest deficient-like 1 (yeast)

4085

2.0

KIF11

kinesin family member 11

3832

2.1

NF2

neurofibromin 2 (merlin)

4771

2.1

SEP11

septin 11

55752

2.1

CENPF

centromere protein F, 350/400 ka (mitosin)

1063

2.5

 

Regulation of cell proliferation

  

BMP2

bone morphogenetic protein 2

650

2.2

DAB2

disabled homolog 2, mitogen-responsive phosphoprotein (Drosophila)

1601

2.4

FGF2

fibroblast growth factor 2 (basic)

2247

3.4

 

Cell signaling

  

PCSK1

proprotein convertase subtilisin/kexin type 1

5122

4.8

 

Cell adhesion

  

CD24

CD24 molecule

100133941

2.3

PKP2

plakophilin 2

5318

2.3

COL14A1

collagen, type XIV, alpha 1

7373

2.5

 

Nucleosome assembly

  

H2AFV

H2A histone family, member V

94239

2.0

 

Transport

  

CNGB1

cyclic nucleotide gated channel beta 1

1258

2.0

SCNN1A

sodium channel, nonvoltage-gated 1 alpha

6337

2.0

ANO2

anoctamin 2

57101

2.1

CHRNA9

cholinergic receptor, nicotinic, alpha 9

55584

2.2

SORBS1

sorbin and SH3 domain containing 1

10580

2.3

STEAP4

STEAP family member 4

79689

2.3

SRI

sorcin

6717

2.6

 

Metabolic process

  

ACSL4

acyl-CoA synthetase long-chain family member 4

2182

2.0

 

Ubiquitin

  

FBXO3

F-box protein 3

26273

2.0

HERC6

hect domain and RLD 6

55008

2.1

DZIP3

DAZ interacting protein 3, zinc finger

9666

2.3

HERC5

hect domain and RLD 5

51191

4.8

 

Others/Unknown

  

NIP7

nuclear import 7 homolog (S. cerevisiae)

51388

2.0

PPL

periplakin

5493

2.0

ADK

adenosine kinase

132

2.1

DIO2

deiodinase, iodothyronine, type II

1734

2.1

PICALM

phosphatidylinositol binding clathrin assembly protein

8301

2.1

METAP2

methionyl aminopeptidase 2

10988

2.2

HIP1R

huntingtin interacting protein 1 related

9026

2.3

ERAP1

KIAA0525 protein

51752

2.4

DAB2

disabled homolog 2, mitogen-responsive phosphoprotein (Drosophila)

1601

2.5

The upregulated genes (2-fold or greater) were clustered within functional groups involved in transcription/translation/RNA processing, signal transduction, the immune response, apoptosis, cell cycle regulation, and cell growth/proliferation (Table 1). In addition, a number of molecules involved in the immune response were significantly downregulated by Tax (Table 2).

Tax induces the expression of genes related to cell cycle progression and apoptosis

It was hypothesized that changes in gene expression may provide valuable information about the dysregulation of cell cycle progression induced by Tax and about how Tax might affect the genes relevant to this process. As shown in Figure 2A, of 17 genes related to cell cycle progression that were regulated by Tax, five were downregulated and 12 were upregulated (fold change > 2.0; p < 0.05). Genes associated with mitosis (CENPF, SEP11, and NF2), including the mitotic cell cycle checkpoint (MAD2L1) and mitotic centrosome separation (KIF11), were repressed by Tax. By contrast, genes upregulated by Tax were functionally classified as genes related to the cell cycle (GADD45A, RGS2, MAP3K8, SESN1, CDKN1A, CYLD, PLK2, SMAD3, JUN, GADD45B, DUSP1 and IL8). Many of these genes are also involved in other processes, such as the response to stress (GADD45B), the response to DNA damage (GADD45A, SESN1, CDKN1A), MAP kinase activity (GADD45B, MAP3K8, DUSP1), cell proliferation (JUN and IL8), and negative regulation of the cell cycle (CYLD, PLK2 and SMAD3). Genes such as SMAD3, GADD45B, and DUSP1 were also identified as having a role in apoptosis, and IL8 is additionally involved in inflammation and the immune response.
https://static-content.springer.com/image/art%3A10.1186%2F1471-2164-13-275/MediaObjects/12864_2012_Article_4548_Fig2_HTML.jpg
Figure 2

Expression profile of genes involved in cell cycle regulation and apoptosis that were altered following the induction of Tax protein. Heat maps showing the hierarchical clustering of genes involved in cell cycle regulation (A) and apoptosis (C) are shown for Tax-expressing cells. The color scheme indicates the fold change in gene expression, with upregulated genes shown in orange/red and downregulated genes shown in blue (with respect to baseline levels under control conditions (yellow)). qRT-PCR validation of the upregulated genes associated with cell cycle regulation (B) and apoptosis (D). RNA from Tax-expressing cells and control cells was used to validate the microarray data. The bars indicate the fold change in gene expression following Tax expression. Data were normalized to GAPDH mRNA. The results represent the mean of two samples from one experiment

The microarray results for genes related to cell cycle progression were validated by performing real-time quantitative reverse transcription polymerase chain reaction (qRT-PCR) on five upregulated genes (Figure 2B). The results of the qRT-PCR agreed with those obtained by microarray analysis.

Next, Tax-regulated genes related to apoptosis were identified (Figure 2C). The microarray results revealed that 21 pro- or anti-apoptotic genes were regulated by Tax (fold change > 2.0; p < 0.05). Two genes associated with the induction of apoptosis, CARD10 and BCLAF1, were downregulated by Tax. The majority of the genes upregulated by Tax were involved in apoptosis. Furthermore, several of these genes also function in the immune response (ADORA2A, CD70, FAS, BCL6, TNFRSF1B and IL6). Interestingly, several highly upregulated genes, such as IER3, TNFAIP3, BIRC3 and IL6, have both pro- and anti-apoptotic functions. In contrast, the highly upregulated gene, TNFRSF9, is pro-apoptotic only. TNF and TNF receptor family genes were also found to be upregulated by Tax in this study.

To confirm and extend the results of the microarray experiments, expression of the pro-apoptotic and anti-apoptotic genes regulated by Tax was measured by qRT-PCR using specific primers. Genes upregulated in the microarray were also upregulated in qRT-PCR (Figure 2D), although there were small differences in the levels measured by the two methods. For example, the expression levels of BIRC3 and IL6 measured by qRT-PCR were almost twice that measured by microarray analysis, and the expression level of the apoptosis inductor TNFRSF9 was more than three times higher by qRT-PCR than by microarray. Despite these minor differences, overall gene expression levels measured by qRT-PCR were similar to those measured by microarray analysis.

Visualizing the spatiotemporal dynamics of the regulation of cell cycle progression and apoptosis by tax

To clarify whether Tax causes apoptosis independently of its ability to induce G1 arrest, the spatiotemporal patterns of cell cycle regulation in response to Tax expression were monitored in HeLa/Fucci2 cells [33]. This system was chosen because it allows dual-color imaging, in which G1-phase nuclei are labeled orange and S/G2/M-phase nuclei are labeled green. A fluorescent Tax vector was constructed that allows the identification of Tax-expressing HeLa/Fucci2 cells. This vector contained Tax, an internal ribosomal entry site (IRES), cyan fluorescent protein (CFP), and a Flag sequence at the 3’ end of tax. The vector was expressed in HeLa cells, and Tax-expressing cells were stained with an anti-Flag MAb followed by an Alexa Fluor 594 secondary antibody (red). As shown in Figure 3A, all Tax-expressing cells were CFP-positive (blue).
https://static-content.springer.com/image/art%3A10.1186%2F1471-2164-13-275/MediaObjects/12864_2012_Article_4548_Fig3_HTML.jpg
Figure 3

Time-lapse imaging of morphological changes in HeLa/Fucci2 cells after Tax-induced cell cycle arrest at G 1 phase. (A) HeLa cells were transfected with the pCAGGS-Tax-IRES-CFP vector or the control pCAGGS-IRES-CFP vector. At 24 h after transfection, cells were stained with an anti-Flag MAb followed by an Alexa Fluor 594-conjugated secondary MAb and analyzed by confocal laser scanning microscopy (Olympus FV1000). Cells showing red and blue fluorescence express Tax-Flag and CFP, respectively. (B and C) HeLa/Fucci2 cells were transfected with the CAGGS-Tax-IRES-CFP vector or the control pCAGGS-IRES-CFP vector and monitored by time-lapse photography using the Olympus LCV110 Imaging System. One day after transfection, CFP-positive cells were selected and fluorescence and phase images were captured once every 15 min for 2 days. Cells showing orange or green fluorescence are in the G1 or S/G2/M phase of cell cycle, respectively. Apoptotic cells, which show a rounded morphology, are marked by arrows. The populations of CFP-expressing cells at the G1 and S/G2/M phases (D and E, respectively) were quantified using MetaMorph 7.7.4 software

HeLa/Fucci2 cells were plated on a glass coverslip, transiently transfected with Tax-IRES-CFP or the CFP control vector, and then incubated for 24 h. Next, fields containing orange, green, and blue fluorescence were selected and images were acquired using an Olympus LCV110 Imaging System (Figure 3B and 3C). The proliferation of control HeLa/Fucci2 cells was evidenced by the fraction of cells at G1 phase with orange nuclei, the fraction of cells at S/G2/M phase with green nuclei, and the subsequent change in the fluorescence of these cells (Figure 3B upper panel and 3D), which indicated that the cells progressed normally through the cell cycle. At 24 h post-transfection, all HeLa/Fucci2 cells expressing Tax-IRES-CFP, which resulted in blue fluorescence, also had orange nuclei, indicating that they were in G1 phase (Figure 3B, lower panel). During the culture period, HeLa/Fucci2 cells expressing Tax-IRES-CFP did not progress to S/G2/M phase, as evidenced by the presence of orange nuclei and the absence of green nuclei in Tax-expressing cells (Figure 3B). Additionally, a marked decrease was observed in the proportion of Tax-IRES-CFP-expressing cells in S/G2/M phase compared with control cells expressing CFP alone (Figure 3D), indicating that Tax arrests cells at the G1 phase of the cell cycle.

Interestingly, overexpression of Tax appeared to reduce the number of HeLa/Fucci2 cells in culture (Figure 3E). Moreover, apoptosis was assessed by the appearance of rounded cells after an increase in the number of Tax-expressing cells at G1 phase, starting at 36 h post-transfection (Figure 3B and 3C). At 72 h post transfection, there was a notable reduction in the overall number of cells, as well as in the percentage of Tax-expressing cells (Figure 3C and 3E).

Expression kinetics of genes involved in cell cycle regulation and apoptosis that are altered following induction of tax protein

To analyze the correlation between the expression of genes related to cell cycle regulation (IL8, SMAD3, CDKN1A, GADD45A and GADD45B) and apoptosis (IL6) (that are altered following the induction of Tax) with the dynamics of cell cycle and apoptosis (shown in Figure 3), total RNA was prepared at 12, 24, 36 and 48 h after transfection of HeLa cells with Tax or a control vector. Each RNA sample was then subjected to qRT-PCR. As indicated in Figure 4, the expression levels of SMAD3, GADD45A and GADD45B in Tax-transfected cells began to increase from 6 h post-transfection and reached a peak at 24 h, decreasing again by 36 h. In the case of IL8, CDKN1A and IL6 in Tax-expressing cells, the expression levels reached a peak at 24 h, decreased at 36 h, and then increased again at 48 h.
https://static-content.springer.com/image/art%3A10.1186%2F1471-2164-13-275/MediaObjects/12864_2012_Article_4548_Fig4_HTML.jpg
Figure 4

Expression kinetics of genes involved in cell cycle regulation and apoptosis that were altered following induction of Tax. HeLa cells were transiently transfected with a pCAGGS-Tax Flag-tagged vector or the control pCAGGS vector. Total RNA was prepared at 12, 24, 36 and 48 h after transfection and then each RNA sample was subjected to qRT-PCR. The bars indicate the fold change in the gene following Tax expression. Data were normalized to GAPDH mRNA. The results represent the mean ± standard deviation (SD) of three samples from one experiment

The kinetics and results from time-lapse imaging indicate that marked upregulation of IL8, SMAD3, CDKN1A, GADD45A, GADD45B and IL6 at 24 h post-transfection was well correlated with a notable reduction in the number of Tax-expressing cells and an increase of Tax-expressing cells in the G1 phase.

Discussion

This study used large-scale host cell gene profiling with human cDNA microarrays and time-lapse imaging of HeLa/Fucci2 cells to monitor the dynamics of Tax-induced cell death. Three major conclusions can be drawn from the data: (i) Tax induces cell cycle arrest at the G1 phase in HeLa cells as assessed by flow cytometry. This result was confirmed by the accumulation of hypo- and/or unphosphorylated form of Rb in Tax-expressing cells. Moreover, analysis of Annexin V-stained cells and caspase-3 activity clearly demonstrated that Tax promotes apoptosis. Thus, a high level of transiently-expressed Tax can arrest the cell cycle at the G1 phase and induce apoptosis in HeLa cells. (ii) The most interesting aspect of this study was visualizing the morphological dynamics of Tax-induced cell death after cell cycle arrest at the G1 phase. Time-lapse imaging of HeLa/Fucci2 cells showed that Tax-induced apoptosis was dependent on the ability of Tax to induce G1 arrest. (iii) Microarray data revealed that Tax induced gene expression changes in HeLa cells; 17 Tax-dependent genes were found to be related to cell cycle regulation and 23 to apoptosis (> 2.0-fold up- or downregulation). (iv) The kinetics of gene expression identified that Tax-induced changes in the expression of IL8, SMAD3, CDKN1A, GADD45A, GADD45B and IL6 closely correlated with the morphological changes of the cell cycle and apoptosis observed by time-lapse imaging. Since these genes are related not only to cell cycle regulation and apoptosis induction, but also to stress kinase pathways, the present study suggests that Tax may induce apoptosis and cell cycle arrest by activating genes related to stress-response signaling pathways.

Many studies show that the Tax oncoprotein accelerates G1 progression [3, 4, 712] and is capable of stimulating anti-apoptotic signaling pathways [29, 30, 36, 37]. In contrast, the present study showed that Tax arrests cells at G1, thereby inducing apoptosis. Our results consist with previous results obtained using HeLa cells and SupT1 cells [20, 38]. There may be possible explanations for how Tax induces cell cycle arrest and apoptosis. One interesting finding from our microarray analysis was the marked activation of stress kinase pathways induced by Tax. In mammalian cells, two families of stress-responsive MAPKs, c-Jun N-terminal kinase (JNK) and p38, are activated by stimuli such as UV radiation, oxidative stress and translation inhibitors, as well as by inflammatory cytokines, tumor necrosis factor α (TNFα), and transforming growth factor β (TGFβ). These signaling pathways promote apoptosis, cell survival, cell cycle arrest, inflammation and differentiation [39, 40]. Interestingly, microarray analysis revealed that genes such as SMAD3 and SMAD4, which are the principal intracellular effectors of the TGFβ family [41, 42]; GADD45A and GADD45B, which are implicated as stress sensors and activated by TGFβ in a SMAD-dependent manner [4345]; DUSP1, DUSP5, DUSP6 and DUSP13, which are stress-inducible MAP kinase phosphatases [46]; MAP kinase kinase kinase 8 (MAP3K8) [46]; JUN [46], which is the effector transcription factor of the JNK pathway; and IL6, IL8 and FAS, which are inflammatory cytokines, were all upregulated by Tax. These genes, expressed in response to Tax, are mediators of JNK and p38 activity. In addition, we found that the kinetics of altered expression of several genes related to pathways involving stress-responsive MAPKs were closely correlated with the kinetics of the spatial and temporal patterns of cell cycle dynamics analyzed in time-lapse imaging. At 24 h post-transfection with Tax expression vectors, the genes for IL8, SMAD3, CDKN1A, GADD45A, GADD45B and IL6 were significantly upregulated (Figure 4) and the number of Tax-IRES-CFP-expressing cells were in G1 phase and underwent apoptosis started to increase at same timing (Figure 3). Thus, the present results suggest that Tax may induce apoptosis and cell cycle arrest by activating several genes related to stress-response signaling pathways. This is supported by a recent publication showing that Tax, along with the activation of a stress kinase, can induce cell death [31]. Furthermore, the present findings consist with those observed by previous microarray analysis studies of HTLV-1-infected T cells, which demonstrated that HTLV-1 infection upregulated JNK activation kinase 1, GADD45 and the inflammatory cytokine, IL1β, which are involved in MAPK stress-response pathways [23]. Recently, HTLV-1 Tax appeared indirectly to connect to cell cycle proteins such as SMAD3, SMAD4, GADD45A and GADD45B [47].

Our microarray analysis results identified one of the genes upregulated by Tax as CDKN1A, which codes p21CIP1/WAF1, known as Cdk inhibitor 1. Again, this is in agreement with results from other microarray analyses showing that HTLV-1 infection and Tax expression upregulated p21CIP1/WAF1 in HTLV-1-infected T cells [23] and the human Jurkat T-cell line JPX-9, which express Tax under the control of an inducible promoter [48]. Likewise, Tax has previously been shown to dramatically upregulate p21CIP1/WAF1 mRNA transcription and stabilization of p21CIP1/WAF1 in HeLa cells [20, 21]. Interestingly, only minimal p21/WAF1 promoter activity appears to be induced by Tax [23]. It is also known that basal levels of p21CIP1/WAF1 are required to promote TGFβ-mediated cell cycle arrest, whereas a lack of p21CIP1/WAF1 allows the induction of cell proliferation in response to TGFβ [49]. Indeed, the loss of p21CIP1/WAF1 and p27KIP1 from HOS cells apparently allows HTLV-1-and Tax-induced G1 arrest to be bypassed [20]. Therefore, Tax may induce cell cycle arrest and apoptosis in HeLa cells by up-regulating GADD45B, SMAD3 and SMAD4 (which act downstream of TGFβ) in the presence of p21CIP1/WAF1 (which is activated by Tax).

In HTLV-1 infected T cell lines, upregulated p21CIP1/WAF1 may potentially function as an assembly factor for the cyclin D2/cdk4 complex, and the p21/cyclin D2/cdk4 complex may not act as an inhibitory complex but instead may allow the increased phosphorylation of Rb and accelerated progression into S phase [50]. In the present study, Tax-mediated G1 arrest occurred in human papilloma virus type 18 (HPV-18)-transformed HeLa cells, in which the Rb pathway was activated by repression of HPV-18 E7 [51]. Indeed, in cells transfected with the control vector, the majority of Rb was in the hyperphosphorylated form ppRb (Figure 1E). By contrast, an accumulation of hypo- and/or unphosphorylated form pRb was observed in Tax-expressing HeLa cells, which is in contrast to the results of study showing that Tax increased the phosphorylation of Rb family members [19]. Therefore, there is a strong possibility that Tax-activated p21CIP1/WAF1 may function to inhibit the cyclin D2/cdk4 complex, thereby inducing cell cycle arrest.

Our microarray result also shows that Tax upregulated the expression of BCL6 gene encodes a sequences-specific transcriptional repressor by 2.7 fold. This supported by the findings in previous study [52], which described that an interaction of Tax with the POZ domain of BCL6 enhances the repressive activity of BCL6 and increased the levels of apoptosis induced by BCL6 in osteosarcoma cells. The BCL6 POZ domain mediates transcriptional repression by interacting with several corepressors including silencing mediator for retinoid and thyroid receptor and nuclear hormone receptor corepressor, BCL6 corepressor together with many histone deacetylases. BCL6 colocalizes with these corepressors in punctate nuclear structures that have been identified as sites of ongoing DNA replication. Interestingly, BCL6 appeared to recruite Tax into punctate nuclear structures and significantly downregulate both basal and Tax-induced NF-kB and long terminal repeat activation [52]. Thus, the high expression of BCL6 in HTLV infected cells may contribute to the silencing of viral gene expression and to the long clinical latency associated with HTLV infection.

This study allows greater understanding of the biological events affected by HTLV-1 Tax, particularly the regulation of cellular proliferation and apoptosis. Since we found evidence of several similarities, as well as differences, between Tax-expressing HeLa cells and HTLV infection in T cell lines, we believe that the overexpression of Tax will be useful for preliminary studies on the effects of HTLV infection in T cell lines. However, since Zane et al. recently demonstrated that infected CD4+ T cells in vivo are positively selected for cell cycling but not cell death [53], our experimental approaches in HeLa cells may not be reflective of normal physiology of Tax or HTLV-1 in vivo infected cells. Therefore, further detailed studies are required to define the direct and indirect effects of Tax-mediated cellular processes to gain a better understanding of the contribution of Tax to HTLV-1 pathogenesis in vivo.

Conclusion

The present study showed that Tax arrested cells at the G1 phase of the cell cycle, thereby inducing apoptosis. Taken together, the results demonstrate that Tax exerts a significant impact on cellular factors that regulate the cell cycle and the induction of apoptosis. Importantly, to the best of our knowledge, this is the first study to highlight the morphological dynamics of Tax-induced cell death after cell cycle arrest at the G1 phase.

This overview can be extended to Tax-mediated signaling, and further study of the interactions between Tax and cellular factors will provide insights into the mechanisms by which Tax regulates host cell behavior, as well as the mechanisms underlying lymphoma induction and progression induced by HTLV-1.

Methods

Cell lines and transfections

Human cervical HeLa cells and Fucci2-expressing HeLa cells (HeLa/Fucci2) [33] were maintained in Dulbecco’s modified Eagle’s medium (DMEM) (Invitrogen) supplemented with 10% heat-inactivated fetal bovine serum (FBS) and 100 units/ml penicillin/streptomycin (Sigma). Cells were transiently transfected with a Tax expression vector, or a control vector, using Fugene HD (Roche) according to the manufacturer’s instructions.

Plasmid construction

The HTLV-1 tax gene was amplified from the HTLV-1 infectious molecular clone, K30 [54], using the primers HTax-F (5’-3’, AACTCGAG GCCACCATGGCCCATTTCCCAGGGTTTGGAC) and HTax-R (5’-3’, AAGCGGCCGC TCACTTGTCGTCATCGTCTTTGTAGTCGACTTCTGTTTCTCGGAAATGTTTTTCACTGG). The underlined sequences correspond to restriction enzyme sites specific for Xho I and Not I, respectively. A Flag sequence was included at the 3’ end of the tax gene. Full-length tax was then cloned into the Xho I and Not I restriction sites in the pCAGGS mammalian expression vector [55]. To generate the pCAGGS-Tax-IRES-CFP vector and the pCAGGS-IRES-CFP control vector, the IRES was amplified from the pRetroX-IRES-ZsGreen1 vector (Clontech) and CFP was amplified from the pCS2+ vector (Clontech). The IRES and CFP sequences were then inserted into the pCAGGS control vector or a pCAGGS vector containing Flag-tagged Tax. The vector pEGFP-N1 encodes a red-shifted variant of wild-type GFP that was modified for brighter fluorescence [56] and which was used as a reporter to identify transfected cells by flow cytometry. The pSV-β-galactosidase vector (Promega) encoding a bacterial β-galactosidase and pRL-SV40 (Promega) encoding Renilla luciferase were used to normalize the transfection efficiency. pGV-HL21 encodes five tandemly repeated 21 bp enhancers of HTLV-1, each of which contain a CRE motif and pGV(−) and have been previously decribed [57].

RNA extraction

HeLa cells were transiently transfected with Tax or the control vector and incubated for 30 h. RNA from total cell extracts was isolated using the RNeasy Mini Kit (Qiagen) according to the manufacturer's instructions. RNA was quantified using a spectrophotometer and stored at −80°C. For gene chip analysis, the quality of RNA was determined using the Agilent Bioanalyzer (Agilent Technologies).

Microarray analysis

RNA samples were analyzed by microarray using the GeneChip Human Genome U133A 2.0 Array (Affymetrix). Microarray hybridization and fluorescence detection were performed as described in the Affymetrix Gene-Chip Expression Analysis Technical Manual. Microarray data were deposited in NCBI’s Gene Expression Omnibus and assigned GEO Series accession number GSE34750. GeneSpring GX 11.0 software (Agilent Technologies) was used to identify statistically significant differences in gene expression between samples. For multiple measurements to detect significantly upregulated and downregulated genes, the Bonferroni correction was performed by adjusting the significance level (p < 0.05). Fold changes in gene expression, hierarchical clustering, and gene ontology annotations were determined.

qRT-PCR

Total RNA was prepared using the RNeasy Mini Kit (Qiagen) at 12, 24, 36 and 48 h after transfection with Tax or the control vector. RT-PCR was performed using specific primers and OneStep SYBR Green PCR mix (Takara) following the manufacturer’s instructions. The qRT-PCR was performed using a 7500 Fast Real-time PCR System (Applied Biosystems). All data were normalized to GAPDH mRNA.

Immunoblot analysis

Transfected cells were lysed and proteins were separated on 6%, 10%, or 17% SDS-polyacrylamide gels and then transferred to a PVDF membrane (Immobilon-P, Millipore Corp.) using a Trans-blot SD semi-dry transfer cell (Bio-Rad). Following the transfer, the membranes were blocked in 5% non-fat dry milk in PBS containing 0.1% Tween-20 for 1 h and then incubated with a 1:1000 dilution of primary antibody against Flag (M2, Sigma), Rb (c-15, Santa Cruz Biotechnology), or actin (c-11, Santa Cruz Biotechnology) for 1 h. The membranes were then washed and incubated with anti-mouse, anti-rabbit, or anti-goat horseradish peroxidase-conjugated secondary antibodies (Jackson, ImmunoResearch) and developed using the SuperSignal West Pico Chemiluminescent substrate Kit (Pierce).

Immunofluorescence

Cells (1 x 105) were seeded onto 22 mm diameter coverslips in 24-well plates and incubated at 37°C for 24 h before transfection. Cells were transiently transfected with either a Tax expression vector or a control vector using the Fugene HD reagent (Roche). Twenty-four hours later, the cells were washed twice with PBS, fixed in 3.7% formaldehyde, permeabilized using 0.2% Triton X-100, and stained with an anti-Flag MAb (M2, Sigma) followed by an anti-mouse IgG1 antibody conjugated to Alexa Fluor 488 or 494 (Molecular Probes). Subcellular localization was analyzed by confocal laser scanning microscopy (FV1000, Olympus).

Luciferase assay

HeLa cells (1 x 105) were transfected with 1 μg of the reporter plasmid, pGV-HL21 (HTLV-1 enhancer) or pGV(−), 0.3 μg of the reference plasmid, pRL-SV40, and 0.5 μg of the Tax expression vector. At 48 h after transfection, cells were recovered and the activity of firefly and Renilla luciferase was measured in the lysates as previously described [58]. For each sample, firefly luciferase activity (pGV-HL21) was normalized by reference to Renilla luciferase activity (pRL-SV40).

Cell cycle analysis

HeLa cells (4 x 105) were incubated in a 6-well plate at 37°C for 24 h followed by co-transfection for 48 h with 2 μg of the Tax expression vector or the control vector and 0.2 μg of the pEGFP-N1 vector. Cells were collected and washed with PBS without Ca2+ and Mg2+ and then fixed with 1% paraformaldehyde followed by 70% ethanol. After fixation, cells were washed twice with PBS, treated with 200 μg/ml of RNase for 1 h at 37°C, and stained with 50 μg/ml of PI. Fluorescence was analyzed using a FACSCalibur (Becton-Dickinson) flow cytometer and Cell Quest software (Becton-Dickinson). Samples were gated to eliminate cells in which GFP emitted strong fluorescence. The acquired FACS data were analyzed using ModFit LT software (Verity Software House).

Analysis of apoptosis

Flow cytometry was used to detect Annexin V-positive apoptotic cells. Transfected cells were incubated for 48 h and then the cell monolayers were detached with trypsin and ethylendiaminetetraacetic acid (EDTA), washed twice in PBS, and re-suspended in binding buffer (1 x 106 cells/ml). An aliquot of 1 x 105 cells was stained with 7-AAD and Annexin V-PE (BD Biosciences) for 15 min at room temperature according to the manufacturer's instructions and then analyzed on a FACSCalibur flow cytometer (BD Biosciences) with Cell Quest software (BD Biosciences). Cells were considered to be in the early stages of apoptosis if they showed staining for Annexin V-PE but not 7-AAD. The double-positive population was considered to be in the late stages of apoptosis, or already dead.

Caspase-3 activity was measured using a caspase-3/CPP32 fluorometric assay kit, according to the manufacturer's instructions. Briefly, transfected HeLa cells were harvested, washed twice with PBS, and treated with lysis buffer. Cell lysates were centrifuged at 15000 × g for 10 min at 4°C, supernatants were collected, and protein concentrations were determined with the Pierce BCA protein assay kit (Thermo Scientific). For each experimental point, 50 μg of total protein extract was incubated with the substrate for 2 h at 37°C. Caspase activity was quantified spectrophotometrically at a wavelength of 405 nm using a multi-label counter (Model 1420, Wallac Arvo, Perkin Elmer Life Sciences).

Imaging of cultured cells

HeLa/Fucci2 cells were transiently transfected with Tax-IRES-CFP or the control vector and were subjected to long-term, time-lapse imaging using a computer-assisted fluorescence microscope (Olympus, LCV110) equipped with an objective lens (Olympus, UAPO 40×/340 N.A. = 0.90), a halogen lamp, a red LED (620 nm), a CCD camera (Olympus, DP30), differential interference contrast (DIC) optical components, and interference filters. For fluorescence imaging, the halogen lamp was used with three filter cubes for observing mCherry (orange), Venus (green), and CFP (blue) fluorescence. For DIC imaging, the red LED was used with a filter cube containing an analyzer. Image acquisition and analysis were performed using MetaMorph 7.7.4 software (Universal Imaging).

Declarations

Acknowledgments

The authors thank Dr. Eri Takeda for kind help and suggestions; Dr. Shin-nosuke Takeshima for submission of microarray data in the NCBI’s Gene Expression Omnibus and kind help of preparation of manuscript; Mr. Tomoyuki Murakami for help with drawing the figures of the manuscript; Drs. Guangai Xue and Muhammad Atif Zahoor for help with the microarray analysis; and other members of the Viral Infectious Diseases Unit, RIKEN, for their help with the experiments. The authors thank Dr. Atsushi Miyawaki for kindly providing the plasmids (pRSETB-CFP and pCS2+) and HeLa/Fucci2 cells, and Drs. Asako Sakaue-Sawano and Dr. Roger Y. Tsien for kindly providing the HeLa/Fucci2 cells. We would like to thank Mr. Keisuke Fukumoto for help with the microarray analysis; Mr. Tetsuya Tajima for excellent technical assistance with the Imaging; We are grateful to the Support Unit for Bio-material Analysis, RIKEN BSI Research Resources Center for help with sequence and microarray analyses; the RIKEN BSI-Olympus Collaboration Center for help with imaging; and the RIKEN BioResource Center Cell Bank for help with the distribution of HeLa/Fucci2. We thank the NIH AIDS Research and Reference Reagent Program for providing the HTLV-1 infectious molecular clone K-30. This work was supported by a Grant-in-Aid for Scientific Research (A and B) and by a grant from the Program for the Promotion of Basic and Applied Research for Innovations in Bio-oriented Industry.

Authors’ Affiliations

(1)
Viral Infectious Diseases Unit, RIKEN
(2)
Department of Medical Genome Sciences, Graduate School of Frontier Science, Laboratory of Viral Infectious Diseases, The University of Tokyo
(3)
Japan Foundation for AIDS Prevention

References

  1. Poiesz BJ, Ruscetti FW, Gazdar AF, Bunn PA, Minna JD, Gallo RC: Detection and isolation of type C retrovirus particles from fresh and cultured lymphocytes of a patient with cutaneous T-cell lymphoma. Proc Natl Acad Sci USA. 1980, 77 (12): 7415-7419. 10.1073/pnas.77.12.7415.PubMed CentralView ArticlePubMedGoogle Scholar
  2. Gessain A, Barin F, Vernant JC, Gout O, Maurs L, Calender A, de The G: Antibodies to human T-lymphotropic virus type-I in patients with tropical spastic paraparesis. Lancet. 1985, 2 (8452): 407-410.View ArticlePubMedGoogle Scholar
  3. Grassmann R, Aboud M, Jeang KT: Molecular mechanisms of cellular transformation by HTLV-1 Tax. Oncogene. 2005, 24 (39): 5976-5985. 10.1038/sj.onc.1208978.View ArticlePubMedGoogle Scholar
  4. Boxus M, Twizere JC, Legros S, Dewulf JF, Kettmann R, Willems L: The HTLV-1 Tax interactome. Retrovirology. 2008, 5: 76-10.1186/1742-4690-5-76.PubMed CentralView ArticlePubMedGoogle Scholar
  5. Yoshida M: Multiple viral strategies of HTLV-1 for dysregulation of cell growth control. Annu Rev Immunol. 2001, 19: 475-496. 10.1146/annurev.immunol.19.1.475.View ArticlePubMedGoogle Scholar
  6. Jeang KT, Giam CZ, Majone F, Aboud M: Life, death, and tax: role of HTLV-I oncoprotein in genetic instability and cellular transformation. J Biol Chem. 2004, 279 (31): 31991-31994. 10.1074/jbc.R400009200.View ArticlePubMedGoogle Scholar
  7. Marriott SJ, Semmes OJ: Impact of HTLV-I Tax on cell cycle progression and the cellular DNA damage repair response. Oncogene. 2005, 24 (39): 5986-5995. 10.1038/sj.onc.1208976.View ArticlePubMedGoogle Scholar
  8. Lemoine FJ, Marriott SJ: Accelerated G(1) phase progression induced by the human T cell leukemia virus type I (HTLV-I) Tax oncoprotein. J Biol Chem. 2001, 276 (34): 31851-31857. 10.1074/jbc.M105195200.View ArticlePubMedGoogle Scholar
  9. Liang MH, Geisbert T, Yao Y, Hinrichs SH, Giam CZ: Human T-lymphotropic virus type 1 oncoprotein tax promotes S-phase entry but blocks mitosis. J Virol. 2002, 76 (8): 4022-4033. 10.1128/JVI.76.8.4022-4033.2002.PubMed CentralView ArticlePubMedGoogle Scholar
  10. Neuveut C, Jeang KT: Cell cycle dysregulation by HTLV-I: role of the tax oncoprotein. Front Biosci. 2002, 7: d157-163. 10.2741/neuveut.View ArticlePubMedGoogle Scholar
  11. Neuveut C, Low KG, Maldarelli F, Schmitt I, Majone F, Grassmann R, Jeang KT: Human T-cell leukemia virus type 1 Tax and cell cycle progression: role of cyclin D-cdk and p110Rb. Mol Cell Biol. 1998, 18 (6): 3620-3632.PubMed CentralView ArticlePubMedGoogle Scholar
  12. Schmitt I, Rosin O, Rohwer P, Gossen M, Grassmann R: Stimulation of cyclin-dependent kinase activity and G1- to S-phase transition in human lymphocytes by the human T-cell leukemia/lymphotropic virus type 1 Tax protein. J Virol. 1998, 72 (1): 633-640.PubMed CentralPubMedGoogle Scholar
  13. Iwanaga R, Ohtani K, Hayashi T, Nakamura M: Molecular mechanism of cell cycle progression induced by the oncogene product Tax of human T-cell leukemia virus type I. Oncogene. 2001, 20 (17): 2055-2067. 10.1038/sj.onc.1204304.View ArticlePubMedGoogle Scholar
  14. Haller K, Wu Y, Derow E, Schmitt I, Jeang KT, Grassmann R: Physical interaction of human T-cell leukemia virus type 1 Tax with cyclin-dependent kinase 4 stimulates the phosphorylation of retinoblastoma protein. Mol Cell Biol. 2002, 22 (10): 3327-3338. 10.1128/MCB.22.10.3327-3338.2002.PubMed CentralView ArticlePubMedGoogle Scholar
  15. Haller K, Ruckes T, Schmitt I, Saul D, Derow E, Grassmann R: Tax-dependent stimulation of G1 phase-specific cyclin-dependent kinases and increased expression of signal transduction genes characterize HTLV type 1-transformed T cells. AIDS Res Hum Retroviruses. 2000, 16 (16): 1683-1688. 10.1089/08892220050193146.View ArticlePubMedGoogle Scholar
  16. Fraedrich K, Muller B, Grassmann R: The HTLV-1 Tax protein binding domain of cyclin-dependent kinase 4 (CDK4) includes the regulatory PSTAIRE helix. Retrovirology. 2005, 2: 54-10.1186/1742-4690-2-54.PubMed CentralView ArticlePubMedGoogle Scholar
  17. Huang Y, Ohtani K, Iwanaga R, Matsumura Y, Nakamura M: Direct trans-activation of the human cyclin D2 gene by the oncogene product Tax of human T-cell leukemia virus type I. Oncogene. 2001, 20 (9): 1094-1102. 10.1038/sj.onc.1204198.View ArticlePubMedGoogle Scholar
  18. Mori N, Fujii M, Hinz M, Nakayama K, Yamada Y, Ikeda S, Yamasaki Y, Kashanchi F, Tanaka Y, Tomonaga M: Activation of cyclin D1 and D2 promoters by human T-cell leukemia virus type I tax protein is associated with IL-2-independent growth of T cells. Int J Cancer. 2002, 99 (3): 378-385. 10.1002/ijc.10388.View ArticlePubMedGoogle Scholar
  19. Iwanaga R, Ozono E, Fujisawa J, Ikeda MA, Okamura N, Huang Y, Ohtani K: Activation of the cyclin D2 and cdk6 genes through NF-kappaB is critical for cell-cycle progression induced by HTLV-I Tax. Oncogene. 2008, 27 (42): 5635-5642. 10.1038/onc.2008.174.View ArticlePubMedGoogle Scholar
  20. Liu M, Yang L, Zhang L, Liu B, Merling R, Xia Z, Giam CZ: Human T-cell leukemia virus type 1 infection leads to arrest in the G1 phase of the cell cycle. J Virol. 2008, 82 (17): 8442-8455. 10.1128/JVI.00091-08.PubMed CentralView ArticlePubMedGoogle Scholar
  21. Zhang L, Zhi H, Liu M, Kuo YL, Giam CZ: Induction of p21(CIP1/WAF1) expression by human T-lymphotropic virus type 1 Tax requires transcriptional activation and mRNA stabilization. Retrovirology. 2009, 6: 35-10.1186/1742-4690-6-35.PubMed CentralView ArticlePubMedGoogle Scholar
  22. de La Fuente C, Santiago F, Chong SY, Deng L, Mayhood T, Fu P, Stein D, Denny T, Coffman F, Azimi N: Overexpression of p21(waf1) in human T-cell lymphotropic virus type 1-infected cells and its association with cyclin A/cdk2. J Virol. 2000, 74 (16): 7270-7283. 10.1128/JVI.74.16.7270-7283.2000.PubMed CentralView ArticlePubMedGoogle Scholar
  23. de La Fuente C, Deng L, Santiago F, Arce L, Wang L, Kashanchi F: Gene expression array of HTLV type 1-infected T cells: Up-regulation of transcription factors and cell cycle genes. AIDS Res Hum Retroviruses. 2000, 16 (16): 1695-1700. 10.1089/08892220050193164.View ArticlePubMedGoogle Scholar
  24. Chen X, Zachar V, Zdravkovic M, Guo M, Ebbesen P, Liu X: Role of the Fas/Fas ligand pathway in apoptotic cell death induced by the human T cell lymphotropic virus type I Tax transactivator. J Gen Virol. 1997, 78 (Pt 12): 3277-3285.View ArticlePubMedGoogle Scholar
  25. Chlichlia K, Busslinger M, Peter ME, Walczak H, Krammer PH, Schirrmacher V, Khazaie K: ICE-proteases mediate HTLV-I Tax-induced apoptotic T-cell death. Oncogene. 1997, 14 (19): 2265-2272. 10.1038/sj.onc.1201070.View ArticlePubMedGoogle Scholar
  26. Kao SY, Lemoine FJ, Mariott SJ: HTLV-1 Tax protein sensitizes cells to apoptotic cell death induced by DNA damaging agents. Oncogene. 2000, 19 (18): 2240-2248. 10.1038/sj.onc.1203559.View ArticlePubMedGoogle Scholar
  27. Nicot C, Harrod R: Distinct p300-responsive mechanisms promote caspase-dependent apoptosis by human T-cell lymphotropic virus type 1 Tax protein. Mol Cell Biol. 2000, 20 (22): 8580-8589. 10.1128/MCB.20.22.8580-8589.2000.PubMed CentralView ArticlePubMedGoogle Scholar
  28. Hall AP, Irvine J, Blyth K, Cameron ER, Onions DE, Campbell ME: Tumours derived from HTLV-I tax transgenic mice are characterized by enhanced levels of apoptosis and oncogene expression. J Pathol. 1998, 186 (2): 209-214. 10.1002/(SICI)1096-9896(1998100)186:2<209::AID-PATH162>3.0.CO;2-I.View ArticlePubMedGoogle Scholar
  29. Brauweiler A, Garrus JE, Reed JC, Nyborg JK: Repression of bax gene expression by the HTLV-1 Tax protein: implications for suppression of apoptosis in virally infected cells. Virology. 1997, 231 (1): 135-140. 10.1006/viro.1997.8509.View ArticlePubMedGoogle Scholar
  30. Tsukahara T, Kannagi M, Ohashi T, Kato H, Arai M, Nunez G, Iwanaga Y, Yamamoto N, Ohtani K, Nakamura M: Induction of Bcl-x(L) expression by human T-cell leukemia virus type 1 Tax through NF-kappaB in apoptosis-resistant T-cell transfectants with Tax. J Virol. 1999, 73 (10): 7981-7987.PubMed CentralPubMedGoogle Scholar
  31. Kasai T, Jeang KT: Two discrete events, human T-cell leukemia virus type I Tax oncoprotein expression and a separate stress stimulus, are required for induction of apoptosis in T-cells. Retrovirology. 2004, 1: 7-10.1186/1742-4690-1-7.PubMed CentralView ArticlePubMedGoogle Scholar
  32. Sakaue-Sawano A, Kurokawa H, Morimura T, Hanyu A, Hama H, Osawa H, Kashiwagi S, Fukami K, Miyata T, Miyoshi H: Visualizing spatiotemporal dynamics of multicellular cell-cycle progression. Cell. 2008, 132 (3): 487-498. 10.1016/j.cell.2007.12.033.View ArticlePubMedGoogle Scholar
  33. Sakaue-Sawano A, Kobayashi T, Ohtawa K, Miyawaki A: Drug-induced cell cycle modulation leading to cell-cycle arrest, nuclear mis-segregation, or endoreplication. BMC Cell Biol. 2011, 12: 2-10.1186/1471-2121-12-2.PubMed CentralView ArticlePubMedGoogle Scholar
  34. Burton M, Upadhyaya CD, Maier B, Hope TJ, Semmes OJ: Human T-cell leukemia virus type 1 Tax shuttles between functionally discrete subcellular targets. J Virol. 2000, 74 (5): 2351-2364. 10.1128/JVI.74.5.2351-2364.2000.PubMed CentralView ArticlePubMedGoogle Scholar
  35. Harbour JW, Luo RX, Dei Santi A, Postigo AA, Dean DC: Cdk phosphorylation triggers sequential intramolecular interactions that progressively block Rb functions as cells move through G1. Cell. 1999, 98 (6): 859-869. 10.1016/S0092-8674(00)81519-6.View ArticlePubMedGoogle Scholar
  36. de la Fuente C, Wang L, Wang D, Deng L, Wu K, Li H, Stein LD, Denny T, Coffman F, Kehn K: Paradoxical effects of a stress signal on pro- and anti-apoptotic machinery in HTLV-1 Tax expressing cells. Mol Cell Biochem. 2003, 245 (1–2): 99-113.View ArticlePubMedGoogle Scholar
  37. Kawakami A, Nakashima T, Sakai H, Urayama S, Yamasaki S, Hida A, Tsuboi M, Nakamura H, Ida H, Migita K: Inhibition of caspase cascade by HTLV-I tax through induction of NF-kappaB nuclear translocation. Blood. 1999, 94 (11): 3847-3854.PubMedGoogle Scholar
  38. Kuo YL, Giam CZ: Activation of the anaphase promoting complex by HTLV-1 tax leads to senescence. EMBO J. 2006, 25 (8): 1741-1752. 10.1038/sj.emboj.7601054.PubMed CentralView ArticlePubMedGoogle Scholar
  39. Chang HY, Nishitoh H, Yang X, Ichijo H, Baltimore D: Activation of apoptosis signal-regulating kinase 1 (ASK1) by the adapter protein Daxx. Science. 1998, 281 (5384): 1860-1863.View ArticlePubMedGoogle Scholar
  40. Chang L, Karin M: Mammalian MAP kinase signalling cascades. Nature. 2001, 410 (6824): 37-40. 10.1038/35065000.View ArticlePubMedGoogle Scholar
  41. Seoane J, Le HV, Shen L, Anderson SA, Massague J: Integration of Smad and forkhead pathways in the control of neuroepithelial and glioblastoma cell proliferation. Cell. 2004, 117 (2): 211-223.View ArticlePubMedGoogle Scholar
  42. Pardali K, Kowanetz M, Heldin CH, Moustakas A: Smad pathway-specific transcriptional regulation of the cell cycle inhibitor p21(WAF1/Cip1). J Cell Physiol. 2005, 204 (1): 260-272. 10.1002/jcp.20304.View ArticlePubMedGoogle Scholar
  43. Yang Q, Manicone A, Coursen JD, Linke SP, Nagashima M, Forgues M, Wang XW: Identification of a functional domain in a GADD45-mediated G2/M checkpoint. J Biol Chem. 2000, 275 (47): 36892-36898. 10.1074/jbc.M005319200.View ArticlePubMedGoogle Scholar
  44. Jin S, Antinore MJ, Lung FD, Dong X, Zhao H, Fan F, Colchagie AB, Blanck P, Roller PP, Fornace AJ: The GADD45 inhibition of Cdc2 kinase correlates with GADD45-mediated growth suppression. J Biol Chem. 2000, 275 (22): 16602-16608. 10.1074/jbc.M000284200.View ArticlePubMedGoogle Scholar
  45. Smith ML, Chen IT, Zhan Q, Bae I, Chen CY, Gilmer TM, Kastan MB, O'Connor PM, Fornace AJ: Interaction of the p53-regulated protein Gadd45 with proliferating cell nuclear antigen. Science. 1994, 266 (5189): 1376-1380. 10.1126/science.7973727.View ArticlePubMedGoogle Scholar
  46. Glossop JR, Cartmell SH: Effect of fluid flow-induced shear stress on human mesenchymal stem cells: differential gene expression of IL1B and MAP3K8 in MAPK signaling. Gene Expr Patterns. 2009, 9 (5): 381-388. 10.1016/j.gep.2009.01.001.View ArticlePubMedGoogle Scholar
  47. Simonis N, Rual JF, Lemmens I, Boxus M, Hirozane-Kishikawa T, Gatot JS, Dricot A, Hao T, Vertommen D, Legros S: Host-pathogen interactome mapping for HTLV-1 and 2 retroviruses. Retrovirology. 2012, 9 (1): 26-10.1186/1742-4690-9-26.PubMed CentralView ArticlePubMedGoogle Scholar
  48. Ng PW, Iha H, Iwanaga Y, Bittner M, Chen Y, Jiang Y, Gooden G, Trent JM, Meltzer P, Jeang KT: Genome-wide expression changes induced by HTLV-1 Tax: evidence for MLK-3 mixed lineage kinase involvement in Tax-mediated NF-kappaB activation. Oncogene. 2001, 20 (33): 4484-4496. 10.1038/sj.onc.1204513.View ArticlePubMedGoogle Scholar
  49. Seoane J: p21(WAF1/CIP1) at the switch between the anti-oncogenic and oncogenic faces of TGFbeta. Cancer Biol Ther. 2004, 3 (2): 226-227.View ArticlePubMedGoogle Scholar
  50. Kehn K, Deng L, de la Fuente C, Strouss K, Wu K, Maddukuri A, Baylor S, Rufner R, Pumfery A, Bottazzi ME: The role of cyclin D2 and p21/waf1 in human T-cell leukemia virus type 1 infected cells. Retrovirology. 2004, 1: 6-10.1186/1742-4690-1-6.PubMed CentralView ArticlePubMedGoogle Scholar
  51. Helt AM, Galloway DA: Mechanisms by which DNA tumor virus oncoproteins target the Rb family of pocket proteins. Carcinogenesis. 2003, 24 (2): 159-169. 10.1093/carcin/24.2.159.View ArticlePubMedGoogle Scholar
  52. Dean J, Hashimoto K, Tsuji T, Gautier V, Hall WW, Sheehy N: Functional interaction of HTLV-1 tax protein with the POZ domain of the transcriptional repressor BCL6. Oncogene. 2009, 28 (42): 3723-3734. 10.1038/onc.2009.230.View ArticlePubMedGoogle Scholar
  53. Zane L, Sibon D, Jeannin L, Zandecki M, Delfau-Larue MH, Gessain A, Gout O, Pinatel C, Lancon A, Mortreux F: Tax gene expression and cell cycling but not cell death are selected during HTLV-1 infection in vivo. Retrovirology. 2010, 7: 17-10.1186/1742-4690-7-17.PubMed CentralView ArticlePubMedGoogle Scholar
  54. Zhao TM, Robinson MA, Bowers FS, Kindt TJ: Characterization of an infectious molecular clone of human T-cell leukemia virus type I. J Virol. 1995, 69 (4): 2024-2030.PubMed CentralPubMedGoogle Scholar
  55. Niwa H, Yamamura K, Miyazaki J: Efficient selection for high-expression transfectants with a novel eukaryotic vector. Gene. 1991, 108 (2): 193-199. 10.1016/0378-1119(91)90434-D.View ArticlePubMedGoogle Scholar
  56. Cormack BP, Valdivia RH, Falkow S: FACS-optimized mutants of the green fluorescent protein (GFP). Gene. 1996, 173 (1 Spec No): 33-38.View ArticlePubMedGoogle Scholar
  57. Tajima S, Aida Y: The region between amino acids 245 and 265 of the bovine leukemia virus (BLV) tax protein restricts transactivation not only via the BLV enhancer but also via other retrovirus enhancers. J Virol. 2000, 74 (23): 10939-10949. 10.1128/JVI.74.23.10939-10949.2000.PubMed CentralView ArticlePubMedGoogle Scholar
  58. Tajima S, Zhuang WZ, Kato MV, Okada K, Ikawa Y, Aida Y: Function and conformation of wild-type p53 protein are influenced by mutations in bovine leukemia virus-induced B-cell lymphosarcoma. Virology. 1998, 243 (1): 735-746.View ArticlePubMedGoogle Scholar

Copyright

© Arainga et al.; licensee BioMed Central Ltd. 2012

This article is published under license to BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Advertisement