High-throughput novel microsatellite marker of faba bean via next generation sequencing

  • Tao Yang1Email author,

    Affiliated with

    • Shi-ying Bao2Email author,

      Affiliated with

      • Rebecca Ford3,

        Affiliated with

        • Teng-jiao Jia1,

          Affiliated with

          • Jian-ping Guan1,

            Affiliated with

            • Yu-hua He2,

              Affiliated with

              • Xue-lian Sun1,

                Affiliated with

                • Jun-ye Jiang1,

                  Affiliated with

                  • Jun-jie Hao4,

                    Affiliated with

                    • Xiao-yan Zhang4 and

                      Affiliated with

                      • Xu-xiao Zong1Email author

                        Affiliated with

                        BMC Genomics201213:602

                        DOI: 10.1186/1471-2164-13-602

                        Received: 19 July 2012

                        Accepted: 4 November 2012

                        Published: 8 November 2012

                        Abstract

                        Background

                        Faba bean (Vicia faba L.) is an important food legume crop, grown for human consumption globally including in China, Turkey, Egypt and Ethiopia. Although genetic gain has been made through conventional selection and breeding efforts, this could be substantially improved through the application of molecular methods. For this, a set of reliable molecular markers representative of the entire genome is required.

                        Results

                        A library with 125,559 putative SSR sequences was constructed and characterized for repeat type and length from a mixed genome of 247 spring and winter sown faba bean genotypes using 454 sequencing. A suit of 28,503 primer pair sequences were designed and 150 were randomly selected for validation. Of these, 94 produced reproducible amplicons that were polymorphic among 32 faba bean genotypes selected from diverse geographical locations. The number of alleles per locus ranged from 2 to 8, the expected heterozygocities ranged from 0.0000 to 1.0000, and the observed heterozygosities ranged from 0.0908 to 0.8410. The validation by UPGMA cluster analysis of 32 genotypes based on Nei's genetic distance, showed high quality and effectiveness of those novel SSR markers developed via next generation sequencing technology.

                        Conclusions

                        Large scale SSR marker development was successfully achieved using next generation sequencing of the V. faba genome. These novel markers are valuable for constructing genetic linkage maps, future QTL mapping, and marker-assisted trait selection in faba bean breeding efforts.

                        Keywords

                        Microsatellite markers Next generation sequencing Marker development Vicia faba L.

                        Background

                        Faba bean (Vicia faba L.) is an important temperate legume, grown for human consumption and animal feed due to its high protein and fibre content [1, 2]. The crop also replaces available nitrogen in the soil when used in rotation with cereals and oilseeds, and thus is expected to be a highly beneficial component in future temperate Low Carbon Agricultural systems. China is the largest faba bean producer (40.36%) with an average dry grain production (2005–2009) of 1,720,000 metric tonnes (mt) from 945,400 hectares; followed by Ethiopia (476,026 mt), France (331,122 mt), Egypt (274,040 mt) and Australia (196,800 mt) [3].

                        However, faba bean suffers from several major biotic and abiotic factors that constrain productivity. Although significant genetic gain to overcome these has been made through traditional breeding practices [1], progress through the use of genomics and associated biotechnologies is limited. This is due mainly to the large genome size (13GB; [4]), which is approximately 25 times larger than that of the model legume Medicago truncatula, and 2.5 times larger than Pisum sativum[1], together with a lack of financial investment in this crop species.

                        Recent advances in next generation sequencing (NGS) technologies enable the generation of large volumes of sequence efficiently and cost-effectively [5, 6]. This has led to a revolution in biological and agricultural applications including identification of genes correlated with key breeding traits through high-density SNP marker and genome-wide association analysis studies (GWAS) [7, 8]. Another outcome is the ability to accurately identify sequences flanking simple sequence repeat (SSR) regions for use as locus-specific markers for downstream genotyping. Otherwise known as microsatellites, SSRs are tandemly repeated motifs of 1 to 6 nucleotides found in both coding and non-coding regions [9, 10]. These have become a marker of choice in many genotyping applications due to their relatively high abundance, high level of allelic variation, co-dominant inheritance, analytical simplicity and transferability of results across laboratories [11].

                        A limited number of characterized SSR loci (<120) which have been validated over relatively few genetic backgrounds are available for faba bean. Initially, Pozarkova et al. developed primers to 25 SSR loci detected in chromosome 1 DNA libraries [12]. Subsequently, Zeid et al. developed primers to 54 SSR loci [13] and Gong et al. developed 11 EST-SSR loci primers [14]. Most recently, EST sequences within the public domain databases were screened and an additional 21 novel SSR loci were characterized and validated among 32 faba bean accessions [15].

                        Besides providing a cost-effective valuable source for molecular marker generation, the identification of SSR within ESTs is an effective approach for gene discovery and transcript pattern characterization, particularly if through mapping an EST-SSR or EST marker is significantly associated with a QTL [1618]. This may be achieved by searching for SSR associated sequences within EST of a well characterised crop or model plant species. Together with the advantage of in silico analysis, this approach has the potential to substantially broaden the field of comparative studies to species where limited or no sequence information is available.

                        The present study identified high-quality putative SSR loci and flanking primer sequences cheaply and efficiently using the Roche 454 GS FLX Titanium platform. The resultant SSR sequences were characterized and validated through successful amplification of randomly selected target loci across a selection of faba bean genotypes from diverse geographic origin.

                        Methods

                        Plant material

                        A total of 247 faba bean accessions were selected from the National Genebank of China held at the Institute of Crop Science (ICS), Chinese Academy of Agricultural Sciences (CAAS), Beijing. Of these, 100 originated from China, 54 were from other Asian countries, 39 were from Europe, 30 were from Africa, 14 were from the America, 9 breeding lines were sourced from the ICARDA (International Center for Agricultural Research in the Dry Areas) faba bean breeding program and one was from Oceania (Additional file 1: Table S1).

                        DNA isolation, library preparation and 454 sequencing

                        Seven days after seed were left on moist filter paper in the dark at 22°C, sprouts from each of the 247 genotypes were collected. A single sprout of each genotype and of approximately the same weight was pooled and total gDNA was extracted using the CTAB method [19, 20].

                        Genome libraries were constructed using eight biotin labeled probes and a selective hybridization with streptavidin coated bead method [2123]. The probes were: pGA, pAC, pAAT, pAAC, pAAG, pATGT, pGATA and pAAAT. The quality of libraries was inspected by randomly selecting and sequencing 276 clones. The cloning vector was pEASY-T1 (TransGen Biotechnology Co., Ltd), and the primers used for sequencing were F: 5-GTAAAACGACGGCCAGT-3 and R: 5-CAGGAAACAGCTATGAC-3. Libraries were considered to be of high quality if the length of sequences were from 200 to 1000 bp, as evidenced on agarose gel.

                        Subsequently, entire libraries were equally pooled and subjected to 454 sequencing with GS-FLX Titanium reagents at Beijing Autolab Biotechnology Co., Ltd (China). All processing and analyses of the sequencing data was performed with GS-FLX Software v2.0.01 (454 Life Sciences, Roche, Germany). Using a series of normalization, correction and quality-filtering algorithms, the 454 sequencing data were processed to screen and filter for weak signals and low-quality reads, and to trim the read ends for 454 adaptor sequences using the EMBOSS [24] software package. The sequencing data were then submitted to the National Center for Biotechnology Information (NCBI) short read archive and given the accession number SRP006387.

                        SSR loci search and primer design

                        The software MISA (Microsatellite identification) tool (http://​pgrc.​ipk-gatersleben.​de/​misa/​) was configured to locate a minimum of 10 bp: monomers (×10), 2-mers (×6), 3-mers (×5), 4-mers (×5), 5-mers (×5) and 6-mers (×5). This tool allowed the identification and localization of perfect microsatellites as well as compound microsatellites. The maximum size of interruption allowed between two different SSR in a compound sequence was 100 bp. Subsequently, Primer 3.0 (http://​www-genome.​wi.​mit.​edu/​genome_​software/​other/​primer3.​html.) was used to design primer pairs to the flanking sequences of each unique SSR.

                        SSR characterization and validation

                        The number of different types of SSR, length (motif bp × number of motifs) and SSR position was searched and analyzed for using a bespoke program written in MISA files [25] and plotted by OpenOffice.org Calc.

                        Marker assessment

                        Polymerase chain reactions (PCR) were performed in 20 μl reaction volumes containing 0.5 U of Taq DNA polymerase (Zhexing, Beijing, China), 1 × PCR BufferII, 1.5 mM MgCl2, 25 μM of dNTP, 0.4 μM primer, and 50 ng of genomic DNA. Microsatellite loci were amplified on a Heijingang Thermal Cycler (Eastwin, Beijing, China) with the following cycle: 5 min initial denaturation at 95°C; 35 cycles of 30s at 95°C, 30s at the optimized annealing temperature (Table 1), 45s of elongation at 72°C, and a final extension at 72°C for 10min. PCR products were initially assessed for size polymorphism on 6% denaturing polyacrylamide gels and visualized by silver nitrate staining.
                        Table 1

                        Occurrence of microsatellites in the genome survey

                        Category

                        Numbers

                        Total number of sequences examined

                        532,599

                        Total size of examined sequences (bp)

                        162,448,842

                        Total number of identified SSRs

                        250,393

                        Number of SSR containing sequences

                        125,559

                        Number of sequences containing more than one SSR

                        61,266

                        Number of SSRs present in compound formation

                        122,988

                        The genotyping data was subsequently used to determine genetic relationships among 32 V. faba accessions (eleven from China, seven from Asia, five from Europe, five from Africa, three from the Americas and one from Oceania; (Additional file 1: Table S1). The number of alleles (Na), expected (He) heterozygosities and observed (Ho) heterozygosities were calculated using POPGEN1.32 [26]. The cluster analysis of 32 genotypes was carried out based on Nei's unbiased measures of genetic distance [27] by using the unweighted pair-group method with arithmetic average (UPGMA), and the dendrogram was drawn by MEGA4 [28].

                        Results

                        Quality inspection of the DNA library

                        The recombination rate within the constructed SSR-enriched V. faba library was 73.9%. Among the 276 clones sequenced, 31.9% contained SSR sequences within an insert that ranged from 0.2 to 1.0 kb in size.

                        454 sequencing and characterization reads

                        A total of 578,251 reads were generated from the pooled library, and 532,599 read sequences were used for further analysis after adaptor removal. Adenine was the most abundant nucleotide (30%), followed by thymine (27%), guanine (22%) and cytosine (21%). The mean GC content was 43%. The average length of read sequence was 305 bp, with a maximum length of 635 bp (Figure 1).
                        http://static-content.springer.com/image/art%3A10.1186%2F1471-2164-13-602/MediaObjects/12864_2012_4569_Fig1_HTML.jpg
                        Figure 1

                        Frequencies length distribution of 454 read sequences.

                        Identification of SSR loci

                        After MISA analysis, the number of sequences containing an SSR was 125,559, and in total 250,393 SSR loci were detected. The number of sequences containing more than one SSR loci was 61,266 and the number of SSRs present in compound formation was 122,988 (Table 1).

                        The total size of SSR motif sequences was 8,759,185 bp, with an average motif length of 69 bp. Of these, 25% comprised more than one discrete repeat and a high proportion (49%) was located within compound repeats. The majority of identified SSR motifs (83%) were located between the 5’-terminus and mid regions of the cloned sequences, and within 200 bp of the 5’-terminus (Figure 2). A total of 28,503 primer pairs were designed for future assessment of locus amplification (Additional file 2: Table S2).
                        http://static-content.springer.com/image/art%3A10.1186%2F1471-2164-13-602/MediaObjects/12864_2012_4569_Fig2_HTML.jpg
                        Figure 2

                        The frequency of the SSR motif start position from the 5’ terminus of the cloned insert within the enriched libraries .

                        Abundance and length frequencies of SSR repeat motifs

                        The most common SSR motifs comprised trinucleotide and dinucleotide repeats (Figure 3). The majority of the trinucleotide repeats were from 15 to 30 bp in length. Within the 1,188 characterised mononucleotide SSR, (A/T)n was almost three times more common than (C/G)n, particularly at the 11–12 bp length. The dinucleotide repeats (AC/GT)n and (AG/CT)n were predominant, representing 99.2% of all of the dinucleotides characterised. Triucleotide (AAC/GTT)n repeats were the most abundant (96.5%). Twenty two unique tetranucleotide repeat motifs were identified, with the most common being AGAT/ATCT (66.4%), ACAG/CTGT (19.3%) and ACAT/ATGT (9.1%). Pentanucleotide and hexanucleotide motifs were far less frequent, together comprising only 0.1% of the total SSR detected. The dominant pentanucelotide motif was AGAGT/ATCTC (23.8%) and the most common hexanucelotide motif was ACACGC/CGTGTG (49.5%) (Additional files 3, 4, 5, 6, 7 and 8: Figure S1-S6).
                        http://static-content.springer.com/image/art%3A10.1186%2F1471-2164-13-602/MediaObjects/12864_2012_4569_Fig3_HTML.jpg
                        Figure 3

                        Frequencies of different nucleotide repeat sizes within the clones analysed .

                        Compound SSR analysis

                        Two types of compound SSR were identified; those without an interruption between two motifs (ie (CA)12(ACG)37 and noted as C* type) and those with an interruption between two motifs ( ie (AAC)7gtcaat(AAC)5 and noted as C type). In total, 1,893 C* type and 59,369 C type compound SSR loci were detected among those sequenced, reflecting the complexity of the faba bean genome.

                        Validation of SSR assay

                        Of the 150 primer pairs selected for validation of SSR locus amplification, 102 produced a reproducible and clear amplicon of the expected size. Of these, 94 (63%) were polymorphic among thirty-two genotypes assessed (Table 2). The number of alleles per locus ranged from 2 to 8, the expected heterozygosities ranged from 0.0000 to 1.0000, and the observed heterozygosities ranged from 0.0908 to 0.8410 (Table 3).
                        Table 2

                        Characteristics of 94 polymorphic SSR markers developed in Vicia faba L. (F=forward primer, R=reverse primer, Size = size of cloned allele, Ta = annealing temperature)

                        Primer

                        Repeat

                        F (5’– 3’)

                        R (5’– 3’)

                        Size (bp)

                        Ta(°C)

                        CAAS1

                        (AAAGGG)7

                        AGTCAGGGGGTCGATTTTTC

                        TCTTGCGCAGTTTTGACATC

                        212

                        55

                        CAAS2

                        (GAA)9

                        TACAAAAGCTCTGGGGCCTA

                        CCAATTCCTCTGGGCAACT

                        202

                        56

                        CAAS3

                        (AG)7

                        CTGGTGCGTAAGGTTGATGA

                        CAAACCACCACCAATCACAG

                        132

                        53

                        CAAS4

                        (CA)11

                        ATTGCAAGTCCTGAGGCAAG

                        ATAATGGCGCCACAAAGTGT

                        160

                        57

                        CAAS5

                        (ACA)15

                        TACATCAGTCCCGCAAATCA

                        CCATGTAGCCGATTCCACTT

                        150

                        55

                        CAAS6

                        (A)10

                        TGCAAAGTAATTCCGAAACAA

                        CGCACATGAATTGGGGTAAT

                        150

                        56

                        CAAS7

                        (A)10

                        GACCCAAGCCTTCACCACTA

                        TGTGTGGGATCCATTTTGAA

                        200

                        59

                        CAAS8

                        (AAC)14

                        AATTTGTTCAGCATCTCGGG

                        CTGGTTGGTTCCTGGTGAGT

                        150

                        56

                        CAAS9

                        (AAC)9

                        GTGATGCTTTGCCTGTGCTA

                        ATGGACGTTTGTAGGTGGGA

                        200

                        56

                        CAAS10

                        (AAG)5

                        CTGTTCGTCATCATCATCGG

                        CGTAAATCAACCCCAACACC

                        150

                        53

                        CAAS11

                        (ACA)10

                        TCCCGCTATTCTTGCTCTGT

                        GCTCAAAAATGCTTGTCTTTCA

                        170

                        54

                        CAAS12

                        (TGT)9

                        GAGGAGGATCCCACAATGAA

                        GCCAAAAGAGCCATGGTAGA

                        210

                        56

                        CAAS13

                        (CAA)11aaatcccaaaaactgcaaattgtatgccatcttaaaccatac(CAA)7

                        CAAAAATCCCAAAAACTGCAA

                        TCGATTTTTCGACTTGGGTC

                        130

                        56

                        CAAS14

                        (AAC)6

                        CCGTAGATCTCAAAAACCATGA

                        GGAGGAAGGAAGCTCGAATC

                        170

                        60

                        CAAS15

                        (AAC)8

                        AACCAACATCAATGGCATCA

                        TCTTTTCCTTTTTCCTCTTCCA

                        140

                        60

                        CAAS16

                        (CA)7

                        TCAAATTTCCCTTTGCAAAAAT

                        GACCAAGGTCAACCACCTTT

                        350

                        56

                        CAAS17

                        (CA)8

                        TCAAACACCTACACACCCACA

                        TCTCGGTCAATCTCACATGC

                        250

                        56

                        CAAS18

                        (CA)9

                        ATGGGAGGGCAAATTTTAGG

                        AGTGAGTGGAGCGCTTGTTT

                        350

                        56

                        CAAS19

                        (CAA)6

                        AACATTTTTCCAATCGAGGC

                        TGTAGGCTTACGGCCAAAGA

                        200

                        56

                        CAAS20

                        (CAT)5

                        ACTGGAAAATCCCAATGCAC

                        AGCAAACTTGCACCCAACAT

                        190

                        56

                        CAAS21

                        (CTT)8

                        GAATTTTCAAAACATGAGTCCCA

                        CCGGATCTGAAAAGACTTGC

                        175

                        60

                        CAAS22

                        (G)10

                        TGATGAACAGAACTGCGCTC

                        ATTGGAGAGAGGCGAAATCA

                        190

                        56

                        CAAS23

                        (GA)6

                        ACCGCATGCTAGGGAGTCTA

                        TGGGTGACTCACTTTTGTGG

                        220

                        58

                        CAAS24

                        (GA)6gca(AG)6(TG)8

                        TCACTCACAAGCCACTAAGTCAA

                        GATGCGACACTATCCCCACT

                        200

                        56

                        CAAS25

                        (GT)15

                        TCCATAATCAATTGGCTAAGCTC

                        AAGACTAACTCTCGACTGTATTTAGGC

                        150

                        58

                        CAAS26

                        (GT)7

                        CGGCTTGGTTAACTGGATGT

                        TCTTCCTTTTCTTCAATGCG

                        160

                        58

                        CAAS27

                        (TA)6

                        TTGGCATCATGCTCTAATCG

                        CTTGAAGTCGTGCCAGATGA

                        280

                        60

                        CAAS28

                        (TC)8

                        CCATTGATGCAGGAAAGGAT

                        CAGCTTTGACAGCTCCAACA

                        160

                        58

                        CAAS29

                        (TCA)5

                        TGCAAGTCAGTAGCCAAGACA

                        CTCGTCTCTCCTCATTCCCA

                        180

                        58

                        CAAS30

                        (TG)10

                        GGTTTTTAGGTGATTTTCGCA

                        GCGAAACCTCGTATGGTTGT

                        170

                        59

                        CAAS31

                        (TG)12

                        CAACGCGCTAGAGGAAGAAG

                        CCACTGCCCTAGCACACTAA

                        160

                        56

                        CAAS32

                        (TG)7

                        TTTGGGGTACAACACTGGGT

                        CCTCACTCCTCTATATAAACAACACTT

                        200

                        59

                        CAAS33

                        (TGA)5

                        GCAGTGATTCTGGCAGTGAA

                        TGCAGCAACATTTCCATCAT

                        190

                        56

                        CAAS34

                        (TGT)5

                        TTTCTCGCAATTGTTCTCACA

                        TTCGATGAAATCCATCTTCTGA

                        200

                        57

                        CAAS35

                        (TTG)8

                        AGGCAGAAGTTTGGAAGCAA

                        TCTCACTTCGGCTTCAGGAT

                        180

                        56

                        CAAS36

                        (A)11

                        AGCACTAGAGTTCCAAGCCA

                        TTTTTATCGTTTCTTGTCACGC

                        130

                        52

                        CAAS37

                        (A)11

                        CAACGCAAGAACACGTGAAT

                        TAGAGGCCAATTCAAGCCAT

                        190

                        54

                        CAAS38

                        (AAC)5

                        CGCCTCAGAACCAAGTTCAT

                        TGCTTTGTTTTGGTTTTGTGA

                        170

                        56

                        CAAS39

                        (AAG)5

                        CTGTTCGTCATCATCATCGG

                        CGTAAATCAACCCCAACACC

                        170

                        54

                        CAAS40

                        (AAG)6

                        CCAAAGCCACTTCCAAACAT

                        TTCAGCCGGGCTTCTTTC

                        110

                        54

                        CAAS41

                        (AC)10

                        GAAACCCACTTGGTCGTGTC

                        TTCATTTGGGTAGGCTCCAA

                        190

                        56

                        CAAS42

                        (AC)10

                        CAAGTGTCGACGCAAGAGAT

                        TGACTTTTTGACTGCTCCCA

                        250

                        56

                        CAAS43

                        (AC)7

                        GAGGAAGTGTGAAAGGTCGC

                        TCATTTTAAAGTGGTGTATGTGTGT

                        170

                        54

                        CAAS44

                        (AC)7

                        ACACACACACGCACACACAC

                        CATGAACCTTTGATAGTTTTCCA

                        150

                        56

                        CAAS45

                        (AGA)5

                        ATGGCTTTGACAAAAGGGAA

                        CTCCTTCACCCGACAATGTT

                        180

                        57

                        CAAS46

                        (AGA)6

                        AGATCGCAGGCGTAGAAAGA

                        TGCTTCAACCACAACACCAT

                        200

                        58

                        CAAS47

                        (C)11

                        CAAATTGGTTTGCATATCCG

                        AGCCCTTCACATCCATTGAG

                        200

                        56

                        CAAS48

                        (CA)10

                        CCTCCTCCTTTAATTTGTGGC

                        TGAATCGTGAATGCTCTCTGA

                        200

                        56

                        CAAS49

                        (CA)10

                        ACCTCCATAGCAGCAGCATT

                        GGCCAATTCTTAACGTGCTT

                        140

                        56

                        CAAS50

                        (CA)10

                        CACTGGACCATTTTGCATTC

                        ATGAGATCCGGAGCAGATGT

                        140

                        56

                        CAAS51

                        (CA)11

                        AAGCATTAAAACTCCCATAGCG

                        ATGTGTGCGTGTGTCATGTG

                        140

                        52

                        CAAS52

                        (CA)12

                        CATTCCATGTTGCGTTTTTG

                        GGATAAGAGGGTGGTGGTGA

                        200

                        56

                        CAAS53

                        (CA)13

                        GGCCCATTTGTTAAGGGTTT

                        AATGAGATCTGGCCTGGATG

                        200

                        56

                        CAAS54

                        (CA)6

                        CCATTGGACCTCTTTGCATT

                        CCAGAGTGGATGATGATCTGA

                        150

                        54

                        CAAS55

                        (CA)6

                        ACTCACATACACGCACACACA

                        AATGCTCTCATCCCTTTTGC

                        150

                        56

                        CAAS56

                        (CA)6

                        CACATACACGCACACACACA

                        AATGCTCTCATCCCTTTTGC

                        150

                        56

                        CAAS57

                        (CA)8

                        GCCCGAGACACTTTGGTTTA

                        CCAGAATGGATGAGGACCTG

                        210

                        56

                        CAAS58

                        (CA)9

                        CTCCTGGTCCATGTATGAATGA

                        TGTGTGTATGTGTATGCGTGC

                        150

                        54

                        CAAS59

                        (CAA)10

                        GGCCAACATAGGTGAGCATT

                        GTGTTGTAGGCCTTTGGTCC

                        200

                        56

                        CAAS60

                        (CAA)8

                        ATGCAAAATGAAATGCGACA

                        TGTAGTTGTCTGTTTAATGGTTGTTG

                        190

                        56

                        CAAS61

                        (G)11

                        AGAGGAAAAAGGCAAATGGC

                        CCCTTCATCAATCACACCAA

                        130

                        54

                        CAAS62

                        (GA)14

                        AATGTTGGGACGGAGTTCAG

                        TTGTTGATTCATTCATCCCTTG

                        130

                        56

                        CAAS63

                        (GA)15

                        CGCAGAGAAACACTCCATGA

                        GAAGTTGAATGTCATTTGTGTCAA

                        100

                        56

                        CAAS64

                        (GA)6

                        AAAATATAATAAACAAAGCAAAAGTGC

                        CAGGTTTGTGGTTTCACCCT

                        200

                        54

                        CAAS65

                        (GA)6

                        CGATATTCCTCGGTTTCCAA

                        CATGGGTCGTCTTCTCCACT

                        200

                        54

                        CAAS66

                        (GA)6

                        CATCACTTTCCAGCCTGTCA

                        ATTTTCTGCCTCCCCTTTGT

                        190

                        58

                        CAAS67

                        (GA)7

                        GGGTTTCAGAGAAAGGGGTC

                        CGCAAGCGTATTGGGTATTT

                        130

                        56

                        CAAS68

                        (GA)8

                        ATGGAGGTTGCGATTTGAAG

                        CATCATCTCCACACTTTTTCCA

                        130

                        54

                        CAAS69

                        (GT)10

                        ATTACAAATGTCGGTGCCGT

                        AGCACAACGATAAGATGATATGC

                        170

                        54

                        CAAS70

                        (GT)8

                        TCGCGATAGAGGTTTTGGAA

                        AACAACAACGATTCATCACAAGA

                        200

                        56

                        CAAS71

                        (GTT)15

                        CCATGTAGCCGATTCCACTT

                        TTCGGCAACGTAGGAAAAAT

                        160

                        54

                        CAAS72

                        (T)10

                        TTTTCCAGTGTCAACCCATCT

                        ACATGAGGCCAAAAACTGCT

                        170

                        54

                        CAAS73

                        (TG)13

                        TTGCACCTCTGTTGAAGACG

                        TCACCAACACTCTAATCCTCAATC

                        190

                        54

                        CAAS74

                        (AC)6

                        CCCACCGTATTACACAAGGG

                        GCGAGGAAGAAGATGACGTT

                        200

                        56

                        CAAS75

                        (AG)15

                        TCGATTGCACAATAAATGGTTT

                        GAGGTCGACTCCCATTGAAA

                        180

                        54

                        CAAS76

                        (AG)6

                        GCCTGTTAATGAGAAGAACTGGA

                        TTTCAAAATTTAGTTTCTCTCTGTCTC

                        200

                        56

                        CAAS77

                        (CA)21

                        TAGCAGCCAACAATCAGTGG

                        GGTGATGTTGCTCATGTTCG

                        180

                        56

                        CAAS78

                        (CA)7

                        TCAAATTTCCCTTTGCAAAAAT

                        TCGAACACAACTTCTTCATTTCTC

                        180

                        56

                        CAAS79

                        (CA)7

                        TCAAATTTCCCTTTGCAAAAAT

                        CATGGAAAATCTTTTATTTTGTGTG

                        100

                        58

                        CAAS80

                        (CA)8

                        GTGTGAAAACTCACCCGGTC

                        TGTGTGTAAGTGTGTGTATGTGTGTG

                        130

                        54

                        CAAS81

                        (GA)15

                        AACTTACAGGGGCCACACAC

                        TGTGCATTATACTTTACGTATGTTCCT

                        100

                        52

                        CAAS82

                        (GA)17

                        TTTGCTTGACAATGGTGGAA

                        ATTCAACAAGCAAGGGTTGG

                        120

                        52

                        CAAS83

                        (T)10

                        GATTTGCGTTTAGGGTTCCA

                        GAACAAACTACGTTTTATTGTCCAGA

                        180

                        52

                        CAAS84

                        (TA)6

                        TGTCGACACCACAGCTATTTT

                        TGTGGTTCGTTGTTTTGGTG

                        200

                        56

                        CAAS85

                        (TCA)6

                        TTGAAGTGAATAAGATGAAGAAGTGT

                        GTTGCCTTTCCTTGCATGAT

                        130

                        56

                        CAAS86

                        (TG)10

                        TCGCGATAGAGGTTTTGGAA

                        CACAAACAACAACGATTCATCA

                        200

                        56

                        CAAS87

                        (TG)14

                        CTCTACCATGGGCCATTTCT

                        AGAGATAGAGAGAGAGACAGAGATGAA

                        90

                        54

                        CAAS88

                        (TG)18

                        TCCTACCGATCTCTCTCTCCC

                        GTGGCATAACCGCGTAAGTT

                        130

                        56

                        CAAS89

                        (TG)18

                        TGTCTCGCCTTCAATCTTCC

                        CTTGCTAAGTGAGACTGCTGCT

                        190

                        54

                        CAAS90

                        (TG)19

                        TCCATAGTCGATGAGGACCG

                        TTGTCTCATTGTCTTTCTTTTCTTTC

                        100

                        54

                        CAAS91

                        (TG)6

                        ATCTTCGGCTTGGTTGATTG

                        GAGGCGGCCACATTAGACT

                        200

                        56

                        CAAS92

                        (TG)9

                        CGAGATCTGGAGTGGATTTAGA

                        TTTTCATATGCCACATGCTCA

                        170

                        56

                        CAAS93

                        (TTC)5

                        GGCATTGCTTACTTACCGGA

                        CGACGTCGACATTAACATGC

                        200

                        56

                        CAAS94

                        (TTG)9

                        TCCTCAACACGTGATGCAAT

                        TGTAGGACCAGGAAGGTCGT

                        180

                        56

                        Table 3

                        Informativeness of SSR loci following amplification from 32 geographically diverse accessions of Vicia faba L

                        Locus

                        32 Accessions

                         

                        Na

                        He

                        Ho

                        CAAS1

                        3

                        0.0000

                        0.3591

                        CAAS2

                        3

                        0.2857

                        0.5703

                        CAAS3

                        7

                        0.4444

                        0.8099

                        CAAS4

                        4

                        0.0000

                        0.6111

                        CAAS5

                        3

                        0.1111

                        0.6471

                        CAAS6

                        4

                        0.2188

                        0.6324

                        CAAS7

                        6

                        0.6774

                        0.7372

                        CAAS8

                        7

                        0.6250

                        0.8016

                        CAAS9

                        4

                        0.1290

                        0.7250

                        CAAS10

                        4

                        0.7419

                        0.7277

                        CAAS11

                        4

                        0.3929

                        0.6890

                        CAAS12

                        4

                        0.1000

                        0.6718

                        CAAS13

                        5

                        0.3871

                        0.6256

                        CAAS14

                        3

                        0.4062

                        0.6493

                        CAAS15

                        4

                        0.6129

                        0.6901

                        CAAS16

                        6

                        0.6667

                        0.7708

                        CAAS17

                        3

                        0.0000

                        0.5159

                        CAAS18

                        4

                        0.3333

                        0.6887

                        CAAS19

                        5

                        0.0500

                        0.7474

                        CAAS20

                        4

                        0.2593

                        0.5926

                        CAAS21

                        4

                        0.1562

                        0.4712

                        CAAS22

                        3

                        0.2222

                        0.6038

                        CAAS23

                        2

                        0.0938

                        0.0908

                        CAAS24

                        6

                        0.1000

                        0.8000

                        CAAS25

                        5

                        0.4375

                        0.7399

                        CAAS26

                        3

                        0.0000

                        0.6333

                        CAAS27

                        5

                        0.2963

                        0.7701

                        CAAS28

                        4

                        0.5294

                        0.6471

                        CAAS29

                        4

                        0.3793

                        0.4483

                        CAAS30

                        4

                        0.2917

                        0.4991

                        CAAS31

                        4

                        0.4167

                        0.3608

                        CAAS32

                        5

                        0.6875

                        0.7882

                        CAAS33

                        3

                        0.2188

                        0.6195

                        CAAS34

                        3

                        0.4091

                        0.5613

                        CAAS35

                        4

                        0.3226

                        0.6753

                        CAAS36

                        3

                        0.3182

                        0.6131

                        CAAS37

                        2

                        0.1053

                        0.1024

                        CAAS38

                        2

                        0.4500

                        0.5013

                        CAAS39

                        4

                        0.3226

                        0.5960

                        CAAS40

                        3

                        0.0000

                        0.3579

                        CAAS41

                        3

                        0.0645

                        0.5812

                        CAAS42

                        5

                        0.7500

                        0.7599

                        CAAS43

                        3

                        0.0000

                        0.6400

                        CAAS44

                        4

                        0.3333

                        0.6078

                        CAAS45

                        4

                        0.1034

                        0.6068

                        CAAS46

                        3

                        0.0625

                        0.2758

                        CAAS47

                        5

                        0.0000

                        0.6885

                        CAAS48

                        3

                        0.5333

                        0.6706

                        CAAS49

                        3

                        0.0938

                        0.6424

                        CAAS50

                        4

                        0.2759

                        0.6733

                        CAAS51

                        4

                        1.0000

                        0.7270

                        CAAS52

                        3

                        0.7000

                        0.5757

                        CAAS53

                        5

                        0.5806

                        0.7832

                        CAAS54

                        5

                        0.6129

                        0.7441

                        CAAS55

                        3

                        0.0000

                        0.4504

                        CAAS56

                        2

                        0.5000

                        0.4944

                        CAAS57

                        5

                        0.2188

                        0.5045

                        CAAS58

                        3

                        0.4167

                        0.5616

                        CAAS59

                        5

                        0.5200

                        0.6686

                        CAAS60

                        3

                        0.8182

                        0.6104

                        CAAS61

                        3

                        0.2667

                        0.4881

                        CAAS62

                        2

                        0.6250

                        0.4583

                        CAAS63

                        3

                        0.1176

                        0.5704

                        CAAS64

                        4

                        0.4194

                        0.7229

                        CAAS65

                        4

                        0.4643

                        0.7266

                        CAAS66

                        4

                        0.3871

                        0.7123

                        CAAS67

                        4

                        0.0000

                        0.4719

                        CAAS68

                        2

                        0.2500

                        0.2283

                        CAAS69

                        6

                        0.9524

                        0.8072

                        CAAS70

                        2

                        0.0000

                        0.5034

                        CAAS71

                        6

                        0.1429

                        0.8097

                        CAAS72

                        2

                        0.1000

                        0.4808

                        CAAS73

                        5

                        0.2000

                        0.6220

                        CAAS74

                        3

                        0.1250

                        0.2651

                        CAAS75

                        5

                        0.2222

                        0.6797

                        CAAS76

                        4

                        0.1724

                        0.3358

                        CAAS77

                        5

                        0.3600

                        0.6106

                        CAAS78

                        5

                        0.6000

                        0.7734

                        CAAS79

                        5

                        0.2812

                        0.7941

                        CAAS80

                        4

                        0.6400

                        0.7192

                        CAAS81

                        5

                        0.0500

                        0.7167

                        CAAS82

                        4

                        0.6875

                        0.6230

                        CAAS83

                        4

                        0.6000

                        0.7590

                        CAAS84

                        3

                        0.0625

                        0.4172

                        CAAS85

                        3

                        0.3750

                        0.5928

                        CAAS86

                        3

                        0.0323

                        0.4691

                        CAAS87

                        5

                        0.9091

                        0.8139

                        CAAS88

                        6

                        0.8571

                        0.8269

                        CAAS89

                        8

                        0.0000

                        0.8410

                        CAAS90

                        4

                        0.5294

                        0.6471

                        CAAS91

                        5

                        0.8710

                        0.6267

                        CAAS92

                        4

                        0.3750

                        0.5382

                        CAAS93

                        4

                        0.1562

                        0.7217

                        CAAS94

                        5

                        0.2400

                        0.7412

                        Notes: Number of alleles (Na), expected heterozygosity (He) and observed heterozygosity (Ho).

                        The dendrogram showed that the 32 faba bean genotypes fell into four distinct clusters (Figure 4). Cluster 1 comprised accessions from China and other Asian countries except for one accessions from Africa. Cluster 2 comprised accessions from Europe and nearby regions such as Syria. Cluster 3 comprised accessions from Africa and Cluster 4 contained accessions from America, Oceania and Africa. The pattern of diversity was similar to that previously observed using AFLP [29] and ISSR [30] markers.
                        http://static-content.springer.com/image/art%3A10.1186%2F1471-2164-13-602/MediaObjects/12864_2012_4569_Fig4_HTML.jpg
                        Figure 4

                        UPGMA dendrogram of 32 genotypes of faba bean .

                        Discussion

                        This study demonstrated that massively parallel sequencing technology offers opportunity to quickly identify large numbers of high quality SSR with diverse motifs from a genetically orphaned species such as Vicia faba. Given the huge number of marker loci identified in this study, future SSR marker optimisation may be best focussed on those comprising trinucleotide repeats. These repeats are generally more robust since they are reported to give fewer “stutter bands” than those based on dinucleotide repeats [31, 32]. Also, trinucleotide repeats in particular have been demonstrated to be highly polymorphic and stably inherited in the human genome [3335]. While the tri- and dinucleotide repeats mostly contributed to the major proportion of SSRs, a very small share was contributed by mono-, tetra-, penta- and hexa-nucleotide repeats. A similar trend was observed in other species [36].

                        The conversion of SSR-containing sequences into single locus markers may have a low success rate due to complex and/or insufficient flanking sequence. For example, just 20% of the identified dinucleotide repeats from spruce were converted to clear, discrete markers [37]. Similar observations were made for pine [38], wheat [39] and previously for V. faba[12]. Another factor affecting the development of clear markers is the complexity of the repeat motifs, indeed a high proportion of the SSR in the current study comprised compound repeats (49.1%). Nevertheless, this study has provided the selected data required to potentially develop tens of thousands of novel SSR markers for the faba bean genome.

                        Previously, a total of 304,680 reads were generated and 802 EST-SSR primer pairs were designed from transcriptome sequencing of faba bean [40]. From this, 81 primer pairs were developed, of which 48% produced polymorphic markers on the genotypes assessed. In our study, 68% (102) of the SSR loci identified were accurately amplified, of which 63% (94) were polymorphic among the genotypes tested. This may be indicatative of the larger number of SSR loci detected, inclusive of non-transcribed sequences. Hence these markers may be more representative of the entire genome for the purposes of germplasm diversity assessment and conservation purposes [41]. Meanwhile, the identification of EST-SSR within sequences provides future opportunity to mine the expressed sequences for significant physical and functional association with traits of interest in marker-assisted faba bean breeding.

                        Conclusion

                        This work represents a major advance in the identification of large numbers of informative SSR loci in V. faba by application of 454 GS FLX Titanium sequencing technology.

                        Abbreviations

                        SSR: 

                        Simple sequence repeat

                        QTL: 

                        Quantative Trait Locus

                        MAS: 

                        Marker-assisted selection

                        NGS: 

                        Next generation sequencing

                        EST: 

                        Express sequence tag

                        NCBI: 

                        National Center for Biotechnology Information

                        CTAB: 

                        Cetyltrimethylammonium bromid

                        MISA: 

                        Microsatellite identification

                        Na

                        Number of alleles

                        He

                        Expected heterozygosities

                        Ho

                        Observed heterozygosities.

                        Declarations

                        Acknowledgements

                        This work was supported by the National Natural Science Foundation of China (no. 31101198), the China Agriculture Research System (CARS-09) from the Ministry of Agriculture of China and Social Development of Science and Technology Plan (no. 2010BB007) from Yunnan Government. We are grateful to Dr. Dahai Wang and Liping Sun (Beijing Autolab Biotechnology Co., Ltd) for their special contribution to this work.

                        Authors’ Affiliations

                        (1)
                        Institute of Crop Science, The National Key Facility for Crop Gene Resources and Genetic Improvement, Chinese Academy of Agricultural Sciences
                        (2)
                        Institute of Grain Crops, Yunnan Academy of Agricultural Sciences
                        (3)
                        Department of Agriculture and Food Systems, Melbourne School of Land and Environment, The University of Melbourne
                        (4)
                        Qingdao Academy of Agricultural Sciences

                        References

                        1. Rispail N, Kal P, Kiss GB, Ellis THN, Gallardo K, Thompson RD, Prats E, Larrainzar E, Ladrera R, Gonzalez EM, ArreseIgor C, Ferguson BJ, Gresshoff PM, Rubiales D: Model legumes contribute to faba bean breeding. Field Crop Res 2010, 115:253–269.View Article
                        2. Duc G, Marget P, Esnault R, Le Guen J, Bastianelli D: Genetic variability for feeding value of faba bean seeds (Vicia faba): Comparative chemical composition of isogenics involving zero-tannin and zero-vicine genes. J Agric Sci 1999, 133:185–196.View Article
                        3. FAOSTAT 2010. http://​faostat.​fao.​org/​site/​291/​default.​aspx.
                        4. Johnston JS, Bennett MD, Rayburn AL, Galbraith DW, Price HJ: Reference standards for determination of DNA content of plant nuclei. Am J Bot 1999, 86:609.PubMedView Article
                        5. Morozova O, Marra MA: Applications of next-generation sequencing technologies in functional genomics. Genomics 2008, 92:255–264.PubMedView Article
                        6. Mardis ER: The impact of next-generation sequencing technology on genetics. Trends Genet 2008, 24:133–141.PubMedView Article
                        7. Lam HM, Xu X, Liu X, Chen W, Yang G, Wong FL, Li MW, He W, Qin N, Wang B, Li J, Jian M, Wang J, Shao G, Wang J, Sun SSM, Zhang G: Resequencing of 31 wild and cultivated soybean genomes identifies patterns of genetic diversity and selection. Nat Genet 2010, 42:1053–1059.PubMedView Article
                        8. Huang X, Wei X, Sang T, Zhao Q, Feng Q, Zhao Y, Li C, Zhu C, Lu T, Zhang Z, Li M, Fan D, Guo Y, Wang A, Wang L, Deng L, Li W, Lu Y, Weng Q, Liu K, Huang T, Zhou T, Jing Y, Li W, Lin Z, Buckler ES, Qian Q, Zhang QF, Li J, Han B: Genome-wide association studies of 14 agronomic traits in rice landraces. Nat Genet 2010, 42:961–967.PubMedView Article
                        9. Tautz D, Renz M: Simple sequences are ubiquitous repetitive components of eukaryotic genomes. Nucleic Acids Res 1984, 12:4127–4138.PubMedView Article
                        10. Lagercrantz U, Ellegren H, Andersson L: The abundance of various polymorphic microsatellite motifs differs between plants and vertebrates. Nucleic Acids Res 1993, 21:1111–1115.PubMedView Article
                        11. Rafalski JA, Tingey SV: Genetic diagnostics in plant breeding: RAPDs, microsatellites and machines. Trends Genet 1993, 9:275–280.PubMedView Article
                        12. Požárková D, Koblížková A, Román B, Torres AM, Lucretti S, Lysák M, Doležel J, Macas J: Development and characterization of microsatellite markers from chromosome 1-specific DNA libraries of Vicia faba. Biologia Plantarum 2002, 45:337–345.View Article
                        13. Zeid M, Mitchell S, Link W, Carter M, Nawar A, Fulton T, Kresovich S: Simple sequence repeats (SSRs) in faba bean: new loci from Orobanche-resistant cultivar ‘Giza 402’. Plant Breeding 2009, 128:149–155.View Article
                        14. Gong Y-M, Xu S-C, Mao W-H, Hu Q-Z, Zhang G-W, Ding J, Li Z-Y: Generation and characterization of 11 novel EST derived microsatellites from Vicia faba (Fabaceae). Am J Bot 2010, 97:e69-e71.PubMedView Article
                        15. Ma Y, Yang T, Guan J, Wang S, Wang H, Sun X, Zong X: Development and characterization of 21 EST-derived microsatellite markers in Vicia faba (fava bean). Am J Bot 2011, 98:e22-e24.PubMedView Article
                        16. Zhang WK, Wang YJ, Luo GZ, Zhang JS, He CY, Wu XL, Gai JY, Chen SY: QTL mapping of ten agronomic traits on the soybean (Glycine max L. Merr.) genetic map and their association with EST markers. Theor Appl Genet 2004, 108:1131–1139.PubMedView Article
                        17. Matthews BF, Devine TE, Weisemann JM, Beard HS, Lewers KS, MacDonald MH, Park Y-B, Maiti R, Lin J-J, Kuo J, Pedroni MJ, Cregan PB, Saunders JA: Incorporation of sequenced cDNA and genomic markers into the soybean genetic map. Crop Science 2001, 41:516–521.View Article
                        18. Hisano H, Sato S, Isobe S, Sasamoto S, Wada T, Matsuno A, Fujishiro T, Yamada M, Nakayama S, Nakamura Y, Watanabe S, Harada K, Tabata S: Characterization of the soybean genome using EST-derived microsatellite markers. DNA Res 2007, 14:271–281.PubMedView Article
                        19. Dellaporta S, Wood J, Hicks J: A plant DNA minipreparation: Version II. Plant Molecular Biology Reporter 1983, 1:19–21.View Article
                        20. Doyle JJ, Doyle JL: A rapid total DNA preparation procedure for fresh plant tissue. Focus 1990, 12:13–15.
                        21. Kandpal RP, Kandpal G, Weissman SM: Construction of libraries enriched for sequence repeats and jumping clones, and hybridization selection for region-specific markers. Proc Natl Acad Sci USA 1994, 91:88–92.PubMedView Article
                        22. Armour JA, Neumann R, Gobert S, Jeffreys AJ: Isolation of human simple repeat loci by hybridization selection. Hum Mol Genet 1994, 3:599–565.PubMedView Article
                        23. Glenn TC, Schable NA: Isolating microsatellite DNA loci. Methods Enzymol 2005, 395:202–222.PubMedView Article
                        24. Rice P, Longden I, Bleasby A: EMBOSS: the European molecular biology open software suite. Trends Genet 2000, 16:276–277.PubMedView Article
                        25. Thiel , Michalek , Varshney , Graner : Exploiting EST databases for the development and characterization of gene-derived SSR-markers in barley (Hordeum vulgare L.). Theor Appl Genet 2003, 106:411–422.PubMed
                        26. Yeh FC, Boyle TJB: Population genetic analysis of co-dominant and dominant markers and quantitative traits. Belgian Journal of Botany 1997, 129:157.
                        27. Nei M: Estimation of average heterozygosity and genetic distance from a small number of individuals. Genetics 1978, 89:583–590.PubMed
                        28. Tamura K, Dudley J, Nei M, Kumar S: MEGA4: molecular evolutionary genetics analysis (MEGA) software version 4.0. Mol Biol Evol 2007, 24:1596–1599.PubMedView Article
                        29. Zong X, Liu X, Guan J, Wang S, Liu Q, Paull JG, Redden R: Molecular variation among Chinese and global winter faba bean germplasm. Theor Appl Genet 2009, 118:971–978.PubMedView Article
                        30. Wang HF, Zong XX, Guan JJ, Yang T, Sun XL, Ma Y, Redden R: Genetic diversity and relationship of global faba bean (Vicia faba L.) germplasm revealed by ISSR markers. Theor Appl Genet 2012, 124:789–797.PubMedView Article
                        31. Hearne CM, Ghosh S, Todd JA: Microsatellites for linkage analysis of genetic traits. Trends Genet 1992, 8:288–294.PubMed
                        32. Diwan N, Cregan PB: Automated sizing of fluorescent-labeled simple sequence repeat (SSR) markers to assay genetic variation in soybean. Theor Appl Genet 1997, 95:723–733.View Article
                        33. Edwards A, Civitello A, Hammond HA, Caskey CT: DNA typing and genetic mapping with trimeric and tetrameric tandem repeats. Am J Hum Genet 1991, 49:746–756.PubMed
                        34. Gastier JM, Pulido JC, Sunden S, Brody T, Buetow KH, Murray JC, Weber JL, Hudson TJ, Sheffield VC, Duyk GM: Survey of trinucleotide repeats in the human genome: assessment of their utility as genetic markers. Hum Mol Genet 1995, 4:1829–1836.PubMedView Article
                        35. Sheffield VC, Weber JL, Buetow KH, Murray JC, Even DA, Wiles K, Gastier JM, Pulido JC, Yandava C, Sunden SL, Mattes G, Businga T, McClain A, Beck J, Scherpler T, Gilliam J, Zhong J, Duyk GM: A collection of tri- and tetranucleotide repeat markers used to generate high quality, high resolution human genome-wide linkage maps. Hum Mol Genet 1995, 4:1837–1844.PubMedView Article
                        36. Sonah H, Deshmukh RK, Sharma A, Singh VP, Gupta DK, Gacche RN, Rana JC, Singh NK, Sharma TR: Genome-wide distribution and organization of microsatellites in plants: an insight into marker development in Brachypodium. PLoS One 2011, 6:e21298.PubMedView Article
                        37. Pfeiffer A, Olivieri AM, Morgante M: Identification and characterization of microsatellites in Norway spruce (Picea abies K.). Genome 1997, 40:411–419.PubMedView Article
                        38. Smith D, Devey ME: Occurrence and inheritance of microsatellites in Pinus radiata. Genome 1994, 37:977–983.PubMedView Article
                        39. Roder MS, Plaschke J, Konig SU, Borner A, Sorrells ME, Tanksley SD, Ganal MW: Abundance, variability and chromosomal location of microsatellites in wheat. Mol Gen Genet 1995, 246:327–333.PubMedView Article
                        40. Kaur S, Pembleton LW, Cogan NO, Savin KW, Leonforte T, Paull J, Materne M, Forster JW: Transcriptome sequencing of field pea and faba bean for discovery and validation of SSR genetic markers. BMC Genomics 2012, 13:104.PubMedView Article
                        41. Zong X, Redden RJ, Liu Q, Wang S, Guan J, Liu J, Xu Y, Liu X, Gu J, Yan L, Ades P, Ford R: Analysis of a diverse global Pisum sp. collection and comparison to a Chinese local P. sativum collection with microsatellite markers. Theor Appl Genet 2009, 118:193–204.PubMedView Article

                        Copyright

                        © Yang et al.; licensee BioMed Central Ltd. 2012

                        This article is published under license to BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://​creativecommons.​org/​licenses/​by/​2.​0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

                        Advertisement