Identification and functional analysis of cytochrome P450 complement in Streptomyces virginiae IBL14

  • Zhi-Zhen Li1Email author,

    Affiliated with

    • Xiao-Fei Li1Email author,

      Affiliated with

      • Wei Yang1,

        Affiliated with

        • Xiang Dong1,

          Affiliated with

          • Jie Yu2,

            Affiliated with

            • Shu-Liang Zhu1,

              Affiliated with

              • Man Li1,

                Affiliated with

                • Li Xie1 and

                  Affiliated with

                  • Wang-Yu Tong1Email author

                    Affiliated with

                    BMC Genomics201314:130

                    DOI: 10.1186/1471-2164-14-130

                    Received: 25 October 2012

                    Accepted: 21 February 2013

                    Published: 27 February 2013

                    Abstract

                    Background

                    As well known, both natural and synthetic steroidal compounds are powerful endocrine disrupting compounds (EDCs) which can cause reproductive toxicity and affect cellular development in mammals and thus are generally regarded as serious contributors to water pollution. Streptomyces virginiae IBL14 is an effective degradative strain for many steroidal compounds and can also catalyze the C25 hydroxylation of diosgenin, the first-ever biotransformation found on the F-ring of diosgenin.

                    Results

                    To completely elucidate the hydroxylation function of cytochrome P450 genes (CYPs) found during biotransformation of steroids by S. virginiae IBL14, the whole genome sequencing of this strain was carried out via 454 Sequencing Systems. The analytical results of BLASTP showed that the strain IBL14 contains 33 CYPs, 7 ferredoxins and 3 ferredoxin reductases in its 8.0 Mb linear chromosome. CYPs from S. virginiae IBL14 are phylogenetically closed to those of Streptomyces sp. Mg1 and Streptomyces sp. C. One new subfamily was found as per the fact that the CYP Svu001 in S. virginiae IBL14 shares 66% identity only to that (ZP_05001937, protein identifer) from Streptomyces sp. Mg1. Further analysis showed that among all of the 33 CYPs in S. virginiae IBL14, three CYPs are clustered with ferredoxins, one with ferredoxin and ferredoxin reductase and three CYPs with ATP/GTP binding proteins, four CYPs arranged with transcriptional regulatory genes and one CYP located on the upstream of an ATP-binding protein and transcriptional regulators as well as four CYPs associated with other functional genes involved in secondary metabolism and degradation.

                    Conclusions

                    These characteristics found in CYPs from S. virginiae IBL14 show that the EXXR motif in the K-helix is not absolutely conserved in CYP157 family and I-helix not absolutely essential for the CYP structure, too. Experimental results showed that both CYP Svh01 and CYP Svu022 are two hydroxylases, capable of bioconverting diosgenone into isonuatigenone and β-estradiol into estriol, respectively.

                    Keywords

                    Biotransformation Cytochrome P450 Ferredoxin Ferredoxin reductase Gene sequencing Secondary metabolism

                    Background

                    Cytochrome P450 (CYP) genes refer to such genes that encode a superfamily of iron-containing hemoproteins with a maximum absorption spectrum near 450 nm, often characterized by conserved Cys residue in hydrophobic pocket(s) [1]. Most of the ORFs of CYP have three distinct characteristics used often for their identification and analysis, i.e., the I-helix of putative CYPs (a highly conserved threonine involved in oxygen activation), the conserved EXXR motif located in the K-helix and the cytochrome P450 cysteine heme-iron ligand signature motif (GXXXCXG, there are exceptions) [2]. According to a widely-accepted taxonomy, CYPs within a family share more than 40% amino acid identity and members of subfamilies share more than 55% amino acid identity [3]. Occasionally, the decision to accept a sequence in a known family depends greatly on how it clusters on a tree, not so much on the absolute amino acid identity [4].

                    CYPs have been confirmed existing in all eukaryotic (human, animals, plants, fungi, etc.) and prokaryotic organisms (bacteria, archaea, and even in viruse) [58]. They often are monooxygenases involved in oxidation of a range of endogenous compounds, such as cholesterol, lipids and steroidal hormones, as well as xenobiotics such as drugs and toxic chemicals in environment [911]. CYPs catalyse diverse reactions, including C-H hydroxylation, epoxidation, hetero-atom oxidation, aromatic ring oxidation and dealkylation [1113]. In the catalytic reaction process of P450 monooxygenase, one atom of O2 is inserted into substrate while the other is reduced to H2O. CYP genes responsible for secondary metabolism are often laid in antibiotic biosynthetic gene clusters to catalyze stereo- and region- specific reaction of substrates to related derivatives.

                    The biotransforming capabilities of bacterial CYPs have been widely elucidated. P450soy (CYP105D1) from Streptomyces griseus was involved in the degradation of a diverse array of complex agrochemicals and environmental pollutants [14]. CYP105C1 from Actinomycete spp. had the ability to transform benanomicin A into two derivatives, 10-hydroxybenanomicin A and 11-O-demethylbenanomicin [15]. The functions of related CYP107 family members have been reported. CYP107E from Micromonospora griseorubida was found to govern the hydroxylation and epoxidization in mycinamicin biosynthesis [16], P450 Terf (107 L) from Streptomyces platensis to catalyze hydroxylation of terfenadine [17] and hydroxylase PikC (107 L1) of Streptomyces venezuelae to convert narbomycin to picromycin [18]. CYP124 of Mycobacterium tuberculosis demonstrated omega-hydroxylase activity of relevant methyl-branched lipids [19]. YbdT (CYP152A) of Bacillus subtilis was involved in fatty acid beta-hydroxylation [20]. CYP154 of Nocardia farcinica IFM10152 had the functions of the O-dealkylation and ortho-hydroxylation of formononetin [21] and 154H1 from Clostridium acetobutylicum performed biocatalytic reactions with different aliphatic and aromatic substrates [22].

                    Genome sequencing is an effective way to predict and annotate all the possible CYPs genes in an organism. Streptomyces coelicolor A3 (2), a typical strain which is often used for the study of physiological function and antibiotic production, is the first Streptomyces species sequenced in 2001. Its linear chromosome is 8.7 Mb [23] which contains 7825 open reading frames (ORFs) with 18 putative CYPs [24]. S. avermitilis, known for producing the antiparasitic agent avermectin, contains 7600 ORFs with 33 putative CYPs in the 9 Mb chromosomes [25, 26]. The genome of Streptomyces peucetius ATCC27592 with the size of 8.7 Mb contains 19 putative CYPs [27].

                    S. virginiae IBL14, isolated from activated sludge for treatment of waste from a steroidal drug factory, is an effective degradative strain of various steroidal compounds, including progesterone, isotestosterone, dihydrotestosterone, hydrocortisone, cholesterol and ostrone [28]. To comprehensively understand the function of CYPs of S. virginiae IBL14 in degradation and biotransformation of diosgenin, the whole genome sequencing of S. virginiae IBL14 isolated by our lab was carried out for the first time. Using in silico technology, we predict and annotate all of the putative CYPs of S. virginiae IBL14 and analyze these CYPs evolutionarily and functionally via comparison with those of other Streptomyces species. Furthermore, functions and characteristics of CYP genes svh01 and CYP svu022 in this strain are experimentally identified and analyzed.

                    Results and discussion

                    Genome sequencing and CYPs in S. virginiae IBL14

                    By in silico analysis of newly-sequenced S. virginiae IBL14 8.0 Mb genome, 8288 ORFs are identified and the total GC content exceeds 70%. The annotated results via Rpsblast display that there are a total of 33 putative CYPs in the genome of this strain IBL14, contributing to approximately 0.4% of all the coding sequences. The number of CYPs is identical to that in S. avermitili and almost two times as that in S. coelicolor A3(2) and S. peucetius ATCC27952 (18 and 19 CYPs, respectively). Such high level of CYP diversity suggests the high diversity of the secondary metabolism pathways in S. virginiae IBL14.

                    The 32 out of 33 putative CYPs of S. virginiae IBL14 belong to 13 previously-reported CYP families, i.e., 105 (5), 107 (11), 121 (1), 124 (1), 147 (1), 152 (1), 154 (1), 157 (2), 185 (1), 191 (3), 197 (4), 247(1) and another to an unknown family, as shown in Table 1. Among the all, the CYP121A (Svu018), CYP124 (Svu19), CYP147 (Svu020), CYP152 (Svu021), CYP154H (Svu022), CYP157 (Svu023-024), CYP185 (Svu025), CYP191 (Svu26-28), CYP197 (Svu017,029-031) and CYP247 (Svu032) are firstly reported in S. virginiae, and especially, CYP107M, CYP185A and CYP247A have been found rarely in Streptomycete spp. The Svu025, Svu026 and Svu029 have lower identity with other family members (<50%) while others show more than 63% identity to CYPs of other organisms. It’s worth noting that the Svu001 presumably belongs to a new CYP family since no close homologue is found in Genbank except that in Streptomyces sp. Mg1 with 66% identity.
                    Table 1

                    Putative cytochrome P450s in S. virginiae IBL14 with their closest homologs

                    IDa

                    Sizeb

                    Best matches in the database

                    Species

                    Protein identifier

                    CYP family

                    AA overlapd

                    identitye%

                    Svu001

                    464

                    Streptomyces sp. Mg1

                    ZP_05001937

                    new

                    598

                    66

                    Photobacterium profundum 3TCK

                    ZP_01217946

                     

                    113

                    25

                    Svu002

                    361

                    Streptomyces virginiae

                    ABR68806

                    105 L

                    134

                    100

                    Streptomyces clavuligerus ATCC 27064

                    ZP_06769587

                     

                    93.2

                    66

                    Svu003

                    439

                    Streptomyces venezuelae ATCC 10712

                    CCA59424

                    105C

                    608

                    77

                    Streptomyces cattleya NRRL 8057

                    YP_004920090

                    105C

                    553

                    70

                    Svu004

                    398

                    Streptomyces virginiae

                    ABR68806

                    105 L

                    794

                    99

                    Streptomyces sp. ACT50-5

                    BAG16627

                     

                    529

                    69

                    Svu005

                    400

                    Streptomyces sp. C

                    ZP_07285089

                    105D

                    595

                    74

                    Streptomyces avermitilis MA-4680

                    BAC75180

                    105D7

                    529

                    69

                    Svh01

                    399

                    Streptomyces virginiae

                    ABR68805

                    105C1

                    797

                    99

                    Streptomyces viridochromogenes DSM 40736

                    ZP_07307444

                    105

                    703

                    87

                    Svu006

                    403

                    Streptomyces virginiae

                    ABR68807

                    107 L14

                    713

                    99

                    Streptomyces sp. C

                    ZP_07284721

                    107 L14

                    611

                    87

                    Svu007

                    351

                    Streptomyces sp. C

                    ZP_07290554

                    107E

                    609

                    87

                    Streptomyces violaceusniger Tu 4113

                    YP_004815015

                     

                    540

                    77

                    Svu008

                    406

                    Streptomyces sp. C

                    ZP_07285026

                    107 L14

                    604

                    77

                    Streptomyces sp. Mg1

                    ZP_04997607

                    107 L14

                    584

                    76

                    Svu009

                    415

                    Streptomyces sp. C

                    ZP_07286517

                    107 L

                    727

                    85

                    Streptomyces sp. Mg1

                    ZP_04999247

                    107 L

                    484

                    59

                    Svu010

                    396

                    Streptomyces sp. Mg1

                    ZP_04997607

                    107 L14

                    578

                    74

                    Streptomyces sp. C

                    ZP_07285026

                    107 L14

                    556

                    72

                    Svu011

                    405

                    Streptomyces sp. C

                    ZP_07287693

                    107 L

                    728

                    91

                    Streptomyces clavuligerus ATCC 27064

                    ZP_05005324

                    107 L

                    601

                    75

                    Svu012

                    430

                    Streptomyces sp. C

                    ZP_07287209

                    107 L

                    808

                    92

                    Streptomyces sp. Mg1

                    ZP_05000207

                    107 L

                    780

                    91

                    Svu013

                    396

                    Streptomyces sp. C

                    ZP_07287353

                    107 L

                    578

                    75

                    Streptomyces hygroscopicus subsp. jinggangensis 5008

                    AEY86095

                     

                    383

                    54

                    Svu014

                    395

                    Streptomyces sviceus ATCC 29083

                    ZP_06921933

                    107 L

                    961

                    80

                    Streptomyces venezuelae ATCC 10712

                    CCA53921

                    107 L

                    549

                    79

                    Svu015

                    406

                    Streptomyces sp. Mg1

                    ZP_05001939

                    107 L

                    667

                    80

                    Streptomyces scabiei 87.22

                    YP_003488837

                    107 L

                    640

                    77

                    Svu016

                    406

                    Amycolatopsis editerranei U32

                    YP_003767608

                    107 M

                    482

                    63

                    Actinomadura hibisc

                    BAA23153

                     

                    387

                    55

                    Svu017

                    368

                    Streptomyces avermitilis MA-4680

                    NP_823237

                    197A1

                    436

                    64

                    Streptomyces scabiei 87.22

                    YP_003487606

                     

                    389

                    59

                    Svu018

                    393

                    Streptomyces venezuelae ATCC 10712

                    CCA55152

                    121A

                    509

                    67

                    Mycobacterium tuberculosis 02_1987

                    ZP_06504929

                    121A

                    464

                    57

                    Svu019

                    421

                    Streptomyces sp. C

                    ZP_07287311

                    124B

                    782

                    94

                    Streptomyces pristinaespiralis ATCC 25486

                    ZP_06909795

                    124B

                    566

                    70

                    Svu020

                    416

                    Streptomyces sp. C

                    ZP_07289557

                    147A

                    731

                    91

                    Streptomyces peucetius ATCC 27952

                    CAE53704

                    147A

                    667

                    79

                    Svu021

                    421

                    Streptomyces sp. C

                    ZP_07290439

                    152A

                    515

                    71

                    Streptomyces sp. SirexAA-E

                    YP_004806454

                    152A

                    429

                    58

                    Svu022

                    412

                    Streptomyces sp. Mg1

                    ZP_05002011

                    154H

                    742

                    91

                    Streptomyces sp. SirexAA-E

                    YP_004804189

                    154H

                    666

                    83

                    Svu023

                    409

                    Streptomyces sp. C

                    ZP_07285064

                    157A

                    773

                    93

                    Streptomyces sp. Mg1

                    ZP_05002010

                    157A

                    734

                    88

                    Svu024

                    450

                    Streptomyces sp. Mg1

                    ZP_05002596

                    157C

                    723

                    82

                    Streptomyces hygroscopicus ATCC 53653

                    ZP_07300920

                    157C

                    574

                    64

                    Svu025

                    89

                    Streptomyces tubercidicus

                    AAT45286

                    185A1

                    85.9

                    47

                    Actinosynnema mirum DSM 43827

                    YP_003102184

                    185A

                    84.7

                    51

                    Svu026

                    409

                    Streptomyces violaceusniger Tu 4113

                    YP_004813101

                    191A

                    313

                    44

                    Rhodococcus opacus B4

                    YP_002781958

                     

                    300

                    43

                    Svu027

                    398

                    Streptomyces sp. C

                    ZP_07286547

                    191A

                    756

                    92

                    Streptomyces sp. Mg1

                    ZP_04998169

                    191A

                    733

                    89

                    Svu028

                    446

                    Streptomyces sp. Mg1

                    ZP_04997583

                    191A

                    699

                    88

                    Streptomyces sp. C

                    ZP_07290135

                    191A

                    692

                    90

                    Svu029

                    476

                    Singulisphaera acidiphila DSM 18658

                    ZP_09568426

                    197A

                    199

                    33

                    Streptomyces roseosporus NRRL 11379

                    ZP_04712663

                    197A

                    191

                    32

                    Svu030

                    447

                    Streptomyces sp. C

                    ZP_07289871

                    197B

                    713

                    82

                    Streptomyces sp. Mg1

                    ZP_05001362

                    197B

                    680

                    77

                    Svu031

                    710

                    Streptomyces sp. C

                    ZP_07284739

                    197B

                    353

                    79

                    Streptomyces clavuligerus ATCC 27064

                    ZP_05006237

                     

                    350

                    55

                    Svu032

                    416

                    Streptomyces flavogriseus ATCC 33331

                    YP_004921083

                    247A

                    693

                    81

                    Frankia alni ACN14a

                    YP_712777

                    247A

                    573

                    70

                    a The name of the putative CYPs in S. virginiae IBL14.

                    b Amino acid number of putative CYPs.

                    c Closest homologs in Genbank and the family classification of CYPs searched in CYPED.

                    d Number of amino acid overlap, which exceeds the protein size, is due to the introduction of gaps during BLAST comparison.

                    e The highest percent identity for a set of aligned segments to the same subject sequence.

                    Features of CYPs from S. virginiae IBL14

                    Table 2 displays the three characteristic motifs of CYPs of S. virginiae IBL14. The critical residues are highlighted with bold fonts, which are threonine (T) in GXXTT motif of I-helix, glutamic acid (E) and arginine (R) in EXXR motif of K-helix and cysteine (C) in the GXXXCXG heme-binding domain signature, respectively.
                    Table 2

                    A comparison of the conserved domain of putative CYPs in S. virginiae IBL14 with those of the same (sub)family in CYPED using ClustalW

                    ID

                    I-helix

                    K-helix

                    Heme binding motif

                    Accession numbers

                    Svu001

                    Unidentified

                    E 335TLR 338

                    F403LPFGAGPRHCVG415

                    JX119062

                    Svu002

                    Unidentified

                    Unidentified

                    L297RVGVDRRLCCG308

                     

                    Svu003

                    G276LDTT280

                    E 314LLR 317

                    H375LGFGHGIHQCLG387

                    JX119063

                    Svu004

                    G237HETT241

                    E 275SLR 278

                    H337LGFGHGIHQCLG349

                    JX119064

                    Svu005

                    G247HETT251

                    E 285LMR 288

                    H346LAFGFGIHQCLG358

                    JX119065

                    Svh01

                    G235FDTT239

                    E 273LLR 276

                    H334LAFSHGIHQCLG346

                    EF646279

                    Svu006

                    G277HETT281

                    E 315MLR 318

                    H377IAFGHGLHYCLG389

                    JX119066

                    Svu007

                    G238HETT342

                    E 276LLR 279

                    H339LGFGHGVHHCLG351

                    JX119067

                    Svu008

                    G236HETT240

                    E 275MLR 278

                    H337LAFGHGLHFCIG349

                    JX119068

                    Svu009

                    G236HKTT240

                    E 274MQR 277

                    H338LGFGYGAHYCLG350

                    JX119069

                    Svu010

                    G234HETT238

                    E 273MLR 276

                    H335LAFGHGIHFCIG347

                    JX119070

                    Svu011

                    G242HEAT246

                    E 285LMR 288

                    H346LTFGAGIHYCLG358

                    JX119071

                    Svu012

                    G259FETT263

                    E 302LLR 305

                    H364LGYGHGIHYCLG376

                    JX119072

                    Svu013

                    G237SETV241

                    E 275LFR 278

                    H337LALGHGVHYCLG349

                    JX119073

                    Svu014

                    G234HETT238

                    E 272LLR 275

                    H334LAFGHGVHRCLG346

                    JX119074

                    Svu015

                    F247APTT251

                    E 285VVR 288

                    Q347LSFGIGVHSCLG359

                    JX119075

                    Svu016

                    G244YHTT248

                    E 282ALR 285

                    H345LAFGAGIHFCLG357

                    JX119076

                    Svu017

                    G207FLTT211

                    E 245GLR 248

                    H307VAFGYGPHACPG319

                    JX119077

                    Svu018

                    G231VIST235

                    E 269LLR 272

                    H332FSFGGGSHYCPA344

                    JX119078

                    Svu019

                    G256VETT260

                    E 295MIR 298

                    H356LGFGGGGPHFCLG369

                    JX119079

                    Svu020

                    G251HETT255

                    E 289LLR 292

                    H351LGLGSGIHSCFG363

                    JX119080

                    Svu021

                    T247WFTT251

                    E 281VRR 284

                    E347LIAQGGGNARTGHRCPG364

                    JX119081

                    Svu022

                    G251HETT255

                    E 286TLR 289

                    H349ISFGHGPHVCPG361

                    JX119082

                    Svu023

                    G238HQPT 242

                    E 276VLW279

                    F337SFGHGEHRCPFPA350

                    JX119083

                    Svu024

                    A247FETT251

                    E 284QILW288

                    S344HLAFSSGPHECPG357

                    JX119084

                    Svu025

                    Unidentified

                    Unidentified

                    H50LALGIGPHVCMG62

                    JX119085

                    Svu026

                    G249NETT253

                    E 287VLR 290

                    H348LALGSGPHYCLG360

                    JX119086

                    Svu027

                    G238NETT242

                    E 274IVR 277

                    H335LGFGGGGPHFCLG348

                    JX119087

                    Svu028

                    G284NDTV288

                    E 322LLR 325

                    H383VSFGDGPHVCLG395

                    JX119088

                    Svu029

                    A242HETT246

                    E 297TLR 300

                    A367FMPFGGGPRTCLG380

                    JX119089

                    Svu030

                    G259HETT263

                    E 314AMR 317

                    A383WFPFGGGPRACIG396

                    JX119090

                    Svu031

                    G499HETT503

                    E 545TLR 548

                    A614YLPFGIGPGPAWARSSRCGS634

                     

                    Svu032

                    A252NVTT256

                    E 290GLR 293

                    R351HGAFGFGPHFCIG364

                    JX119091

                    From the Table 2, we can find the I-helix is absent in Svu001(new family), and the I-helix and K-helix missing in Svu002 (105 L, often for hydroxylation activity) [29], which reflects I-helix is not absolutely essential for the CYP structure. The 2 members of CYP157 family Svu023 (E276VLW279)/157A and Svu024 (E284QILW288)/157C do not have arginine residue in K-helix like the CYP157C1 from S. coelicolor A3(2) having a motif E 297 QSLW [30] and the CYP157A2 and CYP157C2 from S. avermitilis exhibiting a 257EVLW motif and a 257EQSLW motif [26]. The CYP157 family proteins that lack consensus EXXR motifs but genetically are linked to their upstream conservons imply that they have functions linked to the upstream pathway(s) [30]. Besides, Svu002, Svu018, Svu021, Svu023 and Svu031 do not strictly follow the GXXXCXG motif of heme-binding.

                    Multiple alignments and phylogenetic analysis

                    The phylogenetic tree of the combined CYPs of S. virginiae IBL14, S. avermitilis MA-4680, S. venezuelae ATCC 10712 and Streptomyces sp. Mg1 is presented in Figure 1. From Figure 1, we can find almost of all the CYPs in S. virginiae IBL14 are closely related to their homologues. More than 10 of CYPs from S. virginiae IBL14 are close to those from Streptomyces sp. Mg1 and the member (Svu001) of new CYP family found in S. virginiae IBL14 is only close to Streptomyces sp. Mg1. These results indicate that the CYPs from S. virginiae IBL14 are closer to those from Streptomyces sp. Mg1 than those from other Streptomyces spp, including S. avermitilis MA-4680 and S. venezuelae ATCC 10712. For the four species of S. virginiae IBL14, sp. Mg1, avermitilis MA-4680 and S. venezuelae ATCC 10712, the families CYP 107 and CYP157 (labeled with circle A and B in Figure 1, respectively) have more closely evolutionary relationship.
                    http://static-content.springer.com/image/art%3A10.1186%2F1471-2164-14-130/MediaObjects/12864_2012_4800_Fig1_HTML.jpg
                    Figure 1

                    Phylogenetic tree of the CYPs from S. virginiae IBL14 and three related bacteria. Sequences were aligned using Clustal W and the tree was calculated and constructed using MEGA 5.0. (Streptomyces sp. Mg1, Ssm; S. avermitilis MA-4680, Sam; S. venezuelae ATCC 10712, Sva).

                    Further, the paralogous relationship of the 33 CYPs in S. virginiae IBL14 was generated with the neighbor-joining methods (Clustal W and MEGA 5.0). From Figure 2, we can find that svh01 and svu03 and svu04 as well as svu022 and svu005 in S. virginiae IBL14 have the closest homologous evolutionary relationship, respectively. It’s worth noting that most members belonging to the same CYP family are clustered together as expected, e.g., the 11 members of CYP107 family.
                    http://static-content.springer.com/image/art%3A10.1186%2F1471-2164-14-130/MediaObjects/12864_2012_4800_Fig2_HTML.jpg
                    Figure 2

                    A paralogous tree of all CYP sequences from S. virginae IBL14.

                    The prediction of functions of CYPs in S. virginiae IBL14

                    A high identity over 70% among different protein sequences reasonably suggests that they may hold similar function [26]. As shown in the Table 1, we can find a sum of 26 CYP sequences of S. virginiae IBL14 have best matches to those of other Streptomyces, which are helpful in function prediction.

                    CYP105 and CYP107 are the most studied bacterial cytochromes which are associated with the degradation and biotransformation of a diverse array of xenobiotics and antibiotic biosynthesis. Analysis of CYPs sequence of S. virginiae IBL14 shows that there are 11 CYPs belonging to CYP107, five to CYP105, four to CYP197, three to CYP191, two to CYP157 and one to each other family, which indicates the diversity and importance of the two groups CYP105 and CYP107. The predicted functions of several putative CYPs in S. virginiae IBL14, combined with reported experimental evidences, were listed in Table 3.
                    Table 3

                    Prediction of functions of several putative CYPs in S. virginiae IBL14

                    ID

                    Functions

                    Reference

                    Svu003

                    Hydroxylation & O-demethylation

                    [15]

                    Svu005

                    N-demethylation & Hydroxylation

                    [31]

                    Svh01

                    Hydroxylation

                    [32] and this study

                    Svu006

                    Hydroxylation

                    [17]

                    Svu007

                    Hydroxylation

                    [16]

                    Svu019

                    Hydroxylation

                    [19]

                    Svu021

                    Hydroxylation& Decarboxylation

                    [33]

                    Svu022

                    Hydroxylation& O-dealkylation

                    This study

                    CYPs in S. virginiae IBL14 and their ferredoxin reductase and ferredoxin

                    The catalytic activity of CYPs depends greatly on individual ferredoxin or/and ferredoxin reductase associated with. It was reported that there are three, six and four ferredoxin reductase genes and six, nine and two ferredoxin genes in S. coelicolor A3 (2), S. avermitilis and S. peucetius, respectively. In S. coelicolor A3 (2) only CYP105D5 is arranged in an operon with a ferredoxin gene [24]. In S. peucetius CYP147F is clustered with ferredoxin reductase [27]. In S. avermitilis both CYP105P1 and CYP105D6 are clustered with ferredoxin, CYP147B1 is arranged in an operon with a ferredoxin and ferredoxin reductase, CYP105Q1 is associated in an operon containing both a ferredoxin and ferredoxin reductase, and CYP102 is fused to a P450 reductase [26].

                    Three ferredoxin reductase genes and seven ferredoxin genes are found in S. virginiae IBL14 after annotation of S. virginiae IBL14 genome. That is, the activities of many of the CYPs in S. virginiae IBL14 are supported by different combinations with the three ferredoxin reductases and seven ferredoxins. Also in S. virginiae IBL14, svu005 (CYP105D), svh01 (CYP105C) and svu019 (CYP124B) is found to cluster with ferredoxin svf03, svf09 and svf07, respectively and svu020 (CYP147A) clustered with ferredoxin reductase svfr03 and ferredoxins svf06. The facts suggest that the functional realization of CYPs Svu005, Svh01, Svu019 and Svu020 needs the participation of electron transfer. The result of homology analysis by Blast-searching the Genbank are listed in the Table 4.
                    Table 4

                    Putative ferredoxin reductases and ferredoxins in S. viginiae IBL14 with their closest homologs

                    IDa

                    Accession numbers

                    NO. nucleic acids

                    Match in the databasesb

                    Species

                    Accession

                    Identity%

                    Putative ferredoxin reductases

                    svfr01

                    JX119052

                    453

                    Streptomyces sp. C

                    ZP_07290734

                    94

                    Streptomyces pristinaespiralis ATCC 25486

                    ZP_06911868

                    92

                    svfr02

                    JX119053

                    463

                    Streptomyces sp. C

                    ZP_07285271

                    87

                    Streptomyces sp. Mg1

                    ZP_05002250

                    84

                    svfr03

                    JX119054

                    464

                    Streptomyces sp. C

                    ZP_07289558

                    94

                    Streptomyces peucetius ATCC 27952

                    CAF33360

                    84

                    Putative ferredoxins

                    svf03

                    JX119055

                    219

                    Streptomyces sp. C

                    ZP_07285090

                    84

                    Streptomyces viridochromogenes DSM 40736

                    ZP_07308348

                    79

                    svf04

                    JX119056

                    1143

                    Streptomyces sp. Mg1

                    ZP_04996989

                    83

                    Streptomyces griseoflavus Tu4000

                    ZP_07315146

                    83

                    svf05

                    JX119057

                    234

                    Streptomyces sp. C

                    ZP_07286537

                    88

                    Streptomyces sp. Mg1

                    ZP_05002165

                    79

                    svf06

                    JX119058

                    231

                    Streptomyces peucetius ATCC 27952

                    ACE73829

                    62

                    Streptomyces hygroscopicus subsp

                    AEY87986

                    61

                    svf07

                    JX119059

                    600

                    Streptomyces sp. C

                    ZP_07287304

                    98

                    Streptomyces venezuelae ATCC 10712

                    CCA56325

                    94

                    svf08

                    JX119060

                    315

                    Streptomyces sp. C

                    ZP_07285869

                    89

                    Streptomyces peucetius ATCC 27952

                    ACE73824

                    88

                    svf09

                    JX119061

                    243

                    Streptomyces cattleya NRRL 8057

                    YP_004920089

                    63

                    Streptomyces diastaticus

                    AAR16520

                    61

                    a The name of gene in S. virginiae IBL14.

                    b Homologues searched in Genbank.

                    Regulatory elements and functional genes clustered with CYPs

                    The CYPs in S. peucetius ATCC27952 clustered with regulatory elements were reported [27]. In the annotations of gene arrangement around the putative CYPs on the S. virginiae IBL14 chromosome, svu022, svu023 and svu024 were found to cluster with the genes of ATP/GTP binding proteins (having a phosphate-binding loop for energy requiring metabolic reactions) [34], svu001, svu015 to cluster with LysR-family transcriptional regulator (regulating a diverse set of genes, including those involved in virulence, metabolism, quorum sensing and motility) [35], svu011 to cluster with two component transcriptional regulators and LuxR family (quorum sensing signals in Gram-negative bacteria often regulated by acylated homoserine lactones) [36], svu018 to cluster with a transcriptional regulator, AraC family (transcriptional regulators having diverse functions ranging from carbon metabolism to stress responses to virulence) [37] and two component transcriptional regulators, LuxR family and svu020 to cluster with the ATP-binding protein fbpC and TetR-family transcriptional regulators (among bacteria with an HTH DNA-binding motif for the transcriptional control of multidrug efflux pumps, pathways for the biosynthesis of antibiotics, response to osmotic stress and toxic chemicals, control of catabolic pathways, differentiation processes, and pathogenicity) [38].

                    As described above, the CYPs in S. virginiae IBL14 chromosome are responsible for the transcriptional regulation of many functional genes related with primary, secondary metabolism, as well as the responses to environmental factors as expected. Besides, CYPs are clustered with other functional genes. svh01 is adjacent to the genes of MdlB, ABC-type multidrug transport system, ATPase and permease components, which may be involved in the transportation of substrates [39]. svu009 lies next to alcohol dehydrogenase, suggesting that svu009 may take part in alcohol bioconversion and biodegradation. svu013 is next to 4, 5-DOPA dioxygenase which is a member of the class III extradiol dioxygenase family (a group of enzymes which use a non-heme Fe (II) to cleave aromatic rings between a hydroxylated carbon and an adjacent non-hydroxylated carbon), suggesting that the combination of svu013 and 4, 5-DOPA dioxygenase may be responsible in biodegradation of substrates with aromatic rings. svu026 is adjacent to MbtH-like protein which is found in known antibiotic synthesis gene clusters [40]. The cholesterol oxidase ChoL from S. virginiae IBL14 in the bioconversion and biodegradation of diosgenin responsible for the conversion of diosgenin to diosgenone (a 4-ene-3-keto steroid) via a couple of C3-dehydrogenation and C4-5-isomerization was reported [41]. In S. virginiae IBL14 the gene encoding Svu004 (CYP105L) clusters with the genes of putative ferredoxin Svfr2 and cholesterol oxidase (ChoL), suggesting that the cytochrome P450 joins with the cholesterol oxidase ChoL to catalyze the oxidation of cholesterol and its structural analogs. In conclusion, CYPs from S. virginiae IBL14 may have multiple functions in secondary metabolism, including hydroxylation, dehydrogenation, ring-cleavage, transportation, etc.

                    Functional identification and characteristics of svh01 and svu022

                    To elucidate all putative CYPs’ functions in S. virginiae IBL14, four CYP genes of the strain IBL14 were firstly selected. Among them, the functional identities of CYP genes Svh01(105C1) and svu022 (154H) has been finished.

                    The cytochrome P450 Svh01 (responsible for the C25-hydroxylation of diosgenin) [32] belongs to the class I (prokaryotic/mitochondrial) P450 system based on a taxonomic split, in which electrons are transferred from NADPH or NADH to ferredoxin reductase and ferredoxin. Sequence analysis revealed the complete sequence of svh01 with ATG as the start codon has 70% G + C content. The sequence of possible ribosome-binding site is located on the upstream of svf09 (a coenzyme of Svh01).

                    Both svh01 and svf09 contain 1200 bp and 243 bp, respectively, based on sequence analysis. To obtain the expressed products of them, both svh01 and svf09 sequences were first ligated into a pET22b vector in a cluster to generate the expression plasmid pET22b-svh01-svf09 that was then cloned into E. coli JM109 (DE3) to form a recombinant strain E. coli IBL161 [JM109 (DE3)/pET22b-svh01-svf09]. The PCR results of svh01 and svf09 from the recombinant strain E. coli IBL161 were analyzed by gel electrophoresis (Figure 3A and B) and also confirmed by gene sequencing.
                    http://static-content.springer.com/image/art%3A10.1186%2F1471-2164-14-130/MediaObjects/12864_2012_4800_Fig3_HTML.jpg
                    Figure 3

                    DNA analysis of svh 01, svf 09 and svu 022 cloned from S. virginiae IBL14. A, B and C are the PCR results of svh01, svf09 and svu022, respectively.

                    The svu022 with a G + C content of 73% (clustering with the gene of ATP/GTP binding protein) consists of 1239 nucleotides. Similarly, the complete sequence of svu022 was first inserted to the shuttle plasmid pHCMC05 to form the recombinant plasmid pHCMC05-svu022, and then cloned in B. subtilis WB800N (improving the extracellular expression level of Svu022 for the analysis of enzymatic biotransformation) to produce the recombinant strain B. subtilis IBL 241 [WB800N/pHCMC05-svu022]. The PCR result of svu022 from the recombinant strain B. subtilis IBL 241 is shown in Figure 3C.

                    Svh01 (105C1) is a peptide of 399 amino acids, with a molecular weight of 44.04 kDa and a pI value of 4.97 estimated by the ExPASy (a computing pI/MW tool). To obtain its expressed product and study product characteristics, the recombinant strain E. coli IBL161 was incubated and induced. The expression of Svh01 was shown in Figure 4A. From the SDS-PAGE, we can find that the two distinctly additional protein bands should be Svh01 with an about MW of 44 kDa and Svf09 with an about MW of 8.0 kDa, respectively. The further functional identification of the Svh01/FcpC of S. virginiae IBL14, hydroxylating the C25-tertiary carbon of diosgenin to form isonuatigenone, was experimentally confirmed [32].
                    http://static-content.springer.com/image/art%3A10.1186%2F1471-2164-14-130/MediaObjects/12864_2012_4800_Fig4_HTML.jpg
                    Figure 4

                    SDS-PAGE analysis of Svh01 and Svu022. (A) Lane 1, sample from JM109 (DE3)/pET22b cells; Lane 2, sample from E. coli IBL161. (B) Lane 1, WB800N/pHCMC05 cells; Lane 2 and 3, B. subtilis IBL 241.

                    Svu022 (154H) is a deduced protein of 412 amino acids which shares 91% identity with that in Streptomyces sp. Mg1. The estimation of MW and pI of SVU022 are 44.59 kDa and 5.00, respectively. Similarly, the recombinant strain B. subtilis IBL 241 was incubated and induced to study the product expression and its characteristics. The expressed result of Svu022 from the recombinant strain B. subtilis IBL 241 was shown in Figure 4B. The SDS-PAGE displays a distinct protein band with about MW of 45.0 kDa as expected. The further experimental results from TLC, HPLC and LC/MS indicated that the CYP Svu022 enables to biotransform β-estradiol into estriol. Figure 5 shows the profiles of the biotransformation of β-estradiol by strains B. subtilis WB800N and B. subtilis IBL 241 in HPLC. The functional identification of the Svu005 (CYP105D) and Svu019 (CYP124B) is in progress.
                    http://static-content.springer.com/image/art%3A10.1186%2F1471-2164-14-130/MediaObjects/12864_2012_4800_Fig5_HTML.jpg
                    Figure 5

                    The profiles of the transformation of β-estradiol by strain B. subtilis IBL 241 in HPLC. a: standard estriol; b: sample from B. subtilis IBL 241; c: standard β-estradiol; d: sample from B. subtilis WB800N.

                    Conclusion

                    S. virginiae IBL14 contains 33 putative CYPs, 7 ferredoxins and 3 ferredoxin reductases in its 8.0 Mb linear chromosome. Most of the CYPs in S. virginiae IBL14 belong to the CYP107 (11 members) family and CYP105 (5 members) family. Compared phylogenetically with CYPs from 3 typical Streptomycete spp., S. virginiae IBL14 appears to be closest to those of Streptomyces sp. Mg1.

                    Further analysis showed that among all of the 33 CYPs in S. virginiae IBL14, three CYPs are clustered with ferredoxins, one with ferredoxin and ferredoxin reductase and three CYPs with ATP/GTP binding proteins, four CYPs arranged with transcriptional regulatory genes and one CYP locates on the upper of ATP-binding protein and transcriptional regulators as well as four CYPs associated with other functional genes involved in secondary metabolism and degradation.

                    The new characteristics found in CYPs from S. virginiae IBL14 suggest that the EXXR motif in the K-helix is not absolutely conserved in CYP157 family as reported [30] and I-helix not absolutely essential for the CYP structure. Particularly, one new family was found based on the CYP svu001 in S. virginiae IBL14 which shares 66% identity only to that from Streptomyces sp. Mg1.

                    Two recombinant strains E. coli IBL161 [JM109 (DE3)/pET22b-svh01-svf09] and B. subtilis IBL 241 [WB800N/pHCMC05-svu022] were constructed and subsequently their functions were identified, respectively. Experimental results showed that both CYP Svh01 and CYP Svu022 are two hydroxylases, capable of bioconverting diosgenone into isonuatigenone and β-estradiol into estriol, respectively.

                    Methods

                    Strains and plasmids

                    S. virginiae IBL-14 (CCTCCM 206045) [42] as the strain of interest was used for the Cytochrome P450 gene identification and functional analysis. E. coli JM109, JM109 (DE3) and B. subtilis WB800N were used as the host for plasmid construction and target protein expression in the functional identification of the CYPs, respectively. The vector pET22b was used for cloning and expression of genes of interest in E. coli. The shuttle plasmid pHCMC05 was used for the expression of target proteins in B. subtilis (a GRAS strain by FDA). The features of the bacterial strains and plasmids used in this study are listed in Table 5.
                    Table 5

                    Microorganisms and plasmids used in this study

                    Strains

                    Relevant properties

                    Source

                    Escherichia coli

                    JM109

                    Cloning host, genotype:endA1, recA1, gyrA96, thi, hsdR17 (rk, mk+), relA1, supE44, (lac-proAB), [F’ traD36, proAB, laqIqZΔM15]

                    Promega

                    JM109 (DE3)

                    Expression host, genotype:endA1, recA1, gyrA96, thi, hsdR17 (rk, mk+), relA1, supE44, λ–, Δ(lac-proAB), [F’, traD36, proAB, lacIqZΔM15], lDE3

                    Promega

                    Bacillus subtilis

                    WB800N

                    Secretion host with resistance to neomycin, genotype: nprE aprE epr bpr mpr :: ble nprB :: bsr vpr wprA :: hyg cm :: neo; NeoR

                    Mo Bi Tec

                    Streptomyces virginiae

                    IBL14

                    Wild type

                    Our lab

                    Plasmids

                    pET22b

                    Expression vector in E. coli

                    Novagen

                    pHCMC05

                    Shuttle plasmid

                    BGSC

                    pET22b-svh01-svf09

                    The fragment of svh01 and svf09 were digested with NdeI/EcoRIand EcoRI/Hind Ш, respectively, and ligated into the NdeIand Hind Ш sites of pET22b

                    This study

                    pHCMC05-svu022

                    The gene of svu022 digested with BamHI/SmaIligated into BamHI/SmaIdigested pHCMC05

                    This study

                    Media and cultivation

                    Luria-Bertani (LB) medium was used for plasmid construction and protein expression. A final concentration of 70 μg/ml ampicillin was supplemented into the medium when E. coli IBL161 [JM109 (DE3)/pET22b-svh01-svf09] and E. coli IBL152 [JM109/pHCMC05-svu022] were cultivated. A final concentrations of 25 μg/ml chloramphenicol was added to the medium when B. subtilis IBL 241 [WB800N/pHCMC05-svu022] was cultivated. The cultivating procedure of S. virginiae IBL-14 has been described previously [42]. Diosgenin in 95% purity (J&K Chemical Ltd, China) and β-estradiol in 98% purity (J&K Chemical Ltd, China) were dissolved in anhydrous ethanol before adding into medium.

                    Sequencing and in-silico identification analyses of CYPs

                    The S. virginiae IBL14 genome sequencing was performed at 454 platform (Encode Genomics Co. Ltd., Suzhou, China) for the first time (sequence data will be published step by step). All of the ORFs of this genome were predicted using glimmer3.0 and prodigal, respectively. To dig out all possible CYP gene function information in S. virginiae IBL14, the genome sequence of the strain was compared with the SWISSPROT, TrEMBL, KEGG databases by using Blastp and the CDD and COG databases by using Rpsblast, respectively.

                    The deduced amino acid sequences of the putative CYPs of S. virginiae IBL14 were aligned with the CYPs from S. avermitilis MA-4680, S. venezuelae ATCC 10712 and Streptomyces sp. Mg1 by using ClustalW [43]. Then the molecular evolution and phylogenetic analyses by neighbor-joining methods were carried out using MEGA5.0 [44]. To forecast the possible functions involved in secondary metabolism, comparison between all putative CYPs of S. virginiae IBL14 with those in other organisms based on homologues was done by using Blastp too.

                    Using the three motifs as described above as criteria, the CYP gene candidates of S. virginiae IBL14 were blast searched against GenBank non-redundant protein database to identify their closest bacterial homologues and tentatively distribute all of the CYPs of S. virginiae IBL14 into the corresponding family or subfamily [26]. Similar procedure was performed to the putative ferredoxin and ferredoxin reductase genes to identify their closest bacterial homologues.

                    Construction and cloning of expression plasmids

                    The genes of svh01, svf09 and svu022 from the genomic DNA of S. virginiae IBL14 were amplified by using PCR method (Pfu DNA Polymerase, Fermentas, Thermo Fisher Scientific Inc.) and the primers used are listed in Table 6. The PCR products of svh01 and svf09 were digested with NdeI/EcoRIand EcoRI/Hind III, respectively, then ligated into a pET22b vector, and finally transformed to the host bacterium E. coli JM109 (DE3). Similarly, the PCR product of svu022 was digested with BamHI/Sma I, then ligated into a shuttle plasmid pHCMC05 and finally transformed to B. subtilis WB800N.
                    Table 6

                    The PCR primers used in this study

                    Primer

                    Primer sequencea(5to3)

                    Restriction site

                    pSVH01F

                    GCCCCCCATATGAGTGAGTCCCTCCACACCGTC

                    NdeI

                    pSVH01R

                    GGAGGAATTCACTTCGCGTCCCAGGTG

                    EcoRI

                    pSVF09F

                    CCGGAATTCGGGACGCGAAGTGAGCGCGG

                    EcoRI

                    pSVF09R

                    CCCAAGCTTTCAGGCGGAGGGTGGGCGG

                    Hind III

                    pSVU022F

                    CTGGATCCATGAGCTGCCCGATCGACC

                    BamHI

                    pSVU022R

                    CCTAAGCTTTCAGGGGTGCAGGCGTACCG

                    SmaI

                    aThe underlined sequence are recognition sites of restriction enzymes and the nucleotides before it are the protected bases. All primers are designed by Primer Premier 5.0 and verified by Oligo 7.0.

                    Expression and analysis of target proteins

                    0.3 ml (inoculation ratio of 1%) of the overnight culture of E. coli IBL161 as seed was inoculated in 30 ml LB medium (containing 70 μg/ml ampicillin) and then cultivated at a shaking speed of 200 rpm at 37°C. The expression of target protein was induced by adding 0.2 mM IPTG when the OD value reached 0.5 ~ 0.6 at 600 nm. Then the culture was continuously cultivated for another 24 h at 25°C at a speed of 200 rpm in a rotary shaker. Similarly, the overnight culture of B. subtilis IBL 241 was inoculated with 1% ratio in 30 ml LB medium (25 μg/ml chloramphenicol, 200 rpm at 30°C). After adding 0.2 mM IPTG in logarithmic growth phase, the culture was continuously cultivated for another 48 h at the same conditions. The harvested recombinant cells were resuspended and subjected to ultrasonication in 50 mM PBS (pH 7.4), and then centrifuged at 6000 rpm for 5 min. The supernatant was analysed by SDS-PAGE.

                    Biotransformation and product extraction

                    One milliliter of β-estradiol/diosgenin (a final concentration of 0.2 mg/ml) for each flask was added for biotransformation analysis after E. coli IBL161 was induced by IPTG at 25°C for 2 h. After cultivated for another 24 h under the same conditions, the cultures were extracted two times with a half volume of 100% ethyl acetate (Sinopharm Chemical Reagent Co., Ltd). The extracts were evaporated to dryness, then re-dissolved in 1 ml anhydrous ethanol, and finally detected and analyzed (thin layer chromatography/TLC, high performance liquid chromatography/HPLC and liquid chromatography–mass spectrometry LC-MS).

                    DNA and protein analytical methods

                    DNA electrophoresis for recombinant plasmid analysis was carried out in agarose gels at 110 V for 30 min [45]. SDS-PAGE with a 15% (w/v) acrylamide gel for expressed protein analysis was run at 110 V for 2 h according to Schagger’s publication [46]. The bands were visualized by Coomassie R-250 staining.

                    HPLC analysis of biotransformation products

                    To identify and analyze the metabolites, high performance liquid chromatography (HPLC) was carried out. Simply, the sample of 10 μl was first loaded onto 250 mm Symmetry C 18 (4.6 mm × 250 mm, Waters Co., USA) and eluted with ethanol/water (60/40, v/v). The flow rate, the wavelength for UV-detection and the temperature of the column on the HPLC system (Breeze 1525 series, Waters Co., USA) were set at 1 ml/min, 245 nm and 35°C, respectively. The products after biotransformation were qualitatively and quantitatively analyzed by comparing with corresponding standard material.

                    Declarations

                    Acknowledgments

                    Preparation of this manuscript was supported by the National Natural Science Foundation of China (20976001) and by the Key Scientific Research Projects of Department of Education of Anhui Province of China (KJ2009A161) and by the Academic Leader Foundation of 211 Project (phase-3) of Anhui University of China (AU02303154). Also, we are grateful to Hui Peng and Ya-Zhong Xiao, School of Life Science, Anhui University, Hefei, China, for generous gift of plasmids and to Hong Yu, Encode Genomics Co. Ltd., Suzhou, China, for the genome sequencing of the strain IBL14.

                    Authors’ Affiliations

                    (1)
                    Integrated Biotechnology Laboratory, Institute of Health Science, School of Life Science, Anhui University
                    (2)
                    Department of Chemical Engineering, McMaster University

                    References

                    1. Hasemann CA, Kurumbail RG, Boddupalli SS, Peterson JA, Deisenhofer J: Structure and function of cytochromes P450: a comparative analysis of three crystal structures. Structure (London, England: 1993) 1995,3(1):41–62.View Article
                    2. Nelson DR, Koymans L, Kamataki T, Stegeman JJ, Feyereisen R, Waxman DJ, Waterman MR, Gotoh O, Coon MJ, Estabrook RW: P450 superfamily: update on new sequences, gene mapping, accession numbers and nomenclature. Pharmacogenetics 1996,6(1):1–42.PubMedView Article
                    3. Nelson DR: Cytochrome P450 nomenclature, 2004. Methods Mol Biol (Clifton, NJ) 2006, 320:1–10.
                    4. Nelson DR: Cytochrome P450 nomenclature. Methods Mol Biol 1998, 107:15–24.PubMed
                    5. Danielson PB: The cytochrome P450 superfamily: biochemistry, evolution and drug metabolism in humans. Current drug metabolism 2002,3(6):561–597.PubMedView Article
                    6. Mogi T, Kita K: Diversity in mitochondrial metabolic pathways in parasitic protists Plasmodium and Cryptosporidium . Parasitol Int 2010,59(3):305–312.PubMedView Article
                    7. Fu C, Xiong J, Miao W: Genome-wide identification and characterization of cytochrome P450 monooxygenase genes in the ciliate Tetrahymena thermophila . BMC Genomics 2009,10(1):208.PubMedView Article
                    8. Lamb DC, Lei L, Warrilow AGS, Lepesheva GI, Mullins JGL, Waterman MR, Kelly SL: The first virally encoded cytochrome p450. J Virol 2009,83(16):8266–8269.PubMedView Article
                    9. Guengerich FP: Cytochrome p450 and chemical toxicology. Chem Res Toxicol 2008,21(1):70–83.PubMedView Article
                    10. Pryor WA: Cytochrome P450: Structure, mechanism, and biochemistry. New York: Montellano Plenum Press; 1996.
                    11. McLean KJ, Hans M, Munro AW: Cholesterol, an essential molecule: diverse roles involving cytochrome P450 enzymes. Biochem Soc Trans 2012,40(3):587–593.PubMedView Article
                    12. Ouellet H, Johnston JB, Ortiz de Montellano PR: The Mycobacterium tuberculosis cytochrome P450 system. Arch Biochem Biophys 2010,493(1):82–95.PubMedView Article
                    13. Johnston JB, Ouellet H, Podust LM, Ortiz de Montellano PR: Structural control of cytochrome P450-catalyzed ω-hydroxylation. Arch Biochem Biophys 2011,507(1):86–94.PubMedView Article
                    14. Trower MK, Lenstra R, Omer C, Buchholz SE, Sariaslani FS: Cloning, nucleotide sequence determination and expression of the genes encoding cytochrome P-450soy (soyC) and ferredoxinsoy (soyB) from Streptomyces griseus . Mol Microbiol 1992,6(15):2125–2134.PubMedView Article
                    15. Kumagai H, Umekita M, Sawa R, Takahashi Y, Arisawa A, Isshiki K, Nishimura Y, Akamatsu Y: Generation of new benanomicin analogues by biotransformation using Escherichia coli expressing actinomycete cytochrome P450. J antibiotics 2008,61(6):394–399.View Article
                    16. Inouye M, Takada Y, Muto N, Beppu T, Horinouchi S: Characterization and expression of a P-450-like mycinamicin biosynthesis gene using a novel micromonospora- Escherichia coli shuttle cosmid vector. Mol Gen Genet MGG 1994,245(4):456–464.View Article
                    17. Lombard M, Salard I, Sari M-A, Mansuy D, Buisson D: A new cytochrome P450 belonging to the 107 L subfamily is responsible for the efficient hydroxylation of the drug terfenadine by Streptomyces platensis . Arch Biochem Biophys 2011,508(1):54–63.PubMedView Article
                    18. Betlach MC, Kealey JT, Ashley GW, McDaniel R: Characterization of the macrolide P-450 hydroxylase from Streptomyces venezuelae which converts narbomycin to picromycin. Biochemist 1998,37(42):14937–14942.View Article
                    19. Johnston JB, Kells PM, Podust LM, Ortiz de Montellano PR: Biochemical and structural characterization of CYP124: a methyl-branched lipid omega-hydroxylase from Mycobacterium tuberculosis . Proc Nat Academy Sci United StatesAm 2009,106(49):20687–20692.View Article
                    20. Youssef NH, Wofford N, McInerney MJ: Importance of the long-chain fatty acid beta-hydroxylating cytochrome P450 enzyme YbdT for lipopeptide biosynthesis in Bacillus subtilis strain OKB105. Inter J Mol Sci 2011,12(3):1767–1786.View Article
                    21. Choi K-Y, Park H-Y, Kim B-G: Characterization of bi-functional CYP154 from Nocardia farcinica IFM10152 in the O-dealkylation and ortho-hydroxylation of formononetin. Enzyme Microbial Technol 2010,47(7):327–334.View Article
                    22. Schallmey A, den Besten G, Teune IGP, Kembaren RF, Janssen DB: Characterization of cytochrome P450 monooxygenase CYP154H1 from the thermophilic soil bacterium Thermobifida fusca . Appl Microbiol Biotechnol 2011,89(5):1475–1485.PubMedView Article
                    23. Bentley SD, Chater KF, Cerdeño-Tárraga AM, Challis GL, Thomson NR, James KD, Harris DE, Quail MA, Kieser H, Harper D: Complete genome sequence of the model actinomycete Streptomyces coelicolor A3(2). Nature 2002,417(6885):141–147.PubMedView Article
                    24. Lamb DC, Skaug T, Song H-L, Jackson CJ, Podust LM, Waterman MR, Kell DB, Kelly DE, Kelly SL: The cytochrome P450 complement (CYPome) of Streptomyces coelicolor A3(2). J biol chemist 2002,277(27):24000–24005.View Article
                    25. Burg RW, Miller BM, Baker EE, Birnbaum J, Currie SA, Hartman R, Kong YL, Monaghan RL, Olson G, Putter I: Avermectins, new family of potent anthelmintic agents: producing organism and fermentation. Antimicrob Agents Chemother 1979,15(3):361–367.PubMedView Article
                    26. Lamb DC, Ikeda H, Nelson DR, Ishikawa J, Skaug T, Jackson C, Omura S, Waterman MR, Kelly SL: Cytochrome p450 complement (CYPome) of the avermectin-producer Streptomyces avermitilis and comparison to that of Streptomyces coelicolor A3(2). Biochem Biophysical Res Commun 2003,307(3):610–619.View Article
                    27. Parajuli N, Basnet DB, Chan Lee H, Sohng JK, Liou K: Genome analyses of Streptomyces peucetius ATCC 27952 for the identification and comparison of cytochrome P450 complement with other Streptomyces . Archives Biochemist Biophys 2004,425(2):233–241.View Article
                    28. Wang F-Q, Zhang C-G, Li B, Wei D-Z, Tong W-Y: New microbiological transformations of steroids by Streptomyces virginiae IBL-14. Environ Sci Technol 2009,43(15):5967–5974.PubMedView Article
                    29. Yasutake Y, Imoto N, Fujii Y, Fujii T, Arisawa A, Tamura T: Crystal structure of cytochrome P450 MoxA from Nonomuraea recticatena (CYP105). Biochem Biophys Res Commun 2007,361(4):876–882.PubMedView Article
                    30. Rupasinghe S, Schuler MA, Kagawa N, Yuan H, Lei L, Zhao B, Kelly SL, Waterman MR, Lamb DC: The cytochrome P450 gene family CYP157 does not contain EXXR in the K-helix reducing the absolute conserved P450 residues to a single cysteine. FEBS Lett 2006,580(27):6338–6342.PubMedView Article
                    31. Taylor M, Lamb DC, Cannell R, Dawson M, Kelly SL: Cytochrome P450105D1 (CYP105D1) from Streptomyces griseus : heterologous expression, activity, and activation effects of multiple xenobiotics. Biochem Biophys Res Commun 1999,263(3):838–842.PubMedView Article
                    32. Wang W, Wang F-Q, Wei D-Z: Characterization of P450 FcpC, the enzyme responsible for bioconversion of diosgenone to isonuatigenone in Streptomyces virginiae IBL-14. Applied environ microbiol 2009,75(12):4202–4205.View Article
                    33. Rude MA, Baron TS, Brubaker S, Alibhai M, Del Cardayre SB, Schirmer A: Terminal olefin (1-alkene) biosynthesis by a novel p450 fatty acid decarboxylase from Jeotgalicoccus species. Appl Environ Microbiol 2011,77(5):1718–1727.PubMedView Article
                    34. Saraste M, Sibbald PR, Wittinghofer A: The P-loop a common motif in ATP- and GTP-binding proteins. Trends Biochem Sci 1990,15(11):430–434.PubMedView Article
                    35. Maddocks SE, Oyston PCF: Structure and function of the LysR-type transcriptional regulator (LTTR) family proteins. Microbiol (Reading, England) 2008,154(Pt 12):3609–3623.View Article
                    36. Nasser W, Reverchon S: New insights into the regulatory mechanisms of the LuxR family of quorum sensing regulators. Analytical Bioanalytical Chemist 2007,387(2):381–390.View Article
                    37. Frota CC, Papavinasasundaram KG, Davis EO, Colston MJ: The AraC family transcriptional regulator Rv1931c plays a role in the virulence of Mycobacterium tuberculosis . Infect Immun 2004,72(9):5483–5486.PubMedView Article
                    38. Ramos JL, Martínez-Bueno M, Molina-Henares AJ, Terán W, Watanabe K, Zhang X, Gallegos MT, Brennan R, Tobes R: The TetR family of transcriptional repressors. Microbiol Mol Biol Rev 2005,69(2):326–356.PubMedView Article
                    39. Davidson AL, Dassa E, Orelle C, Chen J: Structure, function, and evolution of bacterial ATP-binding cassette systems. Microbiol Mol Biol Rev 2008,72(2):317–364.PubMedView Article
                    40. Quadri LEN, Sello J, Keating TA, Weinreb PH, Walsh CT: Identification of a Mycobacterium tuberculosis gene cluster encoding the biosynthetic enzymes for assembly of the virulence-conferring siderophore mycobactin. Chemist Biol 1998,5(11):631–645.View Article
                    41. Li B, Wang W, Wang F-Q, Wei D-Z: Cholesterol oxidase ChoL is a critical enzyme that catalyzes the conversion of diosgenin to 4-ene-3-keto steroids in Streptomyces virginiae IBL-14. Applied Microbiol Biotechnol 2010,85(6):1831–1838.View Article
                    42. Wang F-Q, Li B, Wang W, Zhang C-G, Wei D-Z: Biotransformation of diosgenin to nuatigenin-type steroid by a newly isolated strain, Streptomyces virginiae IBL-14. Applied microbiol biotechnol 2007,77(4):771–777.View Article
                    43. Thompson JD, Higgins DG, Gibson TJ: CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res 1994,22(22):4673–4680.PubMedView Article
                    44. Tamura K, Peterson D, Peterson N, Stecher G, Nei M, Kumar S: MEGA5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mole Biol Evol 2011,28(10):2731–2739.View Article
                    45. Sambrook J, Russel D: Molecular cloning: a Laboratory manual. 3rd edition. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press; 2011.
                    46. Schägger H, von Jagow G: Tricine-sodium dodecyl sulfate-polyacrylamide gel electrophoresis for the separation of proteins in the range from 1 to 100 kDa. Analytical Biochem 1987,166(2):368–379.View Article

                    Copyright

                    © Li et al.; licensee BioMed Central Ltd. 2013

                    This article is published under license to BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://​creativecommons.​org/​licenses/​by/​2.​0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

                    Advertisement