Figure 9From: A combination of improved differential and global RNA-seq reveals pervasive transcription initiation and events in all stages of the life-cycle of functional RNAs in Propionibacterium acnes, a major contributor to wide-spread human diseaseRNA-seq analysis of the pqs locus. In (A) the tracks are as detailed in Figure 8. For the insets below the gRNA-seq tracks, large bold font indicates TSSs identified by standard 5′ RACE (B), and dRNA-seq (Additional file 3). The putative −10 and −35 boxes of the corresponding promoters are in italic font. The genes of the histidine kinase, response regulator extracellular and signalling peptide are PPA0945, PPA0947 and PPA0946, respectively. RNA-seq data for both strands within the pqs locus is shown: black positive values correspond to the forward strand, while red negative values correspond to the reverse strand. The green box marks the boundaries for a potential antisense RNA regulator of the PPA0945-0946 transcription unit. Blue arrowheads indicate the binding sites of the primers that were extended to produce cDNA for pqsBA and pqsC mRNA. The sequences of the corresponding primers were 5′ CCTTGGGTTGCGTATTCACAG and 5′ TGTGAGACCGTCCATTTCAG, respectively. The dashed lines indicate the sizes of the cDNAs that were produced, as determined by agarose gel electrophoresis (B) and sequencing of the product (data not shown). (B), lanes 1 and 2 show total RNA before and after treatment with TEX, respectively; lanes 3 and 4 show the reaction products of 5′ RACE analysis of pqsBA mRNA without and with template, respectively; lanes 5 and 6, as 3 and 4, except pqsC mRNA was analysed. The marker (M) was a 100-bp ladder (BioLabs). For details of primers and conditions, see Methods.Back to article page