The Gut Microbiotassay: a high-throughput qPCR approach combinable with next generation sequencing to study gut microbial diversity

Hermann-Bank, Marie Louise; Skovgaard, Kerstin; Stockmarr, Anders; Larsen, Niels; Mølbak, Lars

doi:10.1186/1471-2164-14-788

Table 1 Target-specific primer sequences constituting the Gut Microbiotassay in order to target main bacterial phyla and bacterial groups and species of high interest in the mammalian intestine

From: The Gut Microbiotassay: a high-throughput qPCR approach combinable with next generation sequencing to study gut microbial diversity

Main target		rRNA gene	Sequence (5′ → 3′)	E. coli position	Size, bp	Reference	Reference bacterium
Domain Bacteria A V2-V3	Forward	16S	AGAGTTTGATCCTGGCTCAG	7	336	Liu et al.[30]	1,2,3,4,5,6,7,8,9,10,11,13,14,15
Domain Bacteria A V2-V3	Reverse	16S	CTGCTGCCTYCCGTA	342	336	Liu et al.[30]	1,2,3,4,5,6,7,8,9,10,11,13,14,15
Domain Bacteria B V4-V5	Forward	16S	CAGCAGCCGCGGTAATAC	518	389	Schwieger & Tebbe [31]	1,2,3,4,5,6,7,8,9,10,11,13,14,15
Domain Bacteria B V4-V5	Reverse	16S	CCGTCAATTCCTTTGAGTTT	906	389	Schwieger & Tebbe [31]	1,2,3,4,5,6,7,8,9,10,11,13,14,15
Phylum Firmicutes	Forward	16S	CTGATGGAGCAACGCCGCGT	385	429	Haakensen et al.[32]	6,7,9,11,13,14
Phylum Firmicutes	Reverse	16S	ACACYTAGYACTCATCGTTT	813	429	Mühling et al.[33]	6,7,9,11,13,14
Class Bacilli	Forward	16S	GCAGTAGGGAATCTTCCGC	353	461	Felske et al.[34]	7,11,14
Class Bacilli	Reverse	16S	ACACTTAGCACTCATCGTTT	813	461	Modified from Mühling et al.[33]	7,11,14
Genus Enterococcus	Forward	16S	GGGTAACCTRCCCATCAGA	125	325	Modified from Behr et al.[35]	7
Genus Enterococcus	Reverse*	16S 16S	GTTACTCTCATCCTTGTTC ACCGTCAGGGGACGTTCAG	449 466	342	Modified from Behr et al.[35] Modified from Behr et al.[35]	7
Genus Lactobacillus	Forward	23S	GCGGTGAAATTCCAAACG	774	216	This study, Linux ARB [13]	11
Genus Lactobacillus	Reverse	23S	GGGACCTTAACTGGTGAT	989	216	This study, Linux ARB [13]	11
Genus Streptococcus	Forward	16S	CTWACCAGAAAGGGACGGCT	488	337	This study, ClustalW2 [36]	14
Genus Streptococcus	Reverse	16S	AAGGRYCYAACACCTAGC	824	337	This study, ClustalW2 [36]	14
Family Clostridium cluster I	Forward	16S	AAAGGAAGATTAATACCGCATA	159	538	Modified from Rinttila et al.[37]	6
Family Clostridium cluster I	Reverse	16S	TTCTTCCTAATCTCTACGCA	696	538	Hung et al.[38]	6
Species Clostridium perfringens	Forward	16S	TGAAAGATGGCATCATCATTCAAC	183	258	Skånseng et al.[39]	6
Species Clostridium perfringens	Reverse	16S	GGTACCGTCATTATCTTCCCCAAA	440	258	Skånseng et al.[39]	6
Family Clostridium cluster IV	Forward	16S	ACAATAAGTAATCCACCTGG	866	298	Modified from Ramirez-Farias et al.[40]	9
Family Clostridium cluster IV	Reverse	16S	CTTCCTCCGTTTTGTCAA	1163	298	Matsuki et al.[41]	9
Family Clostridium cluster XIV	Forward	16S	CGGTACCTGACTAAGAAGC	482	413	Rinttila et al.[37]	13
Family Clostridium cluster XIV	Reverse	16S	CTTTGAGTTTCATTCTTGCGAA	894	413	Matsuki et al.[42]	13
Phylum Bacteroidetes	Forward	16S	CCGGAWTYATTGGGTTTAAAGGG	554	414	Mühling et al.[33]	1
Phylum Bacteroidetes	Reverse	16S	GGTAAGGTTCCTCGCGTA	967	414	Mühling et al.[33]	1
Genus Bacteroides	Forward	16S	AAGGTCCCCCACATTGG	302	300	Manz et al.[43]	1
Genus Bacteroides	Reverse	16S	GAGCCGCAAACTTTCACAA	601	300	Franks et al.[44]	1
Phylum Actinobacteria	Forward	16S	GCGKCCTATCAGCTTGTT	235	333	Modified from Glockner et al.[45] first published. They refer to Erhart [46]	2
Phylum Actinobacteria	Reverse	16S	CCGCCTACGAGCYCTTTACGC	567	333	This study, ClustalW2 [36]	2
Family Bifidobacteriaceae	Forward	16S	CTCCTGGAAACGGGTGG	152	442	Matsuki et al.[42]	2
Family Bifidobacteriaceae	Reverse	16S	CTTTCACACCRGACGCG	593	442	Delroisse et al.[47]	2
Class β- and γ-proteobacteria	Forward	23S	GTATAATGGGTCAGCGAC	569	673	This study, Linux ARB [13]	8
Class β- and γ-proteobacteria	Reverse	23S	CAGCATTCGCACTTCTGA	1241	673	This study, Linux ARB [13]	8
Family Enterobacteriacea	Forward	16S	CGTCGCAAGMMCAAAGAG	182	333	Modified from Friedrich et al.[48]	8
Family Enterobacteriacea	Reverse	16S	TTACCGCGGCTGCTGGCAC	514	333	Modified from Palmer et al.[49]	8
Species Escherichia coli	Forward	16S	GTTAATACCTTTGCTCATTGA	461	320	Malinen et al.[50]	8
Species Escherichia coli	Reverse	16S	ACCAGGGTATCTAATCCTGTT	780	320	Malinen et al.[50]	8
Class ϵ-proteobacteria	Forward	16S	TGGTGTAGGGGTAAAATCCG	680	286	Bui et al.[51]	5
Class ϵ-proteobacteria	Reverse	16S	AGGTAAGGTTCTTCGYGTATC	965	286	This study, Primrose [14]	5
Class δ-proteobacteria	Forward	16S	GGTGTAGGAGTGAARTCCGT	681	534	This study, Primrose [14]	3
Class δ-proteobacteria	Reverse	16S	TACGTGTGTAGCCCTRGRC	1214	534	This study, Primrose [14]	3
Phylum Fusobacteria	Forward	16S	GATCCAGCAATTCTGTGTGC	387	292	Sanguin et al.[52]	10
Phylum Fusobacteria	Reverse	16S	CGAATTTCACCTCTACACTTGT	678	292	Walter et al.[53]	10
Phylum Verrucomicrobia	Forward	16S	GAATTCTCGGTGTAGCA	673	551	Modified from Ranjan [54]	15
Phylum Verrucomicrobia	Reverse	16S	GGCATTGTAGTACGTGTGCA	1223	551	This study, Primrose [14]	15
Phylum Spirochaetes	Forward	16S	GTYTTAAGCATGCAAGTC	45	294	Choi et al.[55]	4
Phylum Spirochaetes	Reverse	16S	TGCTGCCTCCCGTAGGAG	338	294	This study, ClustalW2 [36]	4
Domain Archaea	Forward	16S	CAGCMGCCGCGGTAATWC	518	440	Giovannoni et al.[56]	12
Domain Archaea	Reverse	16S	YCCGGCGTTGAMTCCAATT	957	440	Delong [57]	12

Reference bacteria listed are target for the respective primer sets. Numbers represent: 1: Bacteroides fragilis (DJF_B083(EU728706)), 2: Bifidobacterium pseudolongum globosum (DMS 20092), 3: Bilophila wadsworthia (ATCC 49260), 4: Brachyspira pilosicoli (isolated from the intestine of slaughter pig at DTU-VET, 28-02-2000), 5: Campylobacter fetus (ATTC 10852), 6: Clostridium perfringens (NCTC 10240), 7: Enterococcus faecalis (ATCC 29212), 8: Escherichia coli (9711108–2), 9: Faecalibacterium prausnitzii (DSM 17677), 10: Fusobacterium Necrophorum (ATCC 25286), 11: Lactobacillus sakei (DSM 20017), 12: Methanocorpusculum labreanum (DSM 4855), 13: Roseburia sp. (DJF_VR77(EU728794)), 14: Streptococcus suis (NCTC 10446), and 15: Verrucomicrobium spinosum (DSM 4136). Nucleotide explanation: Y, C/T ; R, A/G ; W, A/T ; K, G/T ; M, A/C.
*To improve coverage of the Genus Enterococcus, two reverse primers were mixed in equal concentrations.

Back to article page

ISSN: 1471-2164

Contact us

Submission enquiries: bmcgenomics@biomedcentral.com
General enquiries: ORSupport@springernature.com

BMC Genomics

Contact us