From biomedicine to natural history research: EST resources for ambystomatid salamanders

  • Srikrishna Putta1Email author,

    Affiliated with

    • Jeramiah J Smith1Email author,

      Affiliated with

      • John A Walker1Email author,

        Affiliated with

        • Mathieu Rondet2,

          Affiliated with

          • David W Weisrock1,

            Affiliated with

            • James Monaghan1,

              Affiliated with

              • Amy K Samuels1,

                Affiliated with

                • Kevin Kump1,

                  Affiliated with

                  • David C King3,

                    Affiliated with

                    • Nicholas J Maness4,

                      Affiliated with

                      • Bianca Habermann5,

                        Affiliated with

                        • Elly Tanaka6,

                          Affiliated with

                          • Susan V Bryant2,

                            Affiliated with

                            • David M Gardiner2,

                              Affiliated with

                              • David M Parichy7 and

                                Affiliated with

                                • S Randal Voss1Email author

                                  Affiliated with

                                  BMC Genomics20045:54

                                  DOI: 10.1186/1471-2164-5-54

                                  Received: 19 July 2004

                                  Accepted: 13 August 2004

                                  Published: 13 August 2004

                                  Abstract

                                  Background

                                  Establishing genomic resources for closely related species will provide comparative insights that are crucial for understanding diversity and variability at multiple levels of biological organization. We developed ESTs for Mexican axolotl (Ambystoma mexicanum) and Eastern tiger salamander (A. tigrinum tigrinum), species with deep and diverse research histories.

                                  Results

                                  Approximately 40,000 quality cDNA sequences were isolated for these species from various tissues, including regenerating limb and tail. These sequences and an existing set of 16,030 cDNA sequences forA. mexicanumwere processed to yield 35,413 and 20,599 high quality ESTs forA. mexicanumandA. t. tigrinum, respectively. Because theA. t. tigrinumESTs were obtained primarily from a normalized library, an approximately equal number of contigs were obtained for each species, with 21,091 unique contigs identified overall. The 10,592 contigs that showed significant similarity to sequences from the human RefSeq database reflected a diverse array of molecular functions and biological processes, with many corresponding to genes expressed during spinal cord injury in rat and fin regeneration in zebrafish. To demonstrate the utility of these EST resources, we searched databases to identify probes for regeneration research, characterized intra- and interspecific nucleotide polymorphism, saturated a human –Ambystomasynteny group with marker loci, and extended PCR primer sets designed forA. mexicanum/A. t. tigrinumorthologues to a related tiger salamander species.

                                  Conclusions

                                  Our study highlights the value of developing resources in traditional model systems where the likelihood of information transfer to multiple, closely related taxa is high, thus simultaneously enabling both laboratory and natural history research.

                                  Background

                                  Establishing genomic resources for closely related species will provide comparative insights that are crucial for understanding diversity and variability at multiple levels of biological organization. Expressed sequence tags (EST) are particularly useful genomic resources because they enable multiple lines of research and can be generated for any organism: ESTs allow the identification of molecular probes for developmental studies, provide clones for DNA microchip construction, reveal candidate genes for mutant phenotypes, and facilitate studies of genome structure and evolution. Furthermore, ESTs provide raw material from which strain-specific polymorphisms can be identified for use in population and quantitative genetic analyses. The utility of such resources can be tailored to target novel characteristics of organisms when ESTs are isolated from cell types and tissues that are actively being used by a particular research community, so as to bias the collection of sequences towards genes of special interest. Finally, EST resources produced for model organisms can greatly facilitate comparative and evolutionary studies when their uses are extended to other, closely related taxa.

                                  Salamanders (urodele amphibians) are traditional model organisms whose popularity was unsurpassed early in the 20thcentury. At their pinnacle, salamanders were the primary model for early vertebrate development. Embryological studies in particular revealed many basic mechanisms of development, including organizer and inducer regions of developing embryos [1]. Salamanders continue to be important vertebrate model organisms for regeneration because they have by far the greatest capacity to regenerate complex body parts in the adult phase. In contrast to mammals, which are not able to regenerate entire structures or organ systems upon injury or amputation, adult salamanders regenerate their limbs, tail, lens, retina, spinal cord, heart musculature, and jaw [27]. In addition, salamanders are the model of choice in a diversity of areas, including vision, embryogenesis, heart development, olfaction, chromosome structure, evolution, ecology, science education, and conservation biology [815]. All of these disciplines are in need of genomic resources as fewer than 4100 salamander nucleotide sequences had been deposited in GenBank as of 3/10/04.

                                  Here we describe results from an EST project for two ambystomatid salamanders: the Mexican axolotl,Ambystoma mexicanumand the eastern tiger salamander,A. tigrinum tigrinum. These two species are members of the Tiger Salamander Complex [16], a group of closely related species and subspecies that are widely distributed in North America. Phylogenetic reconstruction suggests that these species probably arose from a common ancestor about 10–15 million years ago [16].Ambystoma mexicanumhas a long research history of over 100 years and is now principally supplied to the research community by the Axolotl Colony [17], whileA. t. tigrinumis obtained from natural populations in the eastern United States. Although closely related with equally large genomes (32 × 109bp)[18], these two species and others of the Complex differ dramatically in life history:A. mexicanumis a paedomorphic species that retains many larval features and lives in water throughout it's life cycle whileA. t. tigrinumundergoes a metamorphosis that is typical of many amphibians. Like many other traditional model organisms of the last century, interest in these two species declined during the rise of genetic models like the fly, zebrafish, and mouse [19]. However, "early" model organisms such as salamanders are beginning to re-attract attention as genome resources can rapidly be developed to exploit the unique features that originally identified their utility for research. We make this point below by showing how the development of ESTs for these two species is enabling research in several areas. Furthermore, we emphasize the value of developing resources in model systems where the likelihood of information transfer to multiple, closely related taxa is high, thus simultaneously enabling both laboratory and natural history research programs.

                                  Results and Discussion

                                  Selection of libraries for EST sequencing

                                  Eleven cDNA libraries were constructed using a variety of tissues (Table1). Pilot sequencing of randomly selected clones revealed that the majority of the non-normalized libraries were moderate to highly redundant for relatively few transcripts. For example, hemoglobin-like transcripts represented 15–25% of the sampled clones from cDNA libraries V1, V2, and V6. Accordingly, we chose to focus our sequencing efforts on the non-normalized MATH library as well as the normalized AG library, which had lower levels of redundancy (5.5 and 0.25% globins, respectively). By concentrating our sequencing efforts on these two libraries we obtained transcripts deriving primarily from regenerating larval tissues inA. mexicanumand several non-regenerating larval tissues inA. t. tigrinum.
                                  Table 1

                                  Tissues selected to make cDNA libraries.

                                  ID

                                  Tissue

                                  cDNAs sequenced

                                  GARD

                                  limb blastema

                                  1029

                                  MATH

                                  limb blastema

                                  16244

                                  V1

                                  tail blastema

                                  1422

                                  V2

                                  brain

                                  3196

                                  V3

                                  liver

                                  792

                                  V4

                                  spleen

                                  337

                                  V5

                                  heart

                                  38

                                  V6

                                  gill

                                  3039

                                  V7

                                  stage 22 embryo

                                  96

                                  AG

                                  liver, gonad, lung, kidney, heart, gill

                                  19871

                                  Further information is found in Methods and Materials.

                                  EST sequencing and clustering

                                  A total of 46,064 cDNA clones were sequenced, yielding 39,982 high quality sequences forA. mexicanumandA. t. tigrinum(Table2). Of these, 3,745 corresponded to mtDNA and were removed from the dataset; complete mtDNA genome data for these and other ambystomatid species will be reported elsewhere. The remaining nuclear ESTs for each species were clustered and assembled separately. We included in ourA. mexicanumassembly an additional 16,030 high quality ESTs that were generated recently for regenerating tail and neurula stage embryos [20]. Thus, a total of 32,891 and 19,376 ESTs were clustered forA. mexicanumandA. t. tigrinum, respectively. Using PaCE clustering and CAP3 assembly, a similar number of EST clusters and contigs were identified for each species (Table2). Overall contig totals were 11,190 and 9,901 forA. mexicanumandA. t. tigrinumrespectively. Thus, although 13,515 moreA. mexicanumESTs were assembled, a roughly equivalent number of contigs were obtained for both species. This indicates that EST development was more efficient forA. t. tigrinum,presumably because ESTs were obtained primarily from the normalized AG library; indeed, there were approximately twice as many ESTs on average perA. mexicanumcontig (Table2). Thus, our EST project yielded an approximately equivalent number of contigs forA. mexicanumandA. t. tigrinum, and overall we identified > 21,000 different contigs. Assuming that 20% of the contigs correspond to redundant loci, which has been found generally in large EST projects [21], we identified transcripts for approximately 17,000 different ambystomatid loci. If ambystomatid salamanders have approximately the same number of loci as other vertebrates (e.g. [22]), we have isolated roughly half the expected number of genes in the genome.
                                  Table 2

                                  EST summary and assembly results.

                                   

                                  A. mex

                                  A. t. tig

                                  cDNA clones sequenced

                                  21830

                                  24234

                                  high-quality sequences

                                  19383

                                  20599

                                  mt DNA sequence

                                  2522

                                  1223

                                  seqs submitted to NCBI

                                  16861

                                  19376

                                  sequences assembled

                                  32891a

                                  19376

                                  PaCE clusters

                                  11381

                                  10226

                                  ESTs in contigs

                                  25457

                                  12676

                                  contigs

                                  3756

                                  3201

                                  singlets

                                  7434

                                  6700

                                  putative transcripts

                                  11190

                                  9901

                                  aIncludes 16,030 ESTs from [20].

                                  Identification of vertebrate sequences similar toAmbystomacontigs

                                  We searched all contigs against several vertebrate databases to identify sequences that exhibited significant sequence similarity. As our objective was to reliably annotate as many contigs as possible, we first searched against 19,804 sequences in the NCBI human RefSeq database (Figure1), which is actively reviewed and curated by biologists. This search revealed 5619 and 4973 "best hit" matches for theA. mexicanumandA. t. tigrinumEST datasets at a BLASTX threshold ofE= 10-7. The majority of contigs were supported at more stringent E-value thresholds (Table3). Non-matching contigs were subsequently searched against the Non-Redundant (nr) Protein database andXenopus tropicalusandX. laevisUNIGENE ESTs (Figure1). These later two searches yielded a few hundred more 'best hit' matches, however a relatively large number of ESTs from both ambystomatid species were not similar to any sequences from the databases above. Presumably, these non-matching sequences were obtained from the non-coding regions of transcripts or they contain protein-coding sequences that are novel to salamander. Although the majority are probably of the former type, we did identify 3,273 sequences from the non-matching set that had open reading frames (ORFs) of at least 200 bp, and 911 of these were greater than 300 bp.
                                  http://static-content.springer.com/image/art%3A10.1186%2F1471-2164-5-54/MediaObjects/12864_2004_Article_156_Fig1_HTML.jpg
                                  Figure 1

                                  Results of BLASTX and TBLASTX searches to identify best BLAST hits for Ambystoma contigs searched against NCBI human RefSeq, nr, and Xenopus Unigene databases.

                                  Table 3

                                  Ambystomacontig search of NCBI human RefSeq, nr, andXenopusUnigene databases.

                                   

                                  A. mex

                                  A. t. tig

                                  # BLASTX Best Matches

                                  6283

                                  5545

                                  < E-100

                                  630

                                  870

                                  < E-50> E-100

                                  2015

                                  1990

                                  < E-20> E-50

                                  2153

                                  1595

                                  < E-10> E-20

                                  967

                                  745

                                  < E-7> E-10

                                  518

                                  345

                                  The distribution of ESTs among contigs can provide perspective on gene expression when clones are randomly sequenced from non-normalized cDNA libraries. In general, frequently sampled transcripts may be expressed at higher levels. We identified the 20 contigs fromA. mexicanumandA. t. tigrinumthat contained the most assembled ESTs (Table4). The largestA. t. tigrinumcontigs contained fewer ESTs than the largestA. mexicanumcontigs, probably because fewer overallA. t. tigrinumclones were sequenced, with the majority selected from a normalized library. However, we note that the contig with the most ESTs was identified forA. t. tigrinum:delta globin. In both species, transcripts corresponding to globin genes were sampled more frequently than all other loci. This may reflect the fact that amphibians, unlike mammals, have nucleated red blood cells that are transcriptionally active. In addition to globin transcripts, a few other house-keeping genes were identified in common from both species, however the majority of the contigs were unique to each list. Overall, the strategy of sequencing cDNAs from a diverse collection of tissues (from normalized and non-normalized libraries) yielded different sets of highly redundant contigs. Only 25% and 28% of theA. mexicanumandA. t. tigrinumcontigs, respectively, were identified in common (Figure2). We also note that several hundred contigs were identified in common between Xenopus andAmbystoma; this will help facilitate comparative studies among these amphibian models.
                                  Table 4

                                  Top 20 contigs with the most assembled ESTs.

                                  Contig ID

                                  # ESTs

                                  Best Human Match

                                  E-value

                                  MexCluster_4615_Contig1

                                  415

                                  (NM_000519) delta globin

                                  E-39

                                  MexCluster_600_Contig1

                                  354

                                  (NM_182985) ring finger protein 36 isoform a

                                  E-110

                                  MexCluster_6279_Contig1

                                  337

                                  (NM_000559) A-gamma globin

                                  E-32

                                  MexCluster_10867_Contig1

                                  320

                                  (NM_000558) alpha 1 globin

                                  E-38

                                  MexCluster_5357_Contig1

                                  307

                                  (NM_000558) alpha 1 globin

                                  E-37

                                  MexCluster_9285_Contig3

                                  285

                                  (NM_001614) actin, gamma 1 propeptide

                                  0

                                  MexCluster_7987_Contig3

                                  252

                                  (NM_001402) eukaryotic translation elongation f1

                                  0

                                  MexCluster_9285_Contig1

                                  240

                                  (NM_001101) beta actin; beta cytoskeletal actin

                                  0

                                  MexCluster_9279_Contig3

                                  218

                                  (NM_000223) keratin 12

                                  E-113

                                  MexCluster_11203_Contig1

                                  181

                                  (NM_002032) ferritin, heavy polypeptide 1

                                  E-70

                                  MexCluster_8737_Contig2

                                  152

                                  (NM_058242) keratin 6C

                                  E-131

                                  MexCluster_3193_Contig1

                                  145

                                  (NM_004499) heterogeneous nuclear ribonucleoprotein

                                  E-90

                                  MexCluster_8737_Contig7

                                  134

                                  (NM_058242) keratin 6C

                                  E-131

                                  MexCluster_5005_Contig3

                                  132

                                  (NM_031263) heterogeneous nuclear ribonucleoprotein

                                  E-124

                                  MexCluster_6225_Contig1

                                  125

                                  (NM_001152) solute carrier family 25, member 5

                                  E-151

                                  MexCluster_1066_Contig1

                                  122

                                  [31015660] IMAGE:6953586

                                  E-16

                                  MexCluster_8737_Contig4

                                  114

                                  (NM_058242) keratin 6C; keratin, epidermal type II

                                  E-132

                                  MexCluster_8187_Contig2

                                  113

                                  (NM_005507) cofilin 1 (non-muscle)

                                  E-65

                                  MexCluster_2761_Contig1

                                  109

                                  (NM_001961) eukaryotic translation elongation factor2

                                  0

                                  MexCluster_9187_Contig1

                                  105

                                  (NM_007355) heat shock 90 kDa protein 1, beta

                                  0

                                  A. t. tigrinum

                                     

                                  TigCluster_6298_Contig1

                                  654

                                  (NM_000519) delta globin

                                  E-38

                                  TigCluster_10099_Contig2

                                  193

                                  (NM_001614) actin, gamma 1 propeptide

                                  0

                                  TigCluster_6470_Contig1

                                  167

                                  (NM_000558) alpha 1 globin

                                  E-39

                                  TigCluster_9728_Contig2

                                  142

                                  (NM_000477) albumin precursor

                                  E-140

                                  TigCluster_6594_Contig1

                                  117

                                  (NM_001402) eukaryotic translation elongation f1

                                  0

                                  TigCluster_5960_Contig1

                                  91

                                  (NM_001101) beta actin; beta cytoskeletal actin

                                  0

                                  TigCluster_7383_Contig1

                                  77

                                  (NM_001614) actin, gamma 1 propeptide

                                  0

                                  TigCluster_6645_Contig1

                                  76

                                  (NM_001063) transferrin

                                  0

                                  TigCluster_7226_Contig4

                                  74

                                  (NM_006009) tubulin, alpha 3

                                  E-160

                                  TigCluster_7191_Contig1

                                  67

                                  (NM_019016) keratin 24

                                  E-89

                                  TigCluster_10121_Contig1

                                  64

                                  (NM_005141) fibrinogen, beta chain preproprotein

                                  0

                                  TigCluster_6705_Contig1

                                  63

                                  (NM_000558) alpha 1 globin

                                  E-39

                                  TigCluster_7854_Contig1

                                  62

                                  (NM_021870) fibrinogen, gamma chain isoform

                                  E-121

                                  TigCluster_6139_Contig1

                                  52

                                  (NM_001404) eukaryotic translation elongation f1

                                  0

                                  TigCluster_7226_Contig2

                                  51

                                  (NM_006009) tubulin, alpha 3

                                  0

                                  TigCluster_10231_Contig1

                                  44

                                  (NM_003018) surfactant, pulmonary-associated prot.

                                  E-08

                                  TigCluster_6619_Contig1

                                  36

                                  (NM_000041) apolipoprotein E

                                  E-38

                                  TigCluster_7232_Contig2

                                  35

                                  (NM_003651) cold shock domain protein A

                                  E-46

                                  TigCluster_5768_Contig1

                                  34

                                  (NM_003380) vimentin

                                  E-177

                                  TigCluster_9784_Contig3

                                  32

                                  |XP_218445.1| similar to RIKEN cDNA 1810065E05

                                  E-15

                                  http://static-content.springer.com/image/art%3A10.1186%2F1471-2164-5-54/MediaObjects/12864_2004_Article_156_Fig2_HTML.jpg
                                  Figure 2

                                  Venn diagram of BLAST comparisons among amphibian EST projects.Values provided are numbers of reciprocal best BLAST hits (E<10-20) among quality maskedA. mexicanumandA. t. tigrinumassemblies and a publicly availableX. tropicalisEST assemblyhttp://​www.​sanger.​ac.​uk/​Projects/​X_​tropicalis

                                  Functional annotation

                                  For the 10,592 contigs that showed significant similarity to sequences from the human RefSeq database, we obtained Gene Ontology (23) information to describe ESTs in functional terms. Although there are hundreds of possible annotations, we chose a list of descriptors for molecular and biological processes that we believe are of interest for research programs currently utilizing salamanders as model organisms (Table5). In all searches, we counted each match between a contig and a RefSeq sequence as identifying a different ambystomatid gene, even when different contigs matched the same RefSeq reference. In almost all cases, approximately the same number of matches was found per functional descriptor for both species. This was not simply because the same loci were being identified for both species, as only 20% of the total number of searched contigs shared sufficient identity (BLASTN;E<10-80orE<10-20) to be potential homologues. In this sense, the sequencing effort between these two species was complementary in yielding a more diverse collection of ESTs that were highly similar to human gene sequences.
                                  Table 5

                                  Functional annotation of contigs

                                   

                                  A. mex

                                  A. t. tig

                                  Molecular Function (0016209)

                                    

                                  antioxidant (0016209)

                                  25

                                  29

                                  binding (0005488)

                                  3117

                                  2578

                                  chaparone (0003754)

                                  100

                                  85

                                  enzyme regulation (003023)

                                  193

                                  223

                                  motor (0003774)

                                  73

                                  75

                                  signal transduction (0004871)

                                  344

                                  375

                                  structural protein (0005198)

                                  501

                                  411

                                  transcriptional reg. (0030528)

                                  296

                                  221

                                  translational reg. (0045182)

                                  94

                                  59

                                  bone remodeling (0046849)

                                  8

                                  8

                                  circulation (0008015)

                                  23

                                  78

                                  immune response (000695)

                                  182

                                  263

                                  respiratory ex. (0009605)

                                  254

                                  288

                                  respiratory in. (0009719)

                                  72

                                  58

                                  stress (0006950)

                                  263

                                  320

                                  Biological Process (0008150)

                                    

                                  Cellular (0009987)

                                    

                                  activation (0001775)

                                  4

                                  6

                                  aging and death (0008219)

                                  158

                                  148

                                  communication (0007154)

                                  701

                                  696

                                  differentiation (0030154)

                                  31

                                  20

                                  extracellular mat. (0043062)

                                  4

                                  4

                                  growth and main. (0008151)

                                  1731

                                  1445

                                  migration (0016477)

                                  8

                                  14

                                  motility (0006928)

                                  163

                                  154

                                  Developmental (0007275)

                                    

                                  aging (0007568)

                                  32

                                  21

                                  embryonic (0009790)

                                  6

                                  1

                                  growth (0040007)

                                  2

                                  2

                                  morphogenesis (0009653)

                                  350

                                  272

                                  pigment (0048066)

                                  13

                                  26

                                  post embryonic (0009791)

                                  8

                                  13

                                  reproduction (0000003)

                                  42

                                  27

                                  Physiological (0007582)

                                    

                                  coagulation (0050817)

                                  22

                                  73

                                  death and aging (0016265)

                                  159

                                  148

                                  homeostasis (0042592)

                                  22

                                  27

                                  metabolism (0008152)

                                  3059

                                  2513

                                  secretion (0046903)

                                  9

                                  16

                                  sex differentiation (0007548)

                                  3

                                  2

                                  Numbers in parentheses reference GO numbers [23].

                                  Informatic searches for regeneration probes

                                  The value of a salamander model to regeneration research will ultimately rest on the ease in which data and results can be cross-referenced to other vertebrate models. For example, differences in the ability of mammals and salamanders to regenerate spinal cord may reflect differences in the way cells of the ependymal layer respond to injury. As is observed in salamanders, ependymal cells in adult mammals also proliferate and differentiate after spinal cord injury (SCI) [24,25]; immediately after contusion injury in adult rat, ependymal cell numbers increase and proliferation continues for at least 4 days [[26]; but see [27]]. Rat ependymal cells share some of the same gene expression and protein properties of embryonic stem cells [28], however no new neurons have been observed to derive from these cellsin vivoafter SCI [29]. Thus, although endogenous neural progenitors of the ependymal layer may have latent regenerative potential in adult mammals, this potential is not realized. Several recently completed microarray analyses of spinal cord injury in rat now make it possible to cross-reference information between amphibians and mammals. For example, we searched the complete list of significantly up and down regulated genes from Carmel et al. [30] and Song et al. [31] against allAmbystomaESTs. Based upon amino acid sequence similarity of translated ESTs (TBLASTX;E<10-7), we identified DNA sequences corresponding to 69 of these 164 SCI rat genes (Table6). It is likely that we have sequence corresponding to other presumptive orthologues from this list as many of our ESTs only contain a portion of the coding sequence or the untranslated regions (UTR), and in many cases our searches identified closely related gene family members. Thus, many of the genes that show interesting expression patterns after SCI in rat can now be examined in salamander.
                                  Table 6

                                  Ambystomacontigs that show sequence similarity to rat spinal cord injury genes.

                                  Ambystoma Contig ID

                                  RAT cDNA clone

                                  E-value

                                  MexCluster_7440_Contig1

                                  gi|1150557|c-myc, exon 2

                                  E-29

                                  MexCluster_4624_Contig1

                                  gi|1468968| brain acyl-CoA synthtase II

                                  E-09

                                  TigCluster_4083_Contig1

                                   

                                  E-09

                                  TigSingletonClusters_Salamander_4_G20_ab1

                                  gi|1552375| SKR6 gene, a CB1 cannabinoid recept.

                                  E-08

                                  MexSingletonClusters_NT009B_B04

                                  gi|17352488| cyclin ania-6a

                                  E-46

                                  TigCluster_3719_Contig1

                                   

                                  E-114

                                  TigCluster_8423_Contig1

                                  gi|1778068| binding zyginI

                                  E-102

                                  TigCluster_7064_Contig1

                                  gi|1836160| Ca2+/calmodulin-dependent

                                  E-20

                                  MexCluster_3225_Contig1

                                  gi|1906612| Rattus norvegicus CXC chemokine

                                  E-68

                                  TigSingletonClusters_Salamander_13_F03_ab1

                                   

                                  E-38

                                  MexSingletonClusters_BL285B_A06

                                  gi|203042| (Na+, K+)-ATPase-beta-2 subunit

                                  E-63

                                  TigCluster_6994_Contig1

                                   

                                  E-65

                                  MexSingletonClusters_BL014B_F12

                                  gi|203048| plasma membrane Ca2+ ATPase-isoform 2

                                  E-112

                                  TigSingletonClusters_Salamander_5_F07_ab1

                                   

                                  E-92

                                  MexCluster_1251_Contig1

                                  gi|203167| GTP-binding protein (G-alpha-i1)

                                  E-110

                                  TigSingletonClusters_Salamander_3_P14_ab1

                                   

                                  E-152

                                  TigSingletonClusters_Salamander_22_B01_ab1

                                  gi|203336| catechol-O-methyltransferase

                                  E-47

                                  TigSingletonClusters_Salamander_17_N04_ab1

                                  gi|203467| voltage-gated K+ channel protein (RK5)

                                  E-08

                                  MexSingletonClusters_v1_p8_c16_triplex5ld_

                                  gi|203583| cytosolic retinol-binding protein (CRBP)

                                  E-77

                                  TigCluster_6321_Contig1

                                   

                                  E-18

                                  MexCluster_5399_Contig1

                                  gi|204647| heme oxygenase gene

                                  E-67

                                  TigCluster_2577_Contig1

                                   

                                  E-67

                                  MexCluster_4647_Contig1

                                  gi|204664| heat shock protein 27 (Hsp27)

                                  E-83

                                  TigSingletonClusters_Salamander_12_M05_ab1

                                   

                                  E-51

                                  MexSingletonClusters_BL285C_F02

                                  gi|205404| metabotropic glutamate receptor 3

                                  E-41

                                  TigSingletonClusters_Salamander_2_B24_ab1

                                  gi|205508| myelin/oligodendrocyte glycoprotein

                                  E-26

                                  TigCluster_5740_V2_p10_M20_TriplEx5ld_

                                  gi|205531| metallothionein-2 and metallothionein 1

                                  E-08

                                  TigSingletonClusters_V2_p5_A2_TriplEx5ld_

                                  gi|205537| microtubule-associated protein 1A

                                  E-59

                                  MexCluster_1645_Contig1

                                  gi|205633| Na, K-ATPase alpha-2 subunit

                                  E-149

                                  TigSingletonClusters_Contig328

                                   

                                  0

                                  TigSingletonClusters_Contig45

                                  gi|205683| smallest neurofilament protein (NF-L)

                                  E-63

                                  MexSingletonClusters_NT016A_A09

                                  gi|205693| nerve growth factor-induced (NGFI-A)

                                  E-95

                                  TigSingletonClusters_I09_Ag2_p9_K24_M13R

                                   

                                  E-24

                                  MexSingletonClusters_NT007A_E07

                                  gi|205754| neuronal protein (NP25)

                                  E-64

                                  TigCluster_7148_Contig1

                                   

                                  E-57

                                  MexCluster_9504_Contig1

                                  gi|206161| peripheral-type benzodiazepine receptor

                                  E-73

                                  MexSingletonClusters_BL016B_B02

                                  gi|206166| protein kinase C type III

                                  E-36

                                  TigCluster_981_Contig1

                                   

                                  E-27

                                  MexSingletonClusters_nm_19_k3_t3_

                                  gi|206170| brain type II Ca2+/calmodulin-dependent

                                  E-117

                                  MexSingletonClusters_v11_p42_j20_t3_049_ab1 gi|207138| norvegicus syntaxin B

                                   

                                  1e-079

                                  MexSingletonClusters_nm_14_h19_t3_

                                  gi|207473| neural receptor protein-tyrosine kinase

                                  E-40

                                  TigSingletonClusters_Contig336

                                   

                                  E-34

                                  TigSingletonClusters_E10_Ag2_p18_O19_M13

                                  gi|2116627| SNAP-25A

                                  E-123

                                  MexCluster_211_Contig1

                                  gi|220713| calcineurin A alpha

                                  E-63

                                  TigSingletonClusters_Salamander_7_K14_ab1

                                   

                                  E-87

                                  MexSingletonClusters_NT014A_G03

                                  gi|220839| platelet-derived growth factor A chain

                                  E-21

                                  TigSingletonClusters_Salamander_9_M15_ab1

                                   

                                  E-56

                                  TigSingletonClusters_Salamander_19_M06_ab1

                                  gi|2501807| brain digoxin carrier protein

                                  E-55

                                  MexSingletonClusters_Contig100

                                  gi|2746069| MAP-kinase phosphatase (cpg21)

                                  E-108

                                  TigSingletonClusters_Salamander_11_A16_ab1

                                   

                                  E-70

                                  MexCluster_8345_Contig1

                                  gi|2832312| survival motor neuron (smn)

                                  E-40

                                  TigCluster_8032_Contig1

                                   

                                  E-49

                                  MexCluster_3580_Contig1

                                  gi|294567| heat shock protein 70 (HSP70)

                                  0

                                  TigCluster_8592_Contig2

                                   

                                  E-161

                                  TigSingletonClusters_Salamander_17_N08_ab1

                                  gi|2961528| carboxyl-terminal PDZ

                                  E-10

                                  MexSingletonClusters_BL286C_D09

                                  gi|298325| sodium-dependent neurotransmitter tran.

                                  E-12

                                  TigSingletonClusters_Contig95

                                   

                                  E-22

                                  MexSingletonClusters_Contig461

                                  gi|2996031| brain finger protein (BFP)

                                  E-08

                                  TigSingletonClusters_Salamander_11_O19_ab1

                                   

                                  E-23

                                  TigSingletonClusters_E16_Ag2_p8_O20_M13R

                                  gi|3135196| Ca2+/calmodulin-dependent

                                  E-33

                                  MexSingletonClusters_Contig188

                                  gi|3252500| CC chemokine receptor protein

                                  E-15

                                  MexCluster_6961_Contig1

                                  gi|3319323| suppressor of cytokine signaling-3

                                  E-08

                                  MexSingletonClusters_nm_14_p15_t3_

                                  gi|349552| P-selectin

                                  E-16

                                  TigCluster_218_Contig2

                                   

                                  E-99

                                  MexSingletonClusters_Contig506

                                  gi|3707306| Normalized rat embryo, cDNA clone

                                  E-14

                                  TigSingletonClusters_I16_Ag2_p5_N7_M13R

                                  gi|3711670| Normalized rat muscle, cDNA clone

                                  E-35

                                  MexSingletonClusters_V1_p1_a10_Triplex5Ld

                                  gi|3727094| Normalized rat ovary, cDNA clone

                                  E-15

                                  TigSingletonClusters_v2_p1_D20_triplex5ld

                                   

                                  E-16

                                  MexSingletonClusters_NT005B_F02

                                  gi|3811504| Normalized rat brain, cDNA clone

                                  E-35

                                  TigSingletonClusters_Salamander_22_I04_ab1

                                   

                                  E-34

                                  TigSingletonClusters_Ag2_p34_N23_M13R

                                  gi|405556| adenylyl cyclase-activated serotonin

                                  E-17

                                  TigSingletonClusters_Salamander_1_H02_ab1

                                  gi|4103371| putative potassium channel TWIK

                                  E-22

                                  MexCluster_4589_Contig1

                                  gi|4135567| Normalized rat embryo, cDNA clone

                                  E-32

                                  TigSingletonClusters_Contig220

                                   

                                  E-09

                                  TigCluster_4093_Contig1

                                  gi|4228395| cDNA clone UI-R-A0-bc-h-02-0-UI

                                  E-104

                                  MexSingletonClusters_nm_21_2_m7_t3_

                                  gi|425471| nuclear factor kappa B p105 subunit

                                  E-22

                                  TigCluster_8535_Contig1

                                   

                                  E-11

                                  MexSingletonClusters_v6_p1_j6_triplex5_1ld_

                                  gi|430718| Sprague Dawley inducible nitric oxide

                                  E-13

                                  TigSingletonClusters_Salamander_15_D22_ab1

                                   

                                  E-41

                                  MexCluster_3498_Contig1

                                  gi|436934| Sprague Dawley protein kinase C rec.

                                  0

                                  TigCluster_6648_Contig1

                                   

                                  0

                                  MexSingletonClusters_BL279A_B12

                                  gi|464196| phosphodiesterase I

                                  E-49

                                  TigSingletonClusters_Salamander_25_P03_ab1

                                   

                                  E-75

                                  MexCluster_8708_Contig1

                                  gi|466438| 40kDa ribosomal protein

                                  E-168

                                  TigCluster_5877_Contig1

                                   

                                  E-168

                                  MexSingletonClusters_nm_14_a9_t3_

                                  gi|493208| stress activated protein kinase alpha II

                                  E-51

                                  TigSingletonClusters_Salamander_11_A13_ab1

                                  gi|517393| tau microtubule-associated protein

                                  E-44

                                  TigSingletonClusters_Salamander_12_J14_ab1

                                  gi|55933| c-fos

                                  E-26

                                  MexSingletonClusters_nm_21_2_l13_t3_

                                  gi|56822| major synaptic vesicel protein p38

                                  E-39

                                  TigCluster_2065_Contig1

                                   

                                  E-50

                                  MexCluster_10965_Contig1

                                  gi|56828| nuclear oncoprotein p53

                                  E-75

                                  TigCluster_5315_Contig1

                                   

                                  E-66

                                  MexCluster_4245_Contig1

                                  gi|56909| pJunB gene

                                  E-50

                                  TigSingletonClusters_G05_Ag2_p9_G8_M13R

                                   

                                  E-09

                                  MexSingletonClusters_NT013D_C12

                                  gi|56919| region fragment for protein kinase C

                                  E-33

                                  TigSingletonClusters_Salamander_21_H19_ab1

                                   

                                  E-24

                                  MexCluster_9585_Contig1

                                  gi|57007| ras-related mRNA rab3

                                  E-61

                                  TigCluster_4885_Contig1

                                   

                                  E-63

                                  TigSingletonClusters_Salamander_1_M03_ab1

                                  gi|57238| silencer factor B

                                  E-13

                                  MexSingletonClusters_NT008B_D05

                                  gi|57341| transforming growth factor-beta 1

                                  E-13

                                  TigSingletonClusters_Salamander_24_I16_ab1

                                   

                                  E-20

                                  MexCluster_9533_Contig1

                                  gi|57479| vimentin

                                  0

                                  TigCluster_5768_Contig1

                                   

                                  0

                                  MexSingletonClusters_BL283B_A11

                                  gi|596053| immediate early gene transcription

                                  E-12

                                  TigSingletonClusters_Salamander_13_J19_ab1

                                   

                                  E-16

                                  MexSingletonClusters_v6_p4_j2_triplex5_1ld_

                                  gi|790632| macrophage inflammatory protein-1alpha

                                  E-22

                                  TigCluster_2146_Contig1

                                  gi|951175| limbic system-associated membrane prot.

                                  E-11

                                  MexSingletonClusters_v11_p54_o4_t3_

                                  gi|971274| neurodegeneration associated protein 1

                                  E-09

                                  TigSingletonClusters_Salamander_2_J12_ab1

                                   

                                  E-11

                                  Similar gene expression programs may underlie regeneration of vertebrate appendages such as fish fins and tetrapod limbs. Regeneration could depend on reiterative expression of genes that function in patterning, morphogenesis, and metabolism during normal development and homeostasis. Or, regeneration could depend in part on novel genes that function exclusively in this process. We investigated these alternatives by searchingA. mexicanumlimb regeneration ESTs against UNIGENE zebrafish fin regeneration ESTs (Figure3). This search identified 1357 significant BLAST hits (TBLASTX;E<10-7) that corresponded to 1058 unique zebrafish ESTs. We then asked whether any of these potential regeneration homologues were represented uniquely in limb and fin regeneration databases (and not in databases derived from other zebrafish tissues). A search of the 1058 zebrafish ESTs against > 400,000 zebrafish ESTs that were sampled from non-regenerating tissues revealed 43 that were unique to the zebrafish regeneration database (Table7). Conceivably, these 43 ESTs may represent transcripts important to appendage regeneration. For example, our search identified several genes (e.g.hspc128, pre-B-cell colony enhancing factor 1,galectin 4,galectin 8) that may be expressed in progenitor cells that proliferate and differentiate during appendage regeneration. Overall, our results suggest that regeneration is achieved largely through the reiterative expression of genes having additional functions in other developmental contexts, however a small number of genes may be expressed uniquely during appendage regeneration.
                                  http://static-content.springer.com/image/art%3A10.1186%2F1471-2164-5-54/MediaObjects/12864_2004_Article_156_Fig3_HTML.jpg
                                  Figure 3

                                  Results of BLASTN and TBLASTX searches to identify best BLAST hits for A. mexicanum regeneration ESTs searched against zebrafish EST databases.A total of 14,961A. mexicanumlimb regeneration ESTs were assembled into 4485 contigs for this search.

                                  Table 7

                                  Ambystomalimb regeneration contigs that show sequence similarity to zebrafish fin regeneration ESTs

                                  Mex. Contigs

                                  Human ID

                                  E-value

                                  Zfish ID

                                  E-value

                                  Contig94

                                  gi|10835079|

                                  1e-63

                                  gnl|UG|Dr#S12319632

                                  1e-58

                                  nm_30_a11_t3_

                                  gi|32306539|

                                  1e-58

                                  gnl|UG|Dr#S12312602

                                  1e-35

                                  Contig615

                                  gi|4502693|

                                  1e-70

                                  gnl|UG|Dr#S12313407

                                  1e-34

                                  nm_23_l13_t3_

                                  No Human Hit

                                   

                                  gnl|UG|Dr#S12320916

                                  1e-31

                                  nm_9_e22_t3_

                                  gi|4758788|

                                  1e-98

                                  gnl|UG|Dr#S12309914

                                  1e-29

                                  nm_8_l17_t3_

                                  gi|21361310|

                                  1e-16

                                  gnl|UG|Dr#S12313396

                                  1e-27

                                  Contig531

                                  gi|13775198|

                                  1e-27

                                  gnl|UG|Dr#S12309680

                                  1e-26

                                  Contig152

                                  gi|5453712|

                                  1e-32

                                  gnl|UG|Dr#S12239884

                                  1e-26

                                  nm_32h_j20_t3_

                                  gi|39777601|

                                  1e-79

                                  gnl|UG|Dr#S12136499

                                  1e-25

                                  Contig1011

                                  gi|39752675|

                                  1e-65

                                  gnl|UG|Dr#S12136499

                                  1e-24

                                  v11_p50_b24_t3_

                                  gi|41208832|

                                  1e-36

                                  gnl|UG|Dr#S12319219

                                  1e-23

                                  Contig589

                                  gi|4506505|

                                  1e-56

                                  gnl|UG|Dr#S12312662

                                  1e-22

                                  Contig785

                                  gi|33695095|

                                  1e-61

                                  gnl|UG|Dr#S12264765

                                  1e-22

                                  Contig157

                                  gi|21361122|

                                  1e-138

                                  gnl|UG|Dr#S12313094

                                  1e-21

                                  v11_p42_j20_t3_049_ab1

                                  gi|47591841|

                                  1e-100

                                  gnl|UG|Dr#S12137806

                                  1e-21

                                  Contig610

                                  gi|10801345|

                                  1e-114

                                  gnl|UG|Dr#S12310326

                                  1e-20

                                  nm_27_o1_t3_

                                  gi|7706429|

                                  1e-72

                                  gnl|UG|Dr#S12310422

                                  1e-19

                                  Contig439

                                  gi|4504799|

                                  1e-25

                                  gnl|UG|Dr#S12309233

                                  1e-19

                                  nm_31_d5_t3_

                                  gi|8923956|

                                  1e-50

                                  gnl|UG|Dr#S12264745

                                  1e-17

                                  v11_p41_h12_t3_026_ab1

                                  No Human Hit

                                   

                                  gnl|UG|Dr#S12320916

                                  1e-17

                                  Contig129

                                  gi|34932414|

                                  1e-103

                                  gnl|UG|Dr#S12313534

                                  1e-17

                                  nm_14_j21_t3_

                                  gi|4505325|

                                  1e-42

                                  gnl|UG|Dr#S12136571

                                  1e-17

                                  Contig1321

                                  gi|4501857|

                                  1e-80

                                  gnl|UG|Dr#S12309233

                                  1e-17

                                  nm_19_k3_t3_

                                  gi|26051212|

                                  1e-106

                                  gnl|UG|Dr#S12137637

                                  1e-17

                                  Contig488

                                  gi|4557525|

                                  1e-105

                                  gnl|UG|Dr#S12311975

                                  1e-15

                                  nm_35h_k19_t3_

                                  gi|16950607|

                                  1e-43

                                  gnl|UG|Dr#S12196214

                                  1e-15

                                  Contig195

                                  gi|4557231|

                                  1e-99

                                  gnl|UG|Dr#S12309233

                                  1e-14

                                  nm_14_h19_t3_

                                  gi|4503787|

                                  1e-86

                                  gnl|UG|Dr#S12310912

                                  1e-13

                                  v11_p51_d20_t3_

                                  gi|30520322|

                                  1e-19

                                  gnl|UG|Dr#S12321150

                                  1e-13

                                  g3-n14

                                  gi|13654278|

                                  1e-23

                                  gnl|UG|Dr#S12318856

                                  1e-13

                                  nm_29_f2_t3_

                                  gi|4506517|

                                  1e-65

                                  gnl|UG|Dr#S12312662

                                  1e-13

                                  g4-h23

                                  gi|24111250|

                                  1e-33

                                  gnl|UG|Dr#S12312651

                                  1e-13

                                  Math_p2_A2_T3_

                                  No human Hit

                                   

                                  gnl|UG|Dr#S12078998

                                  1e-13

                                  nm_35h_f4_t3_

                                  gi|41148476|

                                  1e-67

                                  gnl|UG|Dr#S12319663

                                  1e-13

                                  Contig952

                                  gi|21264558|

                                  1e-61

                                  gnl|UG|Dr#S12318843

                                  1e-12

                                  g4-g21

                                  gi|11995474|

                                  1e-65

                                  gnl|UG|Dr#S12192716

                                  1e-12

                                  Contig854

                                  gi|8922789|

                                  1e-117

                                  gnl|UG|Dr#S12313534

                                  1e-11

                                  Contig1105

                                  gi|6912638||

                                  1e-83

                                  gnl|UG|Dr#S12079967

                                  1e-11

                                  nm_26_f7_t3_

                                  gi|30181238|

                                  1e-83

                                  gnl|UG|Dr#S12319880

                                  1e-11

                                  Contig949

                                  gi|21284385|

                                  1e-68

                                  gnl|UG|Dr#S12290856

                                  1e-11

                                  g3-n3

                                  gi|18490991|

                                  1e-64

                                  gnl|UG|Dr#S12320832

                                  1e-10

                                  v11_p41_m16_t3_007_ab1

                                  gi|4885661|

                                  1e-33

                                  gnl|UG|Dr#S12310912

                                  1e-10

                                  Contig653

                                  gi|4505047|

                                  1e-124

                                  gnl|UG|Dr#S12239868

                                  1e-09

                                  Contig1349

                                  gi|9665259|

                                  1e-46

                                  gnl|UG|Dr#S12320840

                                  1e-09

                                  6h12

                                  gi|31317231|

                                  1e-43

                                  gnl|UG|Dr#S12321311

                                  1e-09

                                  v11_p43h_i14_t3_070_ab1

                                  No Human Hit

                                   

                                  gnl|UG|Dr#S12320916

                                  1e-09

                                  nm_35h_d11_t3_

                                  gi|7661790|

                                  1e-35

                                  gnl|UG|Dr#S12196146

                                  1e-09

                                  nm_35h_k22_t3_

                                  gi|5031977|

                                  1e-124

                                  gnl|UG|Dr#S12242267

                                  1e-09

                                  v11_p48_g2_t3_087_ab1

                                  gi|11496277|

                                  1e-60

                                  gnl|UG|Dr#S12312396

                                  1e-09

                                  nm_30_e11_t3_

                                  gi|32483357|

                                  1e-56

                                  gnl|UG|Dr#S12309103

                                  1e-08

                                  nm_28_f23_t3_

                                  gi|42544191|

                                  1e-25

                                  gnl|UG|Dr#S12239884

                                  1e-08

                                  nm_12_p16_t3_

                                  gi|21361553|

                                  1e-21

                                  gnl|UG|Dr#S12310912

                                  1e-08

                                  nm_32h_a8_t3_

                                  gi|11386179|

                                  1e-22

                                  gnl|UG|Dr#S12312152

                                  1e-08

                                  Human RefSeq sequence ID's are provided to allow cross-referencing.

                                  DNA sequence polymorphisms within and betweenA. mexicanumandA. t. tigrinum

                                  The identification of single nucleotide polymorphisms (SNPs) within and between orthologous sequences ofA. mexicanumandA. t. tigrinumis needed to develop DNA markers for genome mapping [32], quantitative genetic analysis [33], and population genetics [34]. We estimated within species polymorphism for both species by calculating the frequency of SNPs among ESTs within the 20 largest contigs (Table4). These analyses considered a total of 30,638 base positions forA. mexicanumand 18,765 base positions forA. t. tigrinum. Two classes of polymorphism were considered in this analysis: those occurring at moderate (identified in 10–30% of the EST sequences) and high frequencies (identified in at least 30% of the EST sequences). Within theA. mexicanumcontigs, 0.49% and 0.06% of positions were polymorphic at moderate and high frequency, while higher levels of polymorphism were observed forA. t. tigrinum(1.41% and 0.20%). Higher levels of polymorphism are expected forA. t. tigrinumbecause they exist in larger, out-bred populations in nature.

                                  To identify SNPs between species, we had to first identify presumptive, interspecific orthologues. We did this by performing BLASTN searches between theA. mexicanumandA. t. tigrinumassemblies, and the resulting alignments were filtered to retain only those alignments between sequences that were one another's reciprocal best BLAST hit. As expected, the number of reciprocal 'best hits' varied depending upon theEvalue threshold, although increasing theEthreshold by several orders of magnitude had a disproportionately small effect on the overall total length of BLAST alignments. A threshold ofE<10-80yielded 2414 alignments encompassing a total of 1.25 Mbp from each species, whereas a threshold ofE<10-20yielded 2820 alignments encompassing a total of 1.32 Mbp. The percent sequence identity of alignments was very high among presumptive orthologues, ranging from 84–100% at the more stringentEthreshold ofE<10-80. On average,A. mexicanumandA. t. tigrinumtranscripts are estimated to be 97% identical at the nucleotide level, including both protein coding and UTR sequence. This estimate for nuclear sequence identity is surprisingly similar to estimates obtained from complete mtDNA reference sequences for these species (96%, unpublished data), and to estimates for partial mtDNA sequence data obtained from multiple natural populations [16]. These results are consistent with the idea that mitochondrial mutation rates are lower in cold versus warm-blooded vertebrates [35]. From a resource perspective, the high level of sequence identity observed between these species suggests that informatics will enable rapidly the development of probes between these and other species of theA. tigrinumcomplex.

                                  Extending EST resources to other ambystomatid species

                                  Relatively little DNA sequence has been obtained from species that are closely related to commonly used model organisms, and yet, such extensions would greatly facilitate genetic studies of natural phenotypes, population structures, species boundaries, and conservatism and divergence of developmental mechanisms. Like many amphibian species that are threatened by extinction, many of these ambystomatid salamanders are currently in need of population genetic studies to inform conservation and management strategies [e.g. [13]]. We characterized SNPs from orthologousA. mexicanumandA. t. tigrinumESTs and extended this information to develop informative molecular markers for a related species,A. ordinarium.Ambystoma ordinariumis a stream dwelling paedomorph endemic to high elevation habitats in central Mexico [36]. This species is particularly interesting from an ecological and evolutionary standpoint because it harbors a high level of intraspecific mitochondrial variation, and as an independently derived stream paedomorph, is unique among the typically pond-breeding tiger salamanders. As a reference of molecular divergence,Ambystoma ordinariumshares approximately 98 and 97% mtDNA sequence identity withA. mexicanumandA. t. tigrinumrespectively [16].

                                  To identify informative markers forA. ordinarium,A. mexicanum and A. t. tigrinumEST contigs were aligned to identify orthologous genes with species-specific sequence variations (SNPs or Insertion/Deletions = INDELs). Primer pairs corresponding to 123 ESTs (Table8) were screened by PCR using a pool of DNA template made from individuals of 10A. ordinariumpopulations. Seventy-nine percent (N = 97) of the primer pairs yielded amplification products that were approximately the same size as correspondingA. mexicanumandA. t. tigrinumfragments, using only a single set of PCR conditions. To estimate the frequency of intraspecific DNA sequence polymorphism among this set of DNA marker loci, 43 loci were sequenced using a single individual sampled randomly from each of the 10 populations, which span the geographic range ofA. ordinarium. At least one polymorphic site was observed for 20 of the sequenced loci, with the frequency of polymorphisms dependent upon the size of the DNA fragment amplified. Our results suggest that the vast majority of primer sets designed forA. mexicanum/A. t. tigrinumEST orthologues can be used to amplify the corresponding sequence in a relatedA. tigrinumcomplex species, and for small DNA fragments in the range of 150–500 bp, approximately half are expected to have informative polymorphisms.
                                  Table 8

                                  EST loci used in a population-level PCR amplification screen inA. ordinarium

                                  Locus ID

                                  Forward Primer 5' to 3'

                                  Reverse Primer 5' to 3'

                                  1F8

                                  AAGAAGGTCGGGATTGTGGGTAA

                                  CAGCCTTCCTCTTCATCTTTGTCTTG

                                  1H3

                                  GGCAAATGCTGGTCCCAACACAAA

                                  GGACAACACTGCCAAATACCACAT

                                  2C8

                                  GCAAGCACCAGCCACATAAAG

                                  GGCCACCATAACCACTCTGCT

                                  3B10

                                  TCAAAACGAATAAGGGAAGAGCGACTG

                                  TTGCCCCCATAATAAGCCATCCATC

                                  5E7

                                  ACGCTTCGCTGGGGTTGACAT

                                  CGGTAGGATTTCTGGTAGCGAGCAC

                                  5F4

                                  CCGAGATGAGATTTATAGAAGGAC

                                  TAGGGGAAGTTAAACATAGATAGAA

                                  6A3

                                  GTTTATGAAGGCGAGAGGGCTATGACCA

                                  ATCTTGTTCTCCTCGCCAGTGCTCTTGT

                                  6B1

                                  TGATGCTGGCGAGTACAAACCCCCTTCT

                                  TTTACCATTCCTTCCCTTCGGCAGCACA

                                  6B3

                                  ACCACGTGCTGTCTTCCCATCCAT

                                  ACGAAGCTCATTGTAGAAGGTGTG

                                  6B4

                                  CCCACGATGAATTGGAATTGGACAT

                                  CTGCCTGCCAGACCTACAGACTATCGT

                                  6C4

                                  ATGGCGCCAAAGTGATGAGTA

                                  GGGCCAGGCACACGACCACAAT

                                  6D2

                                  ATCAAGGCTGGCATGGTGGTCA

                                  GGGGGTCGTTCTTGCTGTCA

                                  6H8

                                  GAAGAAGACAGAAACGCAGGAGAAAAAC

                                  CGGGCGGGGGCGGGTCACAGTAAAAC

                                  BL005B_A01.5.1

                                  GACAGGTCATGAACTTTTGAAAATAA

                                  AAAGTATATGTACCAAATGGGAGAGC

                                  BL006A_G07.5.1

                                  GATGTCCTCTCCACTATACAAGTGTG

                                  GTTTGACTTGTCACCACTTTATCAAC

                                  BL012D_F02.5.1

                                  ACAGCCAGAAATAGAAACTTTGAACT

                                  TGAAAGTATGTATTGTTTTCACAGGG

                                  BL013C_E01.5.1

                                  AGGATGAAATAATATGCTGTGCTTC

                                  ACCGTGATAAACTCCATCCCTT

                                  BL014D_B11.5.1

                                  AGCAAAACTCCTCTATGAATCTCG

                                  ATTGCACACTAAATAGGTGAATACGA

                                  BL279A_G10.5.1

                                  ATGGCAGGATGAAGAAAGACAT

                                  ATGCACTTTGGACCCACTGAG

                                  Et.fasta.Contig1023.5.1

                                  TGTGGTTATTGGACTACTTCACTCTC

                                  AAACGTCCATTTGACACTGTATTTTA

                                  Et.fasta.Contig1166.5.1

                                  GAATGAAGAGAAAATGTTTTGAAGGT

                                  GCACAGTATTGGCTATGAGCAC

                                  Et.fasta.Contig1311.5.1

                                  AGAAAACTGTGTCAAGCTTATTTTCC

                                  CAACTTAGTGTTCACATTTCTGAGGT

                                  Et.fasta.Contig1335.5.1

                                  CCACTTATGGTAGTTCCCACTTTTAT

                                  GCTAAAGAATACCAAGAACCTTTGAC

                                  Et.fasta.Contig1381.5.1

                                  GTCACAGGTATAACATTGAAAGGATG

                                  TAAATGAATCAAACATTGAAGAGAGC

                                  Et.fasta.Contig1459.5.1

                                  ATAACAAGGACATGTTCTGCTGG

                                  CTAGCAGAACCCTGTATAGCCTG

                                  Et.fasta.Contig1506.5.1

                                  AGGATATCCGCTCAGAAATATGAAG

                                  CTGACCACTTGCAAAACTTACTACCT

                                  Et.fasta.Contig1578.5.1

                                  CCTAGAACATTACCAAAACAGACTCA

                                  AATGAAGAAGTATTGCATGTGAGAAC

                                  Et.fasta.Contig1647.5.1

                                  GTACAACGTCAGGCAAAGCTATTCT

                                  ATCTCCAACACCGTGGCTAAT

                                  Et.fasta.Contig1717.5.1

                                  GAACTTGTTGGCAGGTTTCTCTT

                                  CTAGTGATAGGTTGGACATACCAGAG

                                  Et.fasta.Contig1796.5.1

                                  TGTGGGTATGTATATGGCTAACTTGT

                                  AGATTTTATGTGCTACTGCATTTACG

                                  Et.fasta.Contig1908.5.1

                                  CTCATGACTTAATTGCTGTTCTTCG

                                  ATAACCATTCTGAGGTTTTGAGTTG

                                  Et.fasta.Contig1941.5.1

                                  ATCTCCTGCTTCATCTCTTGATTTAT

                                  TAACAGATTTAATAAACGTCCCCTTC

                                  Et.fasta.Contig1943.5.1

                                  AGTACGATGAATCTGGTCCTTCAAT

                                  CCACAATACTGACATACTCTGGTCTT

                                  Et.fasta.Contig325.5.1

                                  GTGAAGTCAGTGAGTAAAGTCCATGT

                                  CTAGGATACCAGTGGGAGAGTGTAAT

                                  Et.fasta.Contig330.5.1

                                  GTCATCACCTCCACTACTTCACAAG

                                  TTTTGGCACTGTAAGATTCTATGAAC

                                  Et.fasta.Contig536.5.1

                                  CCTTAGGTAGAACAGACTGAAGCAG

                                  GAAACATGAAACTGGACTTGTTTTAG

                                  Et.fasta.Contig917.5.1

                                  GGATGCAGATTCTTCCTATTTTACTC

                                  CTGGTCACTTTACTTGTTTTCAGTGT

                                  Et.fasta.Contig926.5.1

                                  TTCATCACATTCTACTTCACAAATCA

                                  CTAGGCAAGCAAGCTTTCTAATAGTT

                                  Et.fasta.Contig93.5.1

                                  GAATAAAAGCAACAATTGCAGAGTTA

                                  CTCGACTCCTTCTACGATCTCTACTC

                                  Et.fasta.Contig990.5.1

                                  GTTTAGGTTAGTATGAAGGATCCCAA

                                  TGCCAGTACTCACCAATTAGTAAAAG

                                  G1-C12

                                  CCCAAATCCAGGAGTTCAAA

                                  TGGGACCTGGGGCTTCATT

                                  G1-C13

                                  TTGCCCGAGAAAAGGAAGGACATA

                                  CAAGGGTGGGTGAGGGACATC

                                  G1-C5

                                  F-CACTGTTGACTTGGGTTATGTTATT

                                  CTGCTCCTAGGGTTTGTGAAG

                                  G1-C7

                                  CCCGTGTGGCTGGCTTGTGC

                                  TCGGCTACTTTGGTGTTTTTCTCCCTCAT

                                  G1-C9

                                  TGGTCCGGCAACAGCATCAGA

                                  GCTTTTCGGTATTCAACGGCAGAGTG

                                  G1-C9

                                  TGGTCCGGCAACAGCATCAGA

                                  GCTTTTCGGTATTCAACGGCAGAGTG

                                  G1-D5

                                  AGACCCTTGCTGTGTAACTGCT

                                  GACTGGGACTGACTTCTATGACG

                                  G1-D6

                                  CAGCGTGCCCACCCGATAGAA

                                  TCCCAAAAAGTAAAATGTGCAAAGAAAA

                                  G1-D7

                                  CAGCGGTGGAAATGACAAACAGG

                                  CCAAGACGACGAGGAACGGTATT

                                  G1-E12

                                  CAACCATGAGAGGAGGCCAGAGAAC

                                  AAAACAGCACTACCTACAAAACCCTATT

                                  G1-F1

                                  TTAGTTTGGGTGCAGACAGGA

                                  GGTGCTCAACAACAAATCAACT

                                  G1-F20

                                  TCCCCAACAACTCCAGCAGAT

                                  GGAAACCACCTAGACGAAAAATG

                                  G1-I18

                                  CATGTTTGTGGGTGTGGTGAA

                                  AAAAGCGGCATCTGGTAAGG

                                  G1-I19

                                  ACCCAGACCTGTCCACCTCA

                                  GAACAGCTCTCCAATCCACAAG

                                  G1-I21

                                  CCAAGCGAAGGAGGCGTGTG

                                  CATGTGGCTCTTTGTTTCTGGA

                                  G1-I5

                                  TAATCGTGTTTGGTGGCATCCTTGAGTC

                                  AGCAGCAGTTCCATTTTCCCACACCA

                                  G1-I8

                                  ACCTGCAGTGGGCTAAGACC

                                  ATGGAAATAATAAAATAAAATGTT

                                  G1-J10

                                  CGTTCGCTTTGCCTGCCACA

                                  GGCTCTTCCCCGGTCGTCCAC

                                  G1-J17

                                  AGCGCCTTCTACACGGACAC

                                  TATGCCCCAATTACTCTTCTGC

                                  G1-J2

                                  TACAGTAACTATGCCAAGATGAAATG

                                  CAATATGGATAATGGCTGTAGACC

                                  G1-J20

                                  ATCCTCCAAGCTCACTACAACA

                                  CCAGCCCCTTCCCAAACAG

                                  G1-J9

                                  CTGTCATTGCCTGCATCGGGGAGAAG

                                  TGTTGAGGGGAAGCAGTTTTG

                                  G1-K2

                                  GCTTTCGCCTTTGACACCTC

                                  GGCCGGACCATTGCTGAAGAAG

                                  G1-L11

                                  AAAGTGACCATCCAGTGCCCAAACCT

                                  CCGGCCGAAACTGACGAGATACATTAG

                                  G1-L13

                                  TCAGCTGCACTAGGTTTGTC

                                  CATTTTGATTTGCTCCATAA

                                  G1-L19

                                  GACAACCTTGAATCCTTTATG

                                  AGATGTTGGTTGGTGACTTAT

                                  G1-L20

                                  TGGGCATAGATGGCAAGGAAAAA

                                  CCCCCAGCATCTCGCATACAC

                                  G1-L7

                                  GTGCTACAGGAAGGAATGGATG

                                  TAGCACAGGAACAGCCGACAATAA

                                  G1-M14

                                  CCGCTTGGACATGAGGAGAT

                                  TGGCAAAGAAACAGAACACAACTA

                                  G1-M19

                                  GAGAAGTAGTGTCCCGGCAGAAAC

                                  ATGGGTGAAAACTTAGGTGAAATG

                                  G1-N9

                                  GCGGGGCAATACATGACGTTCCACAG

                                  GACCCCCATCTCCGTTTCCCATTCC

                                  G1-O1

                                  GGGGTAGAGCACAGTCCAGTT

                                  TTGCAAGGCCGAAAAGGTG

                                  G1-O12

                                  GGAATTCCGGGGCACTACT

                                  TCGCGAGGACGGGGAAGAG

                                  G1-O24

                                  CGGCCTTCCTGCAGTACAACCATC

                                  TCGGCAACGTGAAGACCATA

                                  G2-A11

                                  GCCCCTGGAAGCTGTTGTGA

                                  GGGGTCCATCCGAGTCC

                                  G2-A7

                                  TTACCCCACAGACAAAATCAACACC

                                  GGCGGCCCCTCATAGCAC

                                  G2-B1

                                  GGGCCTAGTCCTGCTGGTC

                                  CAAAGAGTGCGGAGAAATGG

                                  G2-B8

                                  CAACATGCGACCACTATAGCCACTTCCT

                                  CGCCACCGCCACCACCACA

                                  G2-C2

                                  TTTGCAGGAAGAGTCATAACACAG

                                  GTCAACAACACCCTTTTCCCTTCCT

                                  G2-D1

                                  GCAGGTCGGCAAGAAGCTAAAGAAGGAA

                                  AGGGTTGGTTTGAAAGGATGTGCTGGTAA

                                  G2-E17

                                  GGAGCACCAAATTCAAGTCAG

                                  CGTCCCCGGTCAATCTCCAC

                                  G2-E19

                                  CCAGTTTGAGCCCCAGGAG

                                  TCGCGGCAGTCAAGAGGTC

                                  G2-F17

                                  TATCCTCTTATTGCTGCATTCTCCTCAC

                                  AGTACGGCCGTTCACCATCTCTG

                                  G2-F2

                                  CACACCACAGACGCATTGAC

                                  TCCCCAGCCTGTGTAGAAC

                                  G2-G13

                                  GGGAGGGGAGAAGGCTACCA

                                  ATACACGGCTTCCATGCTTCTTCTT

                                  G2-G15

                                  CCACGGCCCCACATCCAGC

                                  TCCCGCAGAATTTCCGTATCCAT

                                  G2-G21

                                  TCCAAGAGGGTGTGAGGTGAAC

                                  AAAGCCATGCGAAGCGGAAGAC

                                  G2-G23

                                  GGTTTGGTACTTCAGCGGATGT

                                  CCAAAGCCTGTACTATGCGAAAAG

                                  G2-G5

                                  CGGTCCCTACTGTGGTCTATGGTTTTCA

                                  GGCTCTGCATATCCTCGGTCACACTTCC

                                  G2-G6

                                  CCCATGGCTGCAAGGATTACG

                                  CAGGGGTTGTTGGGAGGCAGTGT

                                  G2-H18

                                  TTGTCAAATGGGCGAGTTCA

                                  TGTTTTGCACCCAGTTTTTG

                                  G2-I18

                                  GATCTCCTCAGGTCTCTTTCA

                                  GATTATGGGCCGGTGTCTCT

                                  G2-I23

                                  TGACTTTCCCAATGTGAGCAGAC

                                  CAGAGGTGGTGTTACAGCAGCAGTTT

                                  G2-J12

                                  CCTCTTGTCCCAGTGCCAGTG

                                  TCCAGGGATCCGAAACAAAG

                                  G2-J21

                                  CCGCCTCAGCCTGTTTCTCTACTTTT

                                  CTTTGAATTTCTGCTTTTGGTGCTCTGC

                                  G2-K12

                                  ACATTAGTCCTGGTTACGAGAGC

                                  AAAGGGCAGTCCAGCATTGA

                                  G2-K2

                                  CTGCCCAAGAAGACCGAGAGCCACAAG

                                  AGCGCCCCCTGCACCAAAATCA

                                  G2-L16

                                  CCAAGGGTAGGAGAACAAGACA

                                  ATGGCATGCTGGGAAATCA

                                  G2-L21

                                  GAATCTAGGTCCAAGCAGTCCCATCT

                                  GACCATCACACCACTACCCACACTCA

                                  G2-L3

                                  TGAAAGAGGCCAGAAACAAGTAG

                                  TTCCCAAGGTCTCCATAACAAT

                                  G2-L4

                                  TGGCCAAGAAGATGAAACAGGAAGAGGAG

                                  TGGCAAAGGACACGACGCAGAG

                                  G2-M14

                                  CGGCCTCCTCGACGCATACG

                                  CCAGGCCGGCCCATTGTTC

                                  G2-M24

                                  ACGGAGCACGGTCAGATTTCACG

                                  CCCGGCTGGCTCTTCTTGCTCTT

                                  G2-M3

                                  CGATCCGCATTGAACGAGT

                                  TGTGGCAGGAAGGAGAAGG

                                  G2-N2

                                  CGTGTTTTCCTCCTATGTCGACTTCTTTG

                                  ACGTGCTCTGCCTTTCTTGATCTTGTGTT

                                  G3-D7

                                  AGGATTTCTTGGCCGGTGGAGTGG

                                  GAAGTTGAGGGCCTGGGTGGGGAAGTA

                                  NT001D_E08.5.1

                                  AGAAGTTCCTAGATGAGTTGGAGGAG

                                  AATTAATTTCCTAAACCAGGTGACAG

                                  NT010B_E09.5.1

                                  GAAGAGGTCCTAAAATATCAAGATGC

                                  ATGATAGACTTCGTCCTTGTCATAGA

                                  NT014D_E01.5.1

                                  AAAGAAGTCCCGCATCTAACCT

                                  ATTAAATATGAGAAGATGTGTGCAGG

                                  V2_p1_b8

                                  AGTCACTGTGTTACATTATCACCCAC

                                  ATAATTATACACTGCGGTCTGCATCT

                                  V2_p1_c5

                                  AGTACCTGTTCGACAAGCACAC

                                  TGAGAACATAGACAAGTTAACATACACC

                                  V2_p1_d10

                                  GAGATAGAAAGGCTGCATAAAGAAAT

                                  TATGTTTCAACAATGTACAGGAAACC

                                  V2_p1_d4

                                  CACCAGAACAAGCTGTATTTTTATGT

                                  TGGTTTGCATCATATATTAAAGGGTA

                                  V2_p1_g7

                                  GACTTCAAGCACATTGGGAAAC

                                  ATTGTAAACTTGATAGGCTGGTGAG

                                  V2_p2_g6

                                  AGAATTCCCAATAGCACCTGAAAT

                                  CACTTGGTAAATACATACACACAGCA

                                  V2_p2_h2

                                  CTTTTTGGCCTGGTCTTTTTG

                                  AGATTCTTCAGACTCGTCCTTCTTT

                                  V2_p3_a5

                                  TTTACACAGAAACCTTGTTTATTTGGC

                                  TTTAAGGATGCTTAGAGGCAAAGTATT

                                  V2_p3_b1

                                  AGTCACTGTGTTACATTATCACCCAC

                                  TATACACTGCGGTCTGCATCTACT

                                  V2_p5_b3

                                  AATGGGATGAAGAGCGAGAAT

                                  CTGCCCCATTGACATTTACCTA

                                  V2_p5_h3

                                  CCTTCAGACGAAAACAGCACTAAG

                                  TACAGTGTATGAGAGCCCAATATTTC

                                  V2_p6_a4

                                  AGAAATACATCAAATATCGGGTGG

                                  AAAAAGGACAATGTTCAGCTCTCT

                                  V3_p1_a21

                                  ACCAAGTTCTTGGAAAGTGGTG

                                  CTTAGTGTCTCCTGGGTTTGAATAG

                                  V3_p1_b13

                                  GTCTTGGTACTCAATGAAGGAGATG

                                  TCAATCTGATGAAGAGTTTACATGTCT

                                  Comparative gene mapping

                                  Salamanders occupy a pivotal phylogenetic position for reconstructing the ancestral tetrapod genome structure and for providing perspective on the extremely derived anuranXenopus(37) that is currently providing the bulk of amphibian genome information. Here we show the utility of ambystomatid ESTs for identifying chromosomal regions that are conserved between salamanders and other vertebrates. A region of conserved synteny that corresponds to human chromosome (Hsa) 17q has been identified in several non-mammalian taxa including reptiles (38) and fishes (39). In a previous study Voss et al. (40) identified a region of conserved synteny betweenAmbystomaandHsa17q that included collagen type 1 alpha 1 (Col1a1), thyroid hormone receptor alpha (Thra), homeo box b13 (Hoxb13), and distal-less 3 (Dlx3)(Figure4). To evaluate both the technical feasibility of mapping ESTs and the likelihood that presumptive orthologues map to the same synteny group, we searched our assemblies for presumptiveHsa17 orthologues and then developed a subset of these loci for genetic linkage mapping. Using a joint assembly ofA. mexicanumandA. t. tigrinumcontigs, 97 Hsa 17 presumptive orthologues were identified. We chose 15 genes from this list and designed PCR primers to amplify a short DNA fragment containing 1 or more presumptive SNPs that were identified in the joint assembly (Table9). All but two of these genes were mapped, indicating a high probability of mapping success using markers developed from the joint assembly ofA. mexicanumandA. t. tigrinumcontigs. All 6 ESTs that exhibited 'best hits' to loci within the previously defined human-Ambystomasynteny group did map to this region (Hspc009,Sui1,Krt17,Krt24,Flj13855,andRpl19). Our results show that BLAST-based definitions of orthology are informative between salamanders and human. All other presumptiveHsa17 loci mapped toAmbystomachromosomal regions outside of the previously defined synteny group. It is interesting to note that two of these loci mapped to the same ambystomatid linkage group (Cgi-125,Flj20345), but in human the presumptive orthologues are 50 Mb apart and distantly flank the syntenic loci in Figure4. Assuming orthology has been assigned correctly for these loci, this suggests a dynamic history for someHsa17 orthologues during vertebrate evolution.
                                  http://static-content.springer.com/image/art%3A10.1186%2F1471-2164-5-54/MediaObjects/12864_2004_Article_156_Fig4_HTML.jpg
                                  Figure 4

                                  Comparison of gene order between Ambystoma linkage group 1 and an 11 Mb region of Hsa17 (37.7 Mb to 48.7 Mb). Lines connect the positions of putatively orthologous genes.

                                  Table 9

                                  Presumptive human chromosome 17 loci that were mapped inAmbystoma

                                  Marker ID

                                  Primersa

                                  Diagnosisb

                                  LGc

                                  Symbold

                                  RefSeq IDe

                                  E-valuef

                                  Pl_6_E/F_6

                                  F-GAAAACCTGCTCAGCATTAGTGT

                                  ASA

                                  ul

                                  PFN1

                                  NP_005013

                                  E-34

                                   

                                  R-TCTATTACCATAGCATTAATTGGCAG

                                       

                                  Pl_5_G/H_5

                                  F-CTATTTCATCTGAGTACCGTTGAATG

                                  PE (A)

                                  23

                                  CGI-125

                                  NP_057144

                                  E-56

                                   

                                  R-TAATGTAGAACTAAATGGCATCCTTC

                                       
                                   

                                  E-CCATGGTGCAGGAAGAGAGCCTATAT

                                       

                                  Pl_0.4_A/B_1

                                  F-GTCTCATTATCCGCAAACCTGT

                                  SP

                                  1

                                  RPL19

                                  NP_000972

                                  E-67

                                   

                                  R-ATTCTCATCCTCCTCATCCACGAC

                                       

                                  Pl_4_B_7/8

                                  F-CCTAGAACATTACCAAAACAGACTCA

                                  RD (Dpn II)

                                  1

                                  KRT10

                                  NP_061889

                                  E-17

                                   

                                  R-AATGAAGAAGTATTGCATGTGAGAAC

                                       

                                  Pl_4_B_9/10

                                  F-GAACTTGTTGGCAGGTTTCTCTT

                                  RD (AciI)

                                  1

                                  KRT17

                                  NP_000413

                                  E-146

                                   

                                  R-CTAGTGATAGGTTGGACATACCAGAG

                                       

                                  Pl_10_C/D_4

                                  F-CTCCACTATTTAAAGGACATGCTACA

                                  PE (A)

                                  1

                                  SUI1

                                  NP_005792

                                  E-48

                                   

                                  R-TTAATATAGCACAACATTGCCTCATT

                                       
                                   

                                  E-TGCTACATTAATGTAATAAACGGCATCATC

                                       

                                  Pl_6_E/F_11

                                  F-AAGAGAAGTTCCTAGATGAGTTGGAG

                                  PE (A)

                                  1

                                  HSPC009

                                  NP_054738

                                  E-26

                                   

                                  R-TGAAGAGAGAACTCAAAGTGTCTGAT

                                       
                                   

                                  E-TCATGTTTTGCTCTGCTGTGCAGT

                                       

                                  Pl_9_A/B_10

                                  F-TGATAGTTTCTGGATTAAGACGAGTG

                                  PE (T)

                                  1

                                  FLJ13855

                                  NP_075567

                                  E-15

                                   

                                  R-CTTAGAGCCATTGTTACAAGATGTTC

                                       
                                   

                                  E-GTGATCTAGTGGGATCAAACCCTAAAGACC

                                       

                                  Pl_10_C/D_9

                                  F-AAAGTGCCAAGAAGGAGATTAACTT

                                  PE (T)

                                  9

                                  NME1

                                  NP_000260

                                  E-71

                                   

                                  R-GAGCTCAGAAAACAAGGCAGTAAC

                                       
                                   

                                  E-AAATGGATCTACGAGTAGACCTTGACCC

                                       

                                  Pl_9_C/D_9

                                  F-GAGTCTCCTTTAGGATTGACGTATCT

                                  PE (T)

                                  23

                                  FLJ20345

                                  NP_060247

                                  E-17

                                   

                                  R-GCTATGTGAGCAGAGATAAAAGTCAG

                                       
                                   

                                  E-GTTACAGCATCAGTGGGATGTGGTATGT

                                       

                                  Pl_8_C/D_9

                                  F-AGGATACCAACCTCTGTGCTATACAT

                                  PE (C)

                                  15

                                  H3F3B

                                  NP_005315

                                  E-66

                                   

                                  R-TAAATGTATTTACAAACCGAAAGCAA

                                       
                                   

                                  E-CGTGGCGAGCGTGCCTAGT

                                       

                                  Pl_9_C/D_4

                                  F-GTGGTTATTTGTAACATTTCGTTGAC

                                  PE (A)

                                  8

                                  SFRS2

                                  NP_003007

                                  E-40

                                   

                                  R-AATTACATTTGGGCTTCTCAATTTAC

                                       
                                   

                                  E-TTTTTAAACGCGTAAAAATGTTAACAGA

                                       

                                  Pl_6_C/D_5

                                  F-CCGTAAATGTTTCTAAATGACAGTTG

                                  PE (G)

                                  2

                                  ACTG1

                                  NP_001605

                                  0

                                   

                                  R-GGAAAGAAAGTACAATCAAGTCCTTC

                                       
                                   

                                  E-GATTGAAAACTGGAACCGAAAGAAGATAAA

                                       

                                  aSequences are 5' amplification primers, 3' amplification primers, or primer extension probes, and are preceded by F-, R-, and E- respectively.bGenotyping methods are abbreviated: allele specific amplification (ASA), size polymorphism (SP), restriction digestion (RD), primer extension (PE). Diagnostic restriction enzymes and diagnostic extension bases are provided in parentheses.cAmbystoma linkage group ID. "ul" designates markers that are unlinked.dOfficial gene symbols as defined by the Human Genome Organization Gene Nomenclature Committeehttp://​www.​gene.​ucl.​ac.​uk/​nomenclature/​.eBest BLASTX hit (highest e-value) from the human RefSeq database using the contig from which each marker was designed as a query sequence.fHighest E-value statistic obtained by searching contigs, from which EST markers were designed, against the human RefSeq database.

                                  Future directions

                                  Ambystomatid salamanders are classic model organisms that continue to inform biological research in a variety of areas. Their future importance in regenerative biology and metamorphosis will almost certainly escalate as genome resources and other molecular and cellular approaches become widely available. Among the genomic resources currently under development (see [41]) are a comparative genome map, which will allow mapping of candidate genes, QTL, and comparative anchors for cross-referencing the salamander genome to fully sequenced vertebrate models. In closing, we reiterate a second benefit to resource development inAmbystoma. Genome resources inAmbystomacan be extended to multiple, closely related species to explore the molecular basis of natural, phenotypic variation. Such extensions can better inform our understanding of ambystomatid biodiversity in nature and draw attention to the need for conserving such naturalistic systems. Several paedomorphic species, includingA. mexicanum, are on the brink of extinction. We can think of no better investment than one that simultaneously enhances research in all areas of biology and draws attention to the conservation needs of model organisms in their natural habitats.

                                  Conclusions

                                  Approximately 40,000 cDNA sequences were isolated from a variety of tissues to develop expressed sequence tags for two model salamander species (A. mexicanumandA. t. tigrinum). An approximately equivalent number of contigs were identified for each species, with 21,091 unique contigs identified overall. The strategy to sequence cDNAs from a diverse collection of tissues from normalized and non-normalized libraries yielded different sets of highly redundant contigs. Only 25% and 28% of theA. mexicanumandA. t. tigrinumcontigs, respectively, were identified in common. To demonstrate the utility of these EST resources, we searched databases to identify new probes for regeneration research, characterized intra- and interspecific nucleotide polymorphism, saturated a human/Ambystomasynteny group with marker loci, and extended PCR primer sets designed forA. mexicanum/A. t. tigrinumorthologues to a related tiger salamander species. Over 100 new probes were identified for regeneration research using informatic approaches. With respect to comparative mapping, 13 of 15 EST markers were mapped successfully, and 6 EST markers were mapped to a previously defined synteny group inAmbystoma. These results indicate a high probability of mapping success using EST markers developed from the joint assembly ofA. mexicanumandA. t. tigrinumcontigs. Finally, we found that primer sets designed forA. mexicanum/A. t. tigrinumEST orthologues can be used to amplify the corresponding sequence in a relatedA. tigrinumcomplex species. Overall, the EST resources reported here will enable a diversity of new research areas using ambystomatid salamanders.

                                  Methods

                                  cDNA library construction

                                  Ten cDNA libraries were constructed for the project using various larval tissues ofA. mexicanumandA. t. tigrinum(Table1). LarvalA. mexicanumwere obtained from adult animals whose ancestry traces back to the Axolotl Colony [17]. LarvalA. t. tigrinumwere obtained from Charles Sullivan Corp. The GARD and MATH A. mexicanum limb regeneration libraries were constructed using regenerating forelimb mesenchyme. Total RNAs were collected from anterior and posterior limbs amputated at the mid-stylopod level on 15 cm animals, and from the resulting regenerates at 12 h, 2 days, 5 days and early bud stages. One hundred μg fractions of each were pooled together and polyA-selected to yield 5 μg that was utilized for directional library construction (Lambda Zap, Stratagene). The V1 (A. mex), V2 (A. tig), V4-5 (A. tig), and V6-7 (A. mex) libraries were made from an assortment of larval tissues (see Table1) using the SMART cDNA cloning kits (Clontech). Total RNAs were isolated and reverse transcribed to yield cDNAs that were amplified by long distance PCR and subsequently cloned into pTriplEX. The V3 and AG libraries were constructed by commercial companies (BioS&T and Agencourt, respectively).

                                  cDNA template preparation and sequencing

                                  cDNA inserts were mass excised as phagemids, picked into microtitre plates, grown overnight in LB broth, and then diluted (1/20) to spike PCR reactions: (94°C for 2 min; then 30 cycles at 94°C for 45 sec, 58°C for 45°sec, and 72°C for 7 min). All successful amplifications with inserts larger than ~500 bp were sequenced (ABI Big Dye or Amersham Dye terminator chemistry and 5' universal primer). Sequencing and clean-up reactions was carried out according to manufacturers' protocols. ESTs were deposited into NCBI database under accession numbers BI817205-BI818091 and CN033008-CN045937 and CN045944-CN069430.

                                  EST sequence processing and assembly

                                  The PHRED base-calling program [42] was used to generate sequence and quality scores from trace files. PHRED files were then quality clipped and vector/contaminant screened. An in-house program called QUALSCREEN was used to quality clip the ends of sequence traces. Starting at the ends of sequence traces, this program uses a 20 bp sliding window to identify a continuous run of bases that has an average PHRED quality score of 15. Mitochondrial DNA sequences were identified by searching all ESTs against the complete mtDNA genome sequence ofA. mexicanum(AJ584639). Finally, all sequences less than 100 bp were removed. The average length of the resulting ESTs was 629 bp. The resulting high quality ESTs were clustered initially using PaCE [43] on the U.K. HP Superdome computer. Multi-sequence clusters were used as input sequence sets for assembly using CAP3 [44] with an 85% sequence similarity threshold. Clusters comprising single ESTs were assembled again using CAP3 with an 80% sequence similarity threshold to identify multi-EST contigs that were missed during the initial analysis. This procedure identified 550 additional contigs comprising 1150 ESTs.

                                  Functional annotation

                                  All contigs and singletons were searched against the human RefSeq database (Oct. 2003 release) using BLASTX. The subset of sequences that yielded no BLAST hit was searched against the non-redundant protein sequence database (Feb. 2004) using BLASTX. The remaining subset of sequences that yielded no BLAST hit was searched againstXenopus laevisandX. tropicalisUNIGENE ESTs (Mar. 2004) using TBLASTX. Zebrafish ESTs were downloaded from UNIGENE ESTs (May 2004). BLAST searches were done with an E-value threshold of E <10-7 unless specified.

                                  Sequence comparison ofA. mexicanumandA. t. tigrinumassemblies

                                  All low quality base calls within contigs were masked using a PHRED base quality threshold of 16. To identify polymorphisms for linkage mapping, contigs fromA. mexicanumandA. t. tigrinumassemblies were joined into a single assembly using CAP3 and the following criteria: an assembly threshold of 12 bp to identify initial matches, a minimum 100 bp match length, and 85% sequence identity. To identify putatively orthologous genes fromA. mexicanumandA. t. tigrinumassemblies, and generate an estimate of gene sequence divergence, assemblies were compared using BLASTN with a threshold ofE<10-20. Following BLAST, alignments were filtered to obtain reciprocal best BLAST hits.

                                  ExtendingA. mexicanum/A. t. tigrinumsequence information toA. ordinarium

                                  Polymorphic DNA marker loci were identified by locating single nucleotide polymorphisms (SNPs) in the jointA. mexicanumandA. t. tigrinumassembly. Polymerase chain reaction (PCR) primers were designed usingPrimer 3[45] to amplify 100 - 500 bp SNP-containing fragments from 123 different protein-coding loci (Table8). DNA was isolated from salamander tail clips using SDS, RNAse and proteinase K treatment, followed by phenol-chloroform extraction. Fragments were amplified using 150 ng DNA, 75 ng each primer, 1.5 mM MgCl2, 0.25 U Taq, and a 3-step profile (94°C for 4 min; 33 cycles of 94°C for 45 s, 60°C for 45 s, 72°C for 30 s; and 72°C for 7 min). DNA fragments were purified and sequenced using ABI Big Dye or Amersham Dye terminator chemistry. Single nucleotide polymorphisms were identified by eye from sequence alignments.

                                  Linkage mapping of human chromosome 17 orthologous genes

                                  Putative salamander orthologues of genes on human chromosome 17 (Hsa17) were identified by comparing the jointA. mexicanumandA. t. tigrinumassembly to sequences from the human RefSeq (NCBI) protein database, using BLASTX at thresholdE<10-7. Linkage distance and arrangement among markers was estimated using MapManager QTXb19 software [46] and the Kosambi mapping function at a threshold of p = 0.001. All markers were mapped using DNA from a previously described meiotic mapping panel [40]. All PCR primers and primer extension probes were designed usingPrimer 3[45] andArray Designer2(Premier Biosoft) software. Species-specific polymorphisms were assayed by allele specific amplification, restriction digestion, or primer extension, using the reagent and PCR conditions described above. Primer extension markers were genotyped using the AcycloPrime-FP SNP detection assay (Perkin Elmer). See Table9for amplification and extension primer sequences, and information about genotyping methodology.

                                  Declarations

                                  Acknowledgements

                                  We thank the Axolotl Colony. We thank Greg Chinchar and Betty Davidson for providing RNA to make cDNA libraries V3 and V4. We acknowledge the support of the National Science Foundation, the National Center for Research Resources at the National Institutes of Health, the Kentucky Spinal Cord and Head Injury Research Trust, and the NSF EPSCOR initiative in Functional Genomics at University of Kentucky.

                                  Authors’ Affiliations

                                  (1)
                                  Department of Biology, University of Kentucky
                                  (2)
                                  Department of Developmental and Cell Biology and the Developmental Biology Center, University of California
                                  (3)
                                  The Life Sciences Consortium, 519 Wartik Laboratory, Penn State University
                                  (4)
                                  Department of Zoology, University of Wisconsin-Madison
                                  (5)
                                  Scionics Computer Innovation GmbH
                                  (6)
                                  Max Planck Institute of Molecular Cell Biology and Genetics
                                  (7)
                                  Section of Integrative Biology and Section of Molecular, Cell and Developmental Biology, Institute for Cellular and Molecular Biology, University of Texas

                                  References

                                  1. Beetschen J-C:How did urodele embryos come into prominence as a model system. Int J Dev Biol1996,40:629–636.PubMed
                                  2. Gardiner DM, Endo T, Bryant SV:The molecular basis of amphibian limb regeneration: integrating the old with the new. Semin Cell Dev Biol2002,13:345–352.View ArticlePubMed
                                  3. Echeverri K, Tanaka EM:Ectoderm to mesoderm lineage switching during axolotl tail regeneration. Science2002,298:1933–1936.View Article
                                  4. Del Rio-Tsonis K, Jung JC, Chiu IM, Tsonis PA:Conservation of fibroblast growth factor function in lens regeneration. Proc Natl Acad Sci USA1997,94:13701–13706.View ArticlePubMed
                                  5. Ikegami Y, Mitsuda S, Araki M:Neural cell differentiation from retinal pigment epithelial cells of the newt: an organ culture model for the urodele retinal regeneration. J Neurobiol2002,50:209–20.View ArticlePubMed
                                  6. Chernoff EAG, Stocum DL, Nye HLD, Cameron JA:Urodele spinal cord regeneration and related processes. Dev Dyn2003,226:295–307.View ArticlePubMed
                                  7. Ferretti P:Re-examining jaw regeneration in urodeles: what have we learnt? Int J Dev Biol1996,40:807–811.PubMed
                                  8. Zhang J, Wu SM:Goalpha labels ON bipolar cells in the tiger salamander retina. J Comp Neurol2003,461:276–289.View ArticlePubMed
                                  9. Falck P, Hanken J, Olsson L:Cranial neural crest emergence and migration in the Mexican axolotl (Ambystoma mexicanum). Zoology-Jena2002,105:195–202.View ArticlePubMed
                                  10. Zhang C, Dube DK, Huang X, Zajdel RW, Bhatia R, Foster D, Lemanski SL, Lemanski LF:A point mutation in bioactive RNA results in the failure of mutant heart correction in mexican axolotls. Anat Embryol2003,206:495–506.PubMed
                                  11. Kauer JS:On the scents of smell in the salamander. Nature2002,417:336–342.View ArticlePubMed
                                  12. Voss SR, Prudic KL, Oliver JC, Shaffer HB:Candidate gene analysis of metamorphic timing in ambystomatid salamanders. Mol Ecol2003,12:1217–1223.View ArticlePubMed
                                  13. Riley SPD, Shaffer HB, Voss SR, Fitzpatrick BM:Hybridization between a rare, native tiger salamander (Ambystoma californiense. Ecol Appl2003,13:1263–1275.View Article
                                  14. Borland S, Crawford K, Brand V:Setting the stage: Developmental biology in pre-college classrooms. Int J Dev Biol2003,47:85–91.PubMed
                                  15. Jancovich JK, Mao J, Chinchar VG, Wyatt C, Case ST, Kumar S, Valente G, Subrmanian S, Davidson EW, Collins JP, Jacobs JB:Genomic sequence of a ranavirus (family Iridoviridae) associated with salamander mortalities in North America. Virology2003,316:90–103.View ArticlePubMed
                                  16. Shaffer HB, McKnight ML:The polytypic species revisited: genetic differentiation and molecular phylogenetics of the tiger salamander Ambystoma tigrinum (Amphibia: Caudata) complex. Evolution1996,50:417–433.View Article
                                  17. Axolotl Colony Website [http://​www.​indiana.​edu/​-axolotl/​]
                                  18. Straus NA:Comparative DNA renaturation kinetics in amphibians. Proc Nat Acad Sci USA1971,68:799–802.View ArticlePubMed
                                  19. Davis RH:The age of model organisms. Nat Rev2004,5:69–77.
                                  20. Habermann B, Bebin A-G, Herklotz S, Volkmer M, Eckelt K, Pehlke K, Epperlein HH, Schackert HK, Wiebe G, Tanaka EM:An Ambystomatid mexicanum EST sequencing project: Analysis of 17,352 expressed sequence tags from embryonic and regenerating blastema cDNA libraries. Genome Biology,in press.
                                  21. Kawai J, Shinagawa A, Shibata K,et al.:Functional annotation of a full-length mouse cDNA collection. Nature2001,409:685–690.View ArticlePubMed
                                  22. Ewing B, Green P:Analysis of expressed sequence tags indicates 35,000 human genes. Nat Gen2000,25:232–234.View Article
                                  23. Gene Ontology Consortium [http://​www.​godatabase.​org/​dev/​database/​]
                                  24. Adrian EK Jr, Walker BE:Incorporation of thymidine-H3 by cells in normal and injured mouse spinal cord. J Neuropathol Exp Neurol1962,21:597–609.View ArticlePubMed
                                  25. Namiki J, Tator CH:Cell proliferation and nestin expression in the ependyma of the adult rat spinal cord after injury. J Neuropathol Exp Neurol1999,58:489–98.View ArticlePubMed
                                  26. Bruni JE, Anderson WA:Ependyma of the rat fourth ventricle and central canal: Response to injury. Acta Anat1985,128:265–273.View Article
                                  27. Takahashi M, Yasuhisa A, Kurosawa H, Sueyoshi N, Shirai S:Ependymal cell reactions in spinal cord segments after compression injury in adult rat. J Neuropath Exp Neurol2003,62:185–194.PubMed
                                  28. Yamamoto S, Nagao M, Sugimori M, Kosako H, Nakatomi H, Yamamoto N, Takebayashi H, Nabeshima Y, Kitamura T, Weinmaster G, Nakamura K, Nakafuku M:Trancription factor expression and notch-dependent regulation of neural progenitors in the adult rat spinal cord. J Neurosci2001,21:9814–9823.PubMed
                                  29. Horner PJ, Power AE, Kempermann G, Kuhn HG, Plamer TD, Winkler J, Thal LJ, Gage FH:Proliferation and differentiation of progenitor cells throughout the intact adult spinal cord. J Neurosci2000,20:2218–2228.PubMed
                                  30. Carmel JB, Galante A, Soteropoulos P, Tolias P, Recce M, Young W, Hart RP:Gene expression profiling of acute spinal cord injury reveals spreading inflammatory signals and neuron loss. Physio Genomics2001,7:201–213.
                                  31. Song G, Cechvala C, Resnick DK, Dempsey RJ, Rao VLR:GeneChip analysis after acute spinal cord injury in rat. J Neurochem2001,79:804–815.View ArticlePubMed
                                  32. Parichy DM, Stigson S, Voss SR:Genetic analysis of Steel and the PG-M/versican-encoding gene AxPG as candidate genes for the white (d) pigmentation mutant in the salamander Ambystoma mexicanum. Dev Genes Evol1999,209:349–356.View ArticlePubMed
                                  33. Voss SR, Shaffer HB:Adaptive evolution via a major gene effect: paedomorphosis in the Mexican axolotl. Proc Natl Acad Sci USA1997,94:14185–14189.View ArticlePubMed
                                  34. Fitzpatrick BM, Shaffer HB:Environment dependent admixture dynamics in a tiger salamander hybrid zone. Int J Org Evolution2004,58:1282–1293.
                                  35. Martin AP, Palumbi SR:Rate of mitochondrial DNA evolution is slow in sharks compared to mammals. Proc Natl Acad Sci USA1993,90:4087–4091.View ArticlePubMed
                                  36. Anderson JD, Worthington RD:The life history of the Mexican salamander Ambystoma ordinarium Taylor. Herpetologica1971,27:165–176.
                                  37. Cannatella DC, De Sa RO:Xenopus laevis as a model organism. Syst Biol1993,42:476–507.View Article
                                  38. Schmid M, Nanda I, Guttenbach M, Steinlein C, Hoehn H, Schartl M, Haaf T, Weigend S, Fries R, Buderstedde J-M,et al.:First report on chicken genes and chromosomes. Cytogenet Cell Genet2000,90:169–218.View ArticlePubMed
                                  39. Postlethwait JH, Woods IG, Ngo-Hazelett YP, Yan Y-L, Kelly PD, Chu F, Huang H, Hill-Force A, Talbot WS:Zebrafish comparative genomics and the origins of vertebrate chromosomes. Genome Res2000,10:1890–1902.View ArticlePubMed
                                  40. Voss SR, Smith JJ, Gardiner DM, Parichy DM:Conserved vertebrate chromosome segments in the large salamander genome. Genetics2001,158:735–746.PubMed
                                  41. Salamander Genome Project Website [http://​salamander.​uky.​edu]
                                  42. Ewing B, Green P:Base-calling of automated sequencer traces using phred. II. Error probabilities. Genome Res1998,8:186–194.PubMed
                                  43. Kalyanaraman A, Aluru S, Kothari S, Brendel V:Efficient clustering of large EST data sets on parallel computers. Nucleic Acids Res2003,31:2963–2974.View ArticlePubMed
                                  44. Huang X, Madan A:CAP3: A dna sequence assembly program. Genome Res1999,9:868–877.View ArticlePubMed
                                  45. Rozen S, Skaletsky HJ:Primer 3. [http://​frodo.​wi.​mit.​edu/​primer3/​primer3_​code.​html] 1999.
                                  46. Meer JM, Cudmore RH Jr, Manly KF:MapManager QTX. [http://​www.​mapmanager.​org/​mmQTX.​html] 2004.

                                  Copyright

                                  © Putta et al. 2004

                                  This article is published under license to BioMed Central Ltd. This is an open-access article distributed under the terms of the Creative Commons Attribution License (http://​creativecommons.​org/​licenses/​by/​2.​0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

                                  Advertisement