Open Access

Evaluation of toxicity of the mycotoxin citrinin using yeast ORF DNA microarray and Oligo DNA microarray

  • Hitoshi Iwahashi1Email author,
  • Emiko Kitagawa1,
  • Yoshiteru Suzuki1,
  • Youji Ueda2,
  • Yo-hei Ishizawa2,
  • Hitoshi Nobumasa3,
  • Yoshihide Kuboki4,
  • Hiroshi Hosoda5 and
  • Yumiko Iwahashi5
BMC Genomics20078:95

DOI: 10.1186/1471-2164-8-95

Received: 04 December 2006

Accepted: 05 April 2007

Published: 05 April 2007

Abstract

Background

Mycotoxins are fungal secondary metabolites commonly present in feed and food, and are widely regarded as hazardous contaminants. Citrinin, one of the very well known mycotoxins that was first isolated from Penicillium citrinum, is produced by more than 10 kinds of fungi, and is possibly spread all over the world. However, the information on the action mechanism of the toxin is limited. Thus, we investigated the citrinin-induced genomic response for evaluating its toxicity.

Results

Citrinin inhibited growth of yeast cells at a concentration higher than 100 ppm. We monitored the citrinin-induced mRNA expression profiles in yeast using the ORF DNA microarray and Oligo DNA microarray, and the expression profiles were compared with those of the other stress-inducing agents. Results obtained from both microarray experiments clustered together, but were different from those of the mycotoxin patulin. The oxidative stress response genes – AADs, FLR1, OYE3, GRE2, and MET17 – were significantly induced. In the functional category, expression of genes involved in "metabolism", "cell rescue, defense and virulence", and "energy" were significantly activated. In the category of "metabolism", genes involved in the glutathione synthesis pathway were activated, and in the category of "cell rescue, defense and virulence", the ABC transporter genes were induced. To alleviate the induced stress, these cells might pump out the citrinin after modification with glutathione. While, the citrinin treatment did not induce the genes involved in the DNA repair.

Conclusion

Results from both microarray studies suggest that citrinin treatment induced oxidative stress in yeast cells. The genotoxicity was less severe than the patulin, suggesting that citrinin is less toxic than patulin. The reproducibility of the expression profiles was much better with the Oligo DNA microarray. However, the Oligo DNA microarray did not completely overcome cross hybridization.

Background

Mycotoxins are fungal secondary metabolites commonly present in the feed and food, and are widely considered as hazardous contaminants. However, the toxicity of these natural chemicals are not properly evaluated because of the difficulties in isolating these chemicals and also because of the lack of interests as they have no industrial applications. The costs for producing the pure mycotoxins are the biggest obstacle in their evaluation process. On the other hand, development of analytical methods are needed to identify new mycotoxins, to fight against the spreading toxins, and also to meet the growing demands for the toxicological studies.

Citrinin [518-75-2], 4,6-dihydro-8-hydroxy-3,4,5-trimethyl-6-oxo-3H-2-benzopyran-7-crboxylic acid (Figure 1), which was first isolated from Penicillium citrinum [1], is produced by more than 10 kinds of fungi [1]. Citrinin is the one of the well-known mycotoxins, which is possibly spread all over the world. Although citrinin is one of the well-characterized mycotoxins, information on its mechanism of toxic action is limited. Clinically, citrinin was shown to cause renal disease in poultry, pigs, dogs and rats [2, 3]. The electron transport system of the kidney and liver mitochondria were considered as the target of the toxic action of citrinin [4].
https://static-content.springer.com/image/art%3A10.1186%2F1471-2164-8-95/MediaObjects/12864_2006_Article_808_Fig1_HTML.jpg
Figure 1

Chemical structure of citrinin.

The availability of yeast DNA microarrays provides the possibility of monitoring gene expression levels as a function of toxin exposure, and consequently, provides a mean to determine the mechanism of toxicity [5, 6]. The essential features of this yeast system are the small volume of yeast culture required for the analysis, high reproducibility of the expression profiles and availability of the massive functional information of genes on DNA microarray [7, 8]. For example, cadmium treatment was found to induce yeast genes involved in the sulfur amino acid metabolism, oxidative stress response, and heat shock response [6]. This expression pattern of induced genes was in agreement with many previous studies [6]. We applied this system to evaluate the action mechanism of patulin, one of the most potent mycotoxins, and found that patulin targets proteins and possibly DNA [7]. Our results suggested that patulin probably acts as a mutagen [7].

In this report, we studied the toxicity of citrinin to yeast cells using the traditional ORF (Open Reading Frame) DNA microarray [6] and Oligo (Oligo-nucleotide) DNA microarray systems [9]. Results from both microarray studies suggested that the oxidative stress was the main cause for toxicity, but this oxidative stress did not lead to any DNA damage. This observation was different from what was found with another mycotoxin patulin [7]. To detoxify against the citrinin, the yeast cells mainly used glutathione modification and pumped out the toxin using transporters. We have also discussed how the two DNA microarrays were adapted for evaluating the mycotoxin action.

Results

Conditions for the citrinin treatment

As a first step, we characterized the effect of citrinin on yeast growth because without any biological or physiological characterization we will not be able to prove that the induction or repression of specific genes is due to the treatment. Lack of growth inhibition would merely indicate that the conditions used for the study did not cause any cellular stress. Figure 2 shows yeast growth as a function of different concentrations of citrinin. As shown, we observed growth inhibition at concentrations greater than 108 ppm, and at 970 ppm of citrinin there was no growth. Based on this dose-response analysis, 300 ppm of citrinin was chosen for subsequent experiments, as this concentration was found to be inhibitory to non-lethal growth (data not shown). This concentration citrinin is slightly higher than that was used for the patulin treatment [7], and citrinin may be less toxic to yeast cells.
https://static-content.springer.com/image/art%3A10.1186%2F1471-2164-8-95/MediaObjects/12864_2006_Article_808_Fig2_HTML.jpg
Figure 2

Effect of citrinin on yeast growth. Citrinin dissolved in DMSO at a concentration of 20000 ppm was added to the YPD medium to achieve the indicated concentration. The stock solution was added directly to the yeast cells grown for 2–3 days such that they were diluted more than 100-fold.

Overview of citrinin induced and repressed genes through ORF DNA microarray and Oligo DNA microarray

From three independent citrinin treatment experiments, we obtained 12 sheets of DNA microarray results. Three sheets (OR-1, OR-2, OR-3 in Figure 3) were from the ORF DNA microarray, one from each citrinin treatment. For the Oligo DNA microarray, we performed three hybridizations for each experiment and obtained 9 sheets of data (OL-1-1, OL-1-2, OL-1-3, OL-2-1, OL-2-2, OL-2-3, OL-3-1, OL-3-2, OL-3-3 in Figure 3), including dye swap for the OL-1-1, OL-1-2, and OL-1-3 sheets. From the microarray data (Figure 3) we calculated the correlation factors to determine the reproducibility between the different hybridization conditions (region A in Figure 3), citrinin treatment (region B of Figure 3), dye swap (region C of Figure 3), and DNA microarray (region D in Figure 3). The correlation factors for the ORF DNA microarray were from 0.83 to 0.88. For the Oligo DNA microarrays, the correlation factors were from 0.93 to 0.99 for 9 sheets, and from 0.96 to 0.99 for the same source of total RNA (Figure 3). The correlation factors between the ORF DNA microarray and Oligo DNA microarray showed relatively low correlation factors (0.67–0.73) than those among the same type of DNA microarray. These results suggest that the reproducibility of the Oligo DNA microarray is better than those of the ORF DNA microarray (Region B in Figure 3).
https://static-content.springer.com/image/art%3A10.1186%2F1471-2164-8-95/MediaObjects/12864_2006_Article_808_Fig3_HTML.jpg
Figure 3

Correlation factors among the different experiments (same conditions but different treatments). A, Different sheets of microarray. B, Different citrinin treatment. C. Different labeling (dye swap), D, Different types of microarray. Dye swap was carried out with the OL-1-1, OL-1-2 and OL-1-3 sheets.

From the ORF DNA microarray, we obtained 5,928 ORFs exhibiting intensities over the cut-off value at least in one experiment. Among these ORFs, 155 ORFs showed more than two times higher intensity than that of the untreated control and having t-test P-value less than 0.05. In addition, 363 ORFs, having statistically different intensities from that of the control with the t-test P-value less than 0.01, were recognized as induced genes. On the other hand, 73 ORFs, having two times lower intensity than that of the untreated control and having t-test P-value less than 0.05, were recognized as repressed genes. Similarly, 471 ORFs having statistically different intensities from the control with the t-test P-value less than 0.01 were also recognized as repressed genes.

From the Oligo DNA microarray, we obtained 5,869 ORFs exhibiting intensities over the cut-off value at least in one experiment. Among these ORFs, 113 ORFs showed more than two times higher intensity than that of the untreated control and having t-test P-value less than 0.05. In addition, 801 ORFs, having statistically different intensities from the control with the t-test P-value less than 0.01, were recognized as induced genes. On the other hand, 41 ORFs, having two times lower intensity than that of the untreated control and having t-test P-value less than 0.05, were recognized as repressed genes. Similarly, 1123 ORFs were recognized as repressed genes whose intensities were statistically different from that of the control with the t-test P-value less than 0.01. Apparently, the number of induced and repressed genes (P < 0.5) were higher for the ORF DNA microarray and the number of statistically significant (P < 0.01) induced and repressed genes were higher for the Oligo DNA microarray. These differences might arise from the different numbers of data collected from the two microarrays.

Table 1 lists the highly induced genes according to their average induction values obtained from the ORF and Oligo DNA microarrays without any statistical selection. The most highly induced gene was FRM2 followed by AADs, FLR1, OYE3, GRE2, and MET17. The most abundantly induced genes were AADs. Interestingly, AADs, FLR1, OYE3, GRE2, and MET17 are the genes that are significantly induced by oxidative stress[10, 11]. The strongly repressed genes were listed in Table 2. In contrast to the highly induced genes, there was a good agreement between the degree of repression of the repressed genes from both the ORF and Oligo DNA microarray analysis. The most strongly repressed gene was YPL095C followed by ARO10, ZRT1, USV1, CWP1, and RPI1.
Table 1

List of highly induced genes by the citrinin treatment

   

ORF-Array

Oligo-Array

 

Systematic Name

Common Name

Average (Fold)

Fold

t-test P-Value

Fold

t-test P-Value

MIPS_Description

YCL026C-A

FRM2

104.0

162.4

0.002

45.7

0.000

Involved in fatty acid regulation

YFL057C

AAD16

63.5

86.1

0.003

40.8

0.000

Aryl-alcohol dehydrogenase

YFL056C

AAD6

47.0

39.8

NA*

54.2

0.000

Putative aryl-alcohol dehydrogenase,

YDL243C

AAD4

46.3

53.4

0.000

39.2

0.000

Aryl-Alcohol Dehydrogenase

YBR008C

FLR1

33.6

37.9

0.000

29.4

0.000

Putative H+ antiporter involved in multidrug resistance

YPL171C

OYE3

29.9

31.9

0.001

27.8

0.000

NAPDH dehydrogenase (old yellow enzyme), isoform 3

YOL165C

AAD15

26.6

51.3

0.000

1.9

0.000

Putative aryl alcohol dehydrogenase

YIR041W

PAU15

23.6

1.7

0.159

45.3

0.000

Similarity to members of the Srp1p/Tip1p family

YJR155W

AAD10

22.3

43.7

0.000

1.0

0.858

Putative aryl-alcohol dehydrogenase

YNL331C

AAD14

22.3

21.5

0.001

23.1

0.000

Putative aryl-alcohol dehydrogenase

YLR346C**

 

22.3

22.9

0.002

21.7

0.000

Protein of unknown function localised to mitochondria

YOL151W

GRE2

19.5

18.3

0.000

20.7

0.000

Methylglyoxal reductase (NADPH-dependent)

YCR107W

AAD3

15.0

28.4

0.000

1.6

0.000

Aryl-alcohol dehydrogenase

YLR303W

MET17

14.7

12.3

0.000

17.1

0.000

O-acetylhomoserine sulfhydrylase

YLL056C

 

13.6

16.5

0.000

10.7

0.000

Weak similarity to Y. pseudotuberculosis epimerase

YLL060C**

GTT2

13.2

13.1

0.000

13.3

0.000

Glutathione S-transferase

YOR153W*

PDR5

12.5

16.3

0.000

8.8

0.000

ABC transporter involved in multidrug resistance

YGR213C

RTA1

12.3

9.7

0.001

15.0

0.000

Integral membrane protein

YOR049C

 

12.2

11.1

0.001

13.3

0.000

Putative integral membrane transporter

YKR076W

ECM4

11.2

11.7

0.000

10.7

0.000

Involved in cell wall biogenesis and architecture

YML131W

 

10.7

9.2

0.000

12.2

0.000

Putative hydroxydehydrogenase

YKL070W**

 

10.7

9.1

0.020

12.3

0.000

Similarity to B. subtilis transcriptional regulatory protein

YIL167W

 

9.3

9.0

0.005

9.5

0.000

Serine dehydratase

* NA, Not applicable (experiment was either performed less than three times or the data was not valuable

** Names indicated in bold means the genes whose products are localized in the mitochondria

Table 2

List of strongly repressed genes by the citrinin treatment

   

ORF-Array

Oligo-Array

 

Systematic Name

Common Name

Average (Fold)

Fold

t-test P-value

Fold

t-test P-value

MIPS_Description

YPL095C

 

0.19

0.19

0.002

0.18

0.000

Hypothetical ORF

YDR380W

ARO10

0.29

0.36

0.038

0.21

0.000

Phenylpyruvate decarboxylase

YGL255W

ZRT1

0.33

0.36

0.015

0.30

0.000

High-affinity zinc transporter

YKL096W

CWP1

0.35

0.38

0.000

0.32

0.000

Cell wall mannoprotein

YIL119C

RPI1

0.37

0.28

0.028

0.46

0.000

Putative transcriptional regulator

YHL028W

WSC4

0.39

0.51

0.033

0.28

0.000

Cell wall integrity and stress response

YHR137W

ARO9

0.40

0.37

0.001

0.43

0.000

Aromatic aminotransferase

YPR194C

OPT2

0.40

0.46

0.020

0.35

0.000

Oligopeptide transporter

YMR120C

ADE17

0.41

0.41

0.007

0.41

0.000

Enzyme of 'de novo' purine biosynthesis

YAR015W

ADE1

0.42

0.31

0.002

0.54

0.000

SAICAR synthetase

YMR011W

HXT2

0.43

0.41

0.003

0.44

0.000

High-affinity glucose transporter

YPR160W

GPH1

0.44

0.41

0.018

0.47

0.000

Non-essential glycogen phosphorylase

YPL092W

SSU1

0.44

0.41

0.009

0.48

0.000

Plasma membrane sulfite pump

YBL098W

 

0.45

0.42

0.002

0.47

0.000

Kynurenine 3-mono oxygenase

YFR015C

GSY1

0.45

0.48

0.024

0.42

0.000

Glycogen synthase

YOR315W

 

0.45

0.41

0.007

0.50

0.000

Protein of unknown function,

YDL227C

HO

0.45

0.49

0.048

0.42

0.000

Site-specific endonuclease

To compare with the other stress factors, we carried out the cluster analysis of the ORF and Oligo DNA microarray expression data using the average value for each microarray. As shown in Figure 4, the expression profiles of the ORF microarray and Oligo microarray clustered together. The citrinin-induced response was very similar to that of the maneb. The citrinin-induced gene expression data did not cluster with those of the patulin, thiuram and acrolein. These results suggest that the citrinin treatment-induced response was not similar to that of the mycotoxin patulin. Thus, unlike patulin, which is known to target proteins [7, 12], citrinin might not cause protein denaturation.
https://static-content.springer.com/image/art%3A10.1186%2F1471-2164-8-95/MediaObjects/12864_2006_Article_808_Fig4_HTML.jpg
Figure 4

Cluster analysis of the mRNA expression profiles after the citrinin treatment. Hierarchical cluster analysis was performed using GeneSpring as described in the text.

Functional categogorization of citrinin induced genes

To characterize the effect of citrinin to yeast cells, the induced genes were categorized using the functional categories of MIPS. As summarized in Table 3, there were significant number of induced genes in the categories of "metabolism", "cell rescue, defense and virulence", and "energy". In addition, a high percentage of genes in these categories were found to be induced ((number of induced genes in the category/number of genes in the category) × 100). In the category of "metabolism", the subcategories of "amino acid metabolism", "nitrogen and sulfur metabolism", "metabolism of vitamins", and "secondary metabolism" were significantly induced.
Table 3

Contribution of induced genes to functional categories

  

ORF DNA microarray

OligoDNA microarray

  

F > 2 & P < 0.05*

 

P < 0.01*

 

F > 2 & P < 0.05*

 

P < 0.01*

 

Category subcategory

Total number in category

Number

%*

Number

%

Number

%

Number

%

Metabolism

1521

54

3.6

103

6.8

51

2.4

266

17.0

   amino acid metabolism

243

20

8.2

33

13.6

25

10.3

81

33.3

   nitrogen and sulfur metabolism

96

9

9.4

15

15.6

11

11.5

39

40.6

   nucleotide metabolism

227

6

2.6

12

5.3

2

0.9

22

9.7

   phosphate metabolism

414

7

1.7

15

3.6

6

1.4

55

13.3

   C-compound and carbohydrate metabolism

504

18

3.6

36

7.1

19

3.8

86

17.1

   lipid, fatty acid and isoprenoid metabolism

272

7

2.6

20

7.4

5

1.8

30

11.0

   metabolism of vitamins,

163

11

6.7

16

9.8

9

5.5

40

24.5

   secondary metabolism

77

4

5.2

7

9.1

4

5.2

19

24.7

ENERGY

365

17

4.7

34

9.3

15

4.1

59

16.2

CELL CYCLE AND DNA PROCESSING

1001

9

0.9

37

3.7

4

0.4

119

11.9

TRANSCRIPTION

1063

10

0.9

39

3.7

9

0.8

87

8.2

PROTEIN SYNTHESIS

476

3

0.6

20

4.2

1

0.2

8

1.7

PROTEIN FATE (folding, modification, destination)

1137

23

2.0

65

5.7

8

0.7

159

14.0

PROTEIN WITH BINDING FUNCTION

1034

22

2.1

54

5.2

15

1.5

134

13.0

PROTEIN ACTIVITY REGULATION

238

2

0.8

6

2.5

1

0.4

23

9.7

CELLULAR TRANSPORT

1031

33

3.2

74

7.2

18

1.7

131

12.7

CELLULAR COMMUNICATION

234

1

0.4

4

1.7

1

0.4

28

12.0

CELL RESCUE, DEFENSE AND VIRULENCE

548

31

5.7

47

8.6

28

5.1

118

21.5

INTERACTION WITH THE CELLULAR ENVIRONMEN

458

16

3.5

28

6.1

9

2.0

71

15.5

INTERACTION WITH THE ENVIRONMENT

5

0

0.0

0

0.0

0

0.0

1

20.0

TRANSPOSABLE ELEMENTS

124

1

0.8

1

0.8

0

0.0

5

4.0

DEVELOPMENT (Systemic)

70

1

1.4

4

5.7

0

0.0

7

10.0

BIOGENESIS OF CELLULAR COMPONENTS

854

11

1.3

31

3.6

6

0.7

95

11.1

CELL TYPE DIFFERENTIATION

449

3

0.7

18

4.0

2

0.4

48

10.7

UNCLASSIFIED PROTEINS

2038

37

1.8

74

3.6

23

1.1

163

8.0

Total

 

155

 

363

 

113

 

801

 
In the subcategories of "amino acid metabolism" and "nitrogen and sulfur metabolism", we found that the induced genes mainly belonged to the sulfur amino acid metabolism (Table 4). Among the 25 genes listed, 21 genes can be recognized as the induced genes in at least one of the DNA microarrays. These results strongly suggest that the citrinin-treated yeast cells require methionine or glutathione. In the subcategories of "metabolism of vitamins" and "secondary metabolism", there were no groups of genes specific for vitamins and secondary metabolism, but they merely overlapped with the genes for the sulfur amino acid metabolism.
Table 4

Glutathione and methionine metabolism related genes are induced by the citrinin treatment

   

ORF-Array

Oligo-Array

 

Systematic Name

Common Name

Average (Fold)

Fold

t-test P-value

Fold

t-test P-value

Description

YKR069W

MET1

2.6

2.3

0.002

2.9

0.000

siroheme synthase

YFR030W

MET10

3.2

1.8

0.025

4.6

0.000

sulfite reductase flavin-binding subunit

YKL001C

MET14

5.2

5.3

0.000

5.1

0.000

ATP adenosine-5^-phosphosulfate 3^-phosphotransferase

YPR167C

MET16

5.1

5.6

0.001

4.6

0.000

3^-phosphoadenylylsulfate reductase

YLR303W

MET17

14.7

12.3

0.000

17.1

0.000

O-acetylhomoserine sulfhydrylase

YNL277W

MET2

2.9

2.1

0.022

3.8

0.000

homoserine O-acetyltransferase

YOL064C

MET22

1.7

1.8

0.000

1.7

0.000

protein ser/thr phosphatase

YIR017C

MET28

4.7

2.0

0.198

7.5

0.000

transcriptional activator of sulfur amino acid metabolism

YJR010W

MET3

8.9

6.0

0.000

11.8

0.000

sulfate adenylyltransferase

YIL046W

MET30

1.1

1.2

0.203

1.1

0.147

involved in regulation of sulfur assimilation genes

YPL038W

MET31

1.0

1.2

0.151

0.9

0.004

transcriptional regulator of sulfur amino acid metabolism

YDR253C

MET32

2.7

2.2

0.004

3.3

0.000

transcriptional regulator of sulfur amino acid metabolism

YNL103W

MET4

1.0

0.7

0.102

1.2

0.001

transcriptional activator of sulfur metabolism

YER091C

MET6

2.7

2.6

0.001

2.7

0.000

homocysteine methyltransferase

YBR213W

MET8

1.4

1.2

0.460

1.6

0.000

siroheme synthase

YAL012W

CYS3

2.0

1.9

0.009

2.0

0.000

cystathionine gamma-lyase

YGR155W

CYS4

1.9

2.4

0.062

1.5

0.000

cystathionine beta-synthase

YJL101C

GSH1

2.4

2.2

0.000

2.7

0.000

glutamate – cysteine ligase

YOL049W

GSH2

1.1

0.9

0.064

1.2

0.000

Glutathione synthetase

YLR180W

SAM1

1.4

1.6

0.023

1.3

0.000

S-adenosylmethionine synthetase 1

YDR502C

SAM2

1.6

1.5

0.000

1.6

0.000

S-adenosylmethionine synthetase 2

YPL274W

SAM3

1.2

1.3

0.015

1.1

0.124

S-adenosylmethionine permease

YPL273W

SAM4

0.9

0.8

0.010

1.0

0.008

AdoMet-homocysteine methyltransferase

YJR130C

STR2

1.4

1.2

NA

1.6

0.000

Cystathionine gamma-synthase

YGL184C

STR3

2.1

1.4

0.367

2.9

0.001

cystathionine beta-lyase

* NA, Not applicable (experiment was either performed less than three times or the data was not valuable

Table 5 summarized the list of the induced genes belonging to the category of "cell rescue, defense and virulence". The significantly induced genes in this category were transporters, especially the ABC transporters. Several of these transporters – such as FLR1, PDR5, SNQ2, ATR1, and YOR1 – are involved in multi-drug resistance, and are important for the tolerance against a broad range of organic anions [1316]. It should be also noted that the GTT2 gene, which encodes the glutathione-S-transferase protein, was highly induced and the YCF1 gene, which codes for the vacuolar glutathione S-conjugate transporter, was also induced. The relatively significant induction of the genes in the "energy" category was due to the AAD s and the related genes, as these genes are categorized as the dehydrogenase (data not shown).
Table 5

List of highly induced genes in the category of "CELL RESCUE, DEFENSE AND VIRULENCE"

   

ORF-Array

Oligo-Array

 

Systematic Name

Common Name

Average (Fold)

Fold

t-test P-value

Fold

t-test P-value

Description

YBR008C

FLR1

33.6

37.9

0.000

29.4

0.000

Plasma membrane multidrug transporter

YOL151W

GRE2

19.5

18.3

0.000

20.7

0.000

NADPH-dependent methylglyoxal reductase

YLL060C

GTT2

13.2

13.1

0.000

13.3

0.000

Glutathione S-transferase

YOR153W

PDR5

12.5

16.3

0.000

8.8

0.000

Short-lived membrane ABC transporter

YGR213C

RTA1

12.3

9.7

0.001

15.0

0.000

involved in 7-aminocholesterol resistance

YHR048W

 

5.8

3.4

0.003

8.2

0.000

Hypothetical ORF

YDR011W

SNQ2

5.2

6.6

0.000

3.8

0.000

ABC transporter

YML116W

ATR1

5.2

5.5

0.000

4.8

0.000

Multidrug efflux pump of the major facilitator superfamily

YGR281W

YOR1

4.6

4.7

0.000

4.5

0.000

ABC transporter

YNL231C

PDR16

3.8

3.4

0.000

4.3

0.000

Phosphatidylinositol transfer protein

YHL040C

ARN1

3.8

3.1

0.002

4.5

0.000

Member of the ARN family of transporters

YNL160W

YGP1

3.2

2.9

0.000

3.5

0.000

May be involved in cellular adaptations prior to stationary pha

YMR038C

LYS7

3.1

3.3

0.000

3.0

0.000

Copper chaperone for superoxide dismutase Sod1p

YGR209C

TRX2

3.0

3.1

0.025

3.0

0.000

Thioredoxin

YMR173W

DDR48

2.9

3.0

0.003

2.8

0.000

DNA damage-responsive protein

YHR136C

SPL2

2.8

3.5

0.000

2.2

0.000

Protein with similarity to cyclin-dependent kinase inhibitors

YDR533C

 

2.8

3.0

0.000

2.6

0.000

Possible chaperone and cysteine protease

YER042W

MXR1

2.6

2.2

0.001

2.9

0.000

Peptide methionine sulfoxide reductase

YBL064C

 

2.5

3.0

0.000

2.1

0.000

Mitochondrial peroxiredoxin with thioredoxin peroxidase

YER185W

 

2.5

2.8

0.003

2.3

0.000

Hypothetical ORF

YDR135C

YCF1

2.5

ND*

 

2.5

0.000

Vacuolar glutathione S-conjugate transporter

YDR032C

PST2

2.5

2.6

0.005

2.4

0.000

Similarity to members of a family of flavodoxin-like proteins

YJL101C

GSH1

2.4

2.2

0.000

2.7

0.000

Gamma glutamylcysteine synthetase

* ND, Not determined

Citrinin was suggested to cause damages to the mitochondria. Table 6 lists the cellular localization of the induced gene products. It is clear that many of these gene products, which are localized in the mitochondria, were induced; however, the proportion of these induced genes among the total number of induced genes are not so high (Table 6, Impact). The degrees of impact values of induced genes in the mitochondria from both the microarrays were very similar to the degree of impact value of the total genes in the entries (Table 6). Although our results suggest that citrinin affected mitochondria, but we can not say that the citrinin toxicity is specific to mitochondria. In the list of highly induced genes (Table 1), the YLR346C, GTT2, PDR5, and YKL070W genes (shown in bold in Table 1) were counted as the gene products localized in the mitochondria. As these genes are also expressed in other organelles and are not specific to mitochondrial function, our results suggest that the effect of citrinin on mitochondria is true but not specific.
Table 6

Localization of the citrinin-induced gene products

   

ORF DNA microarray

OligoDNA microarray

 

Entries

F > 2 & P < 0.05

P < 0.01

F > 2 & P < 0.05

P < 0.01

Localization

Number

Impact*

Number

Impact

Number

Impact

Number

Impact

Number

Impact

extracellular

54

1.0

2

1.4

6

1.8

4

3.9

10

1.4

bud

149

2.9

3

2.2

5

1.5

0

0.0

13

1.8

cell wall

42

0.8

1

0.7

4

1.2

3

2.9

7

1.0

cell periphery

216

4.1

11

8.0

20

5.9

8

7.8

30

4.2

plasma membrane

186

3.6

8

5.8

18

5.3

5

4.9

29

4.1

integral membrane/endomembranes

176

3.4

10

7.2

14

4.2

7

6.9

23

3.2

cytoplasm

2906

55.8

94

68.1

191

56.7

76

74.5

449

63.2

cytoskeleton

204

3.9

3

2.2

5

1.5

2

2.0

25

3.5

ER

557

10.7

13

9.4

57

16.9

8

7.8

92

13.0

golgi

132

2.5

2

1.4

8

2.4

1

1.0

16

2.3

transport vesicles

139

2.7

2

1.4

6

1.8

0

0.0

13

1.8

nucleus

2157

41.4

49

35.5

129

38.3

35

34.3

304

42.8

mitochondria

1056

20.3

33

23.9

77

22.8

21

20.6

149

21.0

peroxisome

52

1.0

2

1.4

3

0.9

0

0.0

5

0.7

endosome

57

1.1

1

0.7

5

1.5

1

1.0

10

1.4

vacuole

280

5.4

14

10.1

27

8.0

8

7.8

47

6.6

microsomes

5

0.1

0

0.0

0

0.0

0

0.0

1

0.1

lipid particles

27

0.5

2

1.4

4

1.2

1

1.0

3

0.4

punctate composite

141

2.7

5

3.6

9

2.7

4

3.9

15

2.1

ambiguous

237

4.5

6

4.3

18

5.3

4

3.9

37

5.2

KNOWN LOCALIZATION

5209

100

138

100

337

100

102

100

710

100

UNKNOWN LOCALIZATION

1516

 

17

 

26

 

11

 

91

 

The functional categories of the repressed genes were also characterized (data not shown). As often seen with the stressed cells, the category of genes involved in "Protein synthesis" were significantly repressed but other significant character was not observed. The repression of the genes in the category of "Protein synthesis" can be the experimental marker, as this functional group is required for the actively growing cells, and not for the slowly growing or growth inhibited cells [17].

Confirmation of the significantly affected genes and evaluation of both DNA microarrays

Except the AAD15, AAD10, AAD3, and PAU15, the highly induced genes were common between the ORF DNA microarray and Oligo DNA microarray. The AAD genes have strong similarity to each other and this caused cross hybridization in the ORF DNA microarray [18]. Some of the highly induced AAD genes could cross hybridize to the ORF DNA microarray spots corresponding to the AAD15, AAD10, and AAD3. To confirm which AAD gene was really induced, we performed RT-PCR analysis. As shown in Figure 5, citrinin treatment induced the AAD4, AAD6, and AAD16 genes, but not the AAD3, AAD10, AAD14, and AAD15 genes. Thus, the induction of the AAD 4, AAD6, and AAD16 genes, as observed by both microarray analysis, were correct whereas the induction of the AAD3, AAD10, AAD14, and AAD15 genes in ORF DNA microarray and the induction of the AAD14 in Oligo DNA microarray were due to cross hybridization. We confirmed that the AAD14 probe has only one mismatch to the AAD4 ORF, and the apparent induction of the AAD14 was due to the cross hybridiztion to the AAD4. In the Oligo DNA microarray, it seems that the cross hybridization has a limit of one miss match. The PAU15 gene was also highly induced by citrinin treatment in Oligo DNA microarray. This gene has high similarity to other PAU genes, which were not induced. We, however, could not confirm the induction of the PAU genes by RT-PCR. Thus, the apparent induction of the PAU15 was most likely due to the cross hybridization with some highly induced unknown gene.
https://static-content.springer.com/image/art%3A10.1186%2F1471-2164-8-95/MediaObjects/12864_2006_Article_808_Fig5_HTML.jpg
Figure 5

Confirmation of gene induction by RT-PCR. The RT-PCR analysis was performed using the primers described in Methods. Names of the genes are shown below the images.

Discussion

Mycotoxins are fungal secondary metabolites that may be toxic to all kinds of organisms. So far, a few hundreds of mycotoxins are identified and this number can increase dramatically with the development of analytical equipment. Mycotoxins are naturally occurring chemicals. The large-scale production and industrial applications of these mycotoxins are limited, because the purification of these mycotoxins are costly and inadequate. Therefore, only a few mycotoxins were studied in detail. The DNA microarray technology provides an alternative evaluation tool to examine chemical toxicity in organisms. Particularly, the yeast DNA microarray is appropriate for evaluating the action of the mycotoxin because of the less amount of toxin required in this assay and good reproducibility of the expression profile.

Citrinin is the one of the well known mycotoxins produced by Penicillium and Aspergillus family and is possibly spread all over the world [1]. The yeast-based ORF DNA microarray and Oligo DNA microarray can provide information on the possible mechanisms of toxicity and detoxification effort by yeast cells. The list of highly induced genes in citrinin-treated yeast cells (Table 1) clearly shows that the AADs, OYE3, MET17, and GRE2 genes, which are typical indicator genes for the oxidative stress [10, 11], are highly induced. Thus, we can conclude that citrinin treatment causes oxidative stress. Previously, Delneli et al. [10] analyzed several AAD deletion mutants and suggested that only AAD6 and AAD4 were induced by oxidative stress. Our RT-PCR results however suggest the AAD16 gene is induced. Except oxidative stress, we could not find any other cell repair response. It was suggested that citrinin causes damage to the mitochondria. However, we could not confirm that citrinin specifically affects mitochondria. Mitochondria can be the source of oxidative stress. Thus, it is possible that the oxidative stress caused by citrinin could enhance the self-induced oxidative damages in mitochondria. The mycotoxin patulin produced response in yeast cells that was similar to that of the citrinin, as the oxidative stress related genes were also induced by patulin treatment [7]. In addition, the patulin treatment strongly induced the genes contributing to the protein metabolism and DNA repair, and patulin was considered as a natural mutagenic chemical [7]. However, in comparison to the patulin treatment, the citrinin treatment did not induce the genes contributing to DNA repair (Table 7). Except the oxidative stress, citrinin did not show any significant toxicity to yeast cells. The less toxicity of citrinin than the patulin was also reported in other organisms [19].
Table 7

Comparison of the patulin – and citrinin-induced genes contributing to DNA repair

 

Fold Induction

  

Systematic Name

Patulin

Citrinin

Common Name

MIPS_Description

YDL059C

5.7

1.8

RAD59

Recombination and DNA repair protein

YGL163C

5.3

1.0

RAD54

DNA-dependent ATPase of the Snf2p family

YGR209C

4.4

3.0

TRX2

Thioredoxin II

YDR092W

4.0

1.2

UBC13

E2 ubiquitin-conjugating enzyme

YER142C

3.9

1.5

MAG1

3-methyladenine DNA glycosylase

YHL024W

3.7

1.1

RIM4

No sporulation

YFL014W

3.7

0.9

HSP12

Heat shock protein

YPR193C

3.7

1.2

HPA2

Histone and other Protein Acetyltransferase

YKL145W

3.5

1.3

RPT1

26S proteasome regulatory subunit

YMR173W

3.4

2.9

DDR48

Heat shock protein

YAR007C

3.4

1.0

RFA1

DNA replication factor A, 69 KD subunit

YPL194W

3.1

1.1

DDC1

DNA damage checkpoint protein

YLR043C

3.0

1.4

TRX1

Thioredoxin I

YOR023C

2.9

1.0

AHC1

Component of the ADA histone acetyltransferase comple

YEL037C

2.8

1.1

RAD23

Nucleotide excision repair protein (ubiquitin-like protein)

YMR302C

2.8

0.9

PRP12

Involved in early maturation of pre-rRNA

YNL312W

2.7

1.2

RFA2

DNA replication factor A, 36 kDa subunit

YIL143C

2.7

1.1

SSL2

DNA helicase

YJR052W

2.6

1.1

RAD7

Nucleotide excision repair protein

YOL068C

2.4

0.7

HST1

Silencing protein

YGR231C

2.4

1.0

PHB2

Prohibitin

YPR023C

2.3

1.2

EAF3

Esa1p-associated factor

YML032C

2.3

1.1

RAD52

Recombination and DNA repair protein

YIR025W

2.2

1.2

MND2

Subunit of anaphase-promoting complex

YGL201C

2.1

1.0

MCM6

Involved in replication

YMR201C

2.1

0.9

RAD14

Nucleotide excision repair protein

YNL250W

2.0

1.2

RAD50

DNA repair protein

YCR086W

2.0

1.5

CSM1

Involved in nuclear migration

Contrast to the information concerning the mechanism of citrinin-induced toxicity, information on the detoxification mechanism was clear. The activation of the methionine and glutathione metabolisms (Table 4) strongly suggest the contribution of glutathione in the detoxification process. Moreover, strong induction of the DTT2 gene implies direct transfer of glutathione to citrinin. As the PDR s were also strongly induced (Table 5), it may be possible that the ABC transporters were involved in pumping out the citrinin-glutathione complex. Pumping out the toxin after glutathione modification is one of the main detoxification pathway used by many organism [19].

During the process of evaluating the citrinin toxicity, we also compared reproducibility of the ORF DNA microarray and Oligo DNA microarray. The Oligo DNA microarray showed higher correlation factor than the ORF DNA microarray (region B in Figure 2). This may have resulted from the cross hybridization exampled by AAD s. The apparent induction of the AAD s in the ORF DNA microarray was due to cross hybridization [7]. The Oligo DNA microarray showed less cross hybridization, as the expression levels of most of the AAD s obtained from this assay agreed with the RT-PCR results. However, the Oligo DNA microarray may have limits in terms of specificity, as the AAD14 gene, which has one mismatch with the AAD4 gene, was recognized as the induced gene. On the other hand, the PAU15 gene was not recognized as the induced gene by the ORF DNA microarray and RT-PCR, but was recognized as induced gene by the Oligo DNA microarray. If the RT-PCR results were correct, these results suggest that the high specificity may not always produce correct results. Although the Oligo DNA microarray did not completely overcome the cross hybridization in the case of single mismatch, it is still a useful tool for detecting gene expression differences between similar genes.

Conclusion

Citrinin caused growth inhibition in yeast cells at a concentration more than 100 ppm. Under this condition, we monitored the citrinin treatment-induced response using the ORF DNA microarray and Oligo DNA microarray. Results obtained from these microarray experiments suggest that citrinin induced oxidative stress in the yeast cells. The citrinin-induced genotoxicity was less severe than that of the patulin. Thus, citrinin is a less toxic substance than patulin. The expression profiles obtained from both types of DNA microarrays were essentially similar. The reproducibility of the expression profiles were much better and the cross hybridization was less with the Oligo DNA microarray.

Methods

Strain, growth conditions, and citrinin treatment

Saccharomyces cerevisiae strain S288C (Mat alpha SUC2 mal mel gal2 CUP1) was grown in YPD medium (2% polypeptone, 1% yeast extract, 2% glucose) at 25°C as a pre-culture for 2–3 days. This strain was used because the ORF DNA microarray probes were produced using the S288C DNA as the template for PCR [6] and because Oligo DNA microarray probes were designed based on the DNA sequence of this strain [20]. Citrinin was purchased from MP Biochemicals (Irvine, CA, USA) and was dissolved in DMSO (Dimethyl sulfoxide) to prepare a stock solution of 20000 ppm. To monitor the dose response of citrinin to yeast cells, the stock solution was added directly to the YPD medium containing the yeast cells such that they were diluted more than 100-fold. For the DNA microarray analysis, yeast cultures in YPD were diluted and grown overnight to an optical density (OD660) of 1.0. The citrinin stock solution was added to the cultures and yeast cells were allowed to grow for an additional 2 h. For the control cells, the same volume of DMSO was added to the yeast culture and this was incubated for 2 h. Cells were harvested by centrifugation and stored at -80°C until used.

DNA microarray analysis

DNA microarray analysis was carried out on three independent cultures and total RNA was isolated by the hot-phenol method as described previously [21].

For the ORF type DNA microarray, yeast DNA microarray Ver. 2.0 (DNA Chip Research, Inc., Yokohama, Japan) was used and the hybridization was performed using the dual color method. The Cy3- or Cy5-labeled cDNA pools were synthesized by CyScribe First-Strand cDNA Labeling Kit (GE Healthcare UK Ltd., Buckinghamshire, England). On this microarray, a total of 6,037 kinds of amplified ORFs with 200–8,000 bp length (0.1–0.5 ng) were spotted. The Cy3- or Cy5-labeled aRNA mixed pools were hybridized for 24–36 h at 65°C. The details of our conditions for the microarray procedure and validation studies were previously described [68, 21, 22].

For the Oligo DNA microarray, 3D-Gene Yeast Oligo Chip 6K (Toray Industries Inc., Tokyo, Japan/DNA Chip Research, Inc., Yokohama, Japan) was used. For efficient hybridization, this microarray has 3-dimensions that is constructed with a well as the space between the probes and cylinder-stems with 30-mer oligonucleotide probes on the top. Total RNA was labeled with Cy3- or Cy5- using the Amino Allyl MessageAMP II aRNA Amplificatin Kit (Applied Biosystems, CA, U.S.A.). The Cy3- or Cy5-labeled aRNA pools and hybridization buffer containing micro beads were mixed, and hybridized for 16 h. The hybridization was performed using the supplier's protocols.

Data analysis

Detected signals for each ORF were normalized by the intensity dependent (LOWESS) methods [23]. The cutoff values were the intensity of the background average plus 2SD. Genes were characterized for function according to the functional categories established by MIPS [24] and the SGD [25]. The data obtained in this experiment have been assigned accession number GSE6118 in the Gene Expression Omnibus Database [26].

Hierarchical cluster analysis was performed using the GeneSpring ver. 7.3.1 software (Silicon Genetics, CA, USA). The clustering algorithm arranges conditions according to their similarity in the expression profiles across all conditions, such that conditions with similar patterns are clustered together as in a taxonomic tree. Data from 3874 genes were used for the calculation. These 3874 genes were selected on the basis of having previously exhibited higher than average intensities in another trial [21].

RT-PCR

A reverse transcriptase-polymerase chain reaction (RT-PCR) was carried out to confirm the result of the microarray experiments for the genes showing different patterns of expression between the ORF type microarray and the oligo probe microarray. The primers for the AADs were described previously [7]. The primers for the PAU s are:

PAU15 (YIR041W),

CTTGTTTCAAGCAGCTCATCCAAGT and ATGGAATCTCATTCGTAAAGGCATG; PAU16(YKL224C),

CTTGTTTCAAGCAGCTCATCCAAGT and CATATTCATAAAATGCTTCACG; PAU21/22 (YOR394W, YPL282C),

TACCAGATTGAGACCGGCTATC and TACTCCACAAACACTGTTATTG; and

PAU17 (YLL025W),

GAGCTCATTTGGCTGAATACTATATG and TGCAGATAGAGCGCTGGAGATG. Total RNA prepared for the microarray analysis was used as template for the RT-PCR experiments. Reverse transcriptase reaction was performed using the StrataScript First-Strand Synthesis System (STRATAGENE, CA, USA). The cDNA mixture was diluted 20 times, and 2 μl of the diluted solution was used for a 20 μl PCR reaction using the TaKaRa Ex Taq HS (TaKaRa, Shiga, Japan). Annealing temperature was originally set at 55°C. However, the PAU s showed multiple bands at 55°C and annealing temperature was increased to 61°C. Each amplification reaction was resolved on a 2% agarose gel and the DNA bands were visualized with EtBr staining.

Abbreviations

ORF: 

open reading frame

Oligo: 

oligo-nucleotide

MIPS: 

Munich Information Center for Protein Sequences

SGD: 

Yeast Genome Database

DMSO: 

Dimethyl sulfoxide

RT-PCR: 

reverse transcriptase-polymerase chain reaction

Declarations

Acknowledgements

This work was supported by government-subsidized grants to AIST and NFRI.

Authors’ Affiliations

(1)
Human Stress Signal Research Center, National Institute of Industrial Science and Technology, AIST
(2)
DNA Chip Research Inc.
(3)
Toray Industries, Inc
(4)
Toray Industries, Inc
(5)
National Food Research Institute, NFRI

References

  1. Bennett JW, Klich M: Mycotoxins. Clin Microbiol Rev. 2003, 16: 497-516. 10.1128/CMR.16.3.497-516.2003.PubMed CentralPubMedView Article
  2. Yu FY, Liao YC, Chang CH, Liu BH: Citrinin induces apoptosis in HL-60 cells via activation of the mitochondrial pathway. Toxicol Lett. 2006, 161: 143-151. 10.1016/j.toxlet.2005.08.009.PubMedView Article
  3. Reiss J: Mycotoxins in foodstuffs X. Production of citrinin by Penicillium chrysogenum in bread. Food Cosmet Toxicol. 1977, 15: 303-307. 10.1016/S0015-6264(77)80201-0.PubMedView Article
  4. Da Lozzo EJ, Oliveira MB, Carnieri EG: Citrinin-induced mitochondrial permeability transition. J Biochem Mol Toxicol. 1998, 12: 291-297. 10.1002/(SICI)1099-0461(1998)12:5<291::AID-JBT5>3.0.CO;2-G.PubMedView Article
  5. Lettieri T: Recent applications of DNA microarray technology to toxicology and ecotoxicology. Environ Health Perspect. 2006, 114: 4-9.PubMed CentralPubMed
  6. Momose Y, Iwahashi H: Bioassay of cadmium using a DNA microarray: genome wide expression patterns of Saccharomyces cerevisiae response to cadmium. Environ Toxicol Chem. 2001, 20: 2533-2360. 10.1897/1551-5028(2001)020<2353:BOCUAD>2.0.CO;2.View Article
  7. Iwahashi Y, Hosoda H, Park J, Lee J, Suzuki Y, Kitagawa E, Murata S, Jwa N, Gu M, Iwahashi H: Mechanisms of patulin toxicity under the condition that cause growth inhibition to yeast cells. J Agri Food Chem. 2006, 54: 1936-1942. 10.1021/jf052264g.View Article
  8. Mizukami S, Suzuki Y, Kitagawa E, Iwahashi H: Standardization of cDNA microarray technology for toxicogenomics; essential data for initiating cDNA microarray studies. Chem Bio Info J. 2004, 4: 38-55. 10.1273/cbij.4.38.
  9. Nagino K, Nomura O, Takii Y, Myomoto A, Ichikawa M, Nakamura F, Higasa M, Akiyama H, Nobumasa H, Shiojima S, Tsujimoto G: Related Articles, Links Ultrasensitive DNA chip: gene expression profile analysis without RNA amplification. J Biochem (Tokyo). 2006, 139: 697-703.View Article
  10. Delneri D, Gardner DC, Oliver SG: Analysis of the seven-member AAD gene set demonstrates that genetic redundancy in yeast may be more apparent than real. Genetics. 2006, 153: 1591-600.
  11. Iwahashi H: Yeast genes that star in the cross protection against enivironmental stress. Cryobiol Cryotech. 2006, 52: 55-59.
  12. Kitagawa E, Takahashi J, Momose Y, Iwahashi H: Effects of the pesticide thiuram: genome-wide screening of indicator genes by yeast DNA microarray. Environ Sci Technol. 2002, 36: 3908-3915. 10.1021/es015705v.PubMedView Article
  13. Broco N, Tenreiro S, Viegas CA, Sa-Correia I: FLR1 gene (ORF YBR008c) is required for benomyl and methotrexate resistance in Saccharomyces cerevisiae and its benomyl-induced expression is dependent on pdr3 transcriptional regulator. Yeast. 1999, 15 (15): 1595-608. 10.1002/(SICI)1097-0061(199911)15:15<1595::AID-YEA484>3.0.CO;2-6.PubMedView Article
  14. Anderson JB, Sirjusingh C, Parsons AB, Boone C, Wickens C, Cowen LE, Kohn LM: Mode of selection and experimental evolution of antifungal drug resistance in Saccharomyces cerevisiae. Genetics. 2003, 163: 1287-98.PubMed CentralPubMed
  15. Goffeau A, Park J, Paulsen IT, Jonniaux JL, Dinh T, Mordant P, Saier MH: Multidrug-resistant transport proteins in yeast: complete inventory and phylogenetic characterization of yeast open reading frames with the major facilitator superfamily. Yeast. 1997, 13: 43-54. 10.1002/(SICI)1097-0061(199701)13:1<43::AID-YEA56>3.0.CO;2-J.PubMedView Article
  16. Katzmann DJ, Hallstrom TC, Voet M, Wysock W, Golin J, Volckaert G, Moye-Rowley WS: Expression of an ATP-binding cassette transporter-encoding gene (YOR1) is required for oligomycin resistance in Saccharomyces cerevisiae. Mol Cell Biol. 1995, 15: 6875-83.PubMed CentralPubMedView Article
  17. Liu BH, Yu FY, Wu TS, Li SY, Su MC, Wang MC, Shih SM: Evaluation of genotoxic risk and oxidative DNA damage in mammalian cells exposed to mycotoxins, patulin and citrinin. Toxicol Appl Pharmacol. 2005, 191: 255-63. 10.1016/S0041-008X(03)00254-0.View Article
  18. Ballatori N, Hammond CL, Cunningham JB, Krance SM, Marchan R: Molecular mechanisms of reduced glutathione transport: role of the MRP/CFTR/ABCC and OATP/SLC21A families of membrane proteins. Toxicol Appl Pharmacol. 2005, 204: 238-55. 10.1016/j.taap.2004.09.008.PubMedView Article
  19. Cole SP, Deeley RG: Transport of glutathione and glutathione conjugates by MRP1. Trends Pharmacol Sci. 2006, 27: 438-46. 10.1016/j.tips.2006.06.008.PubMedView Article
  20. Yamada T, Morishita S: Computing Highly Specific and Noise Tolerant Oligomers Efficiently. Journal of Bioinformatics and Computational Biology. 2004, 2: 21-46. 10.1142/S0219720004000454.PubMedView Article
  21. Murata Y, Watanabe T, Sato M, Momose Y, Nakahara T, Oka S, Iwahashi H: DMSO exposure facilitates phospholipid biosynthesis and cellular membrane proliferation in yeast cells. J Biol Chem. 2003, 278: 33185-33193. 10.1074/jbc.M300450200.PubMedView Article
  22. Mizukami S, Suzuki Y, Kitagawa E, Momose Y, Kim H, Iwahashi H: Construction of a Data Dependent Analysis (DDA) yeast cDNA microarray experiment for use in toxicogenomcs. Envir Sci. 2004, 11: 325-335.
  23. GeneSpring Analysis Platform. [http://​www.​silicongenetics.​com/​cgi/​SiG.​cgi/​index.​smf]
  24. Munich Information Center for Protein Sequences. [http://​mips.​gsf.​de/​]
  25. Yeast Genome Database. [http://​www.​yeastgenome.​org/​]
  26. Gene Expression Omnibus Database. [http://​www.​ncbi.​nlm.​nih.​gov/​geo/​]

Copyright

© Iwahashi et al; licensee BioMed Central Ltd. 2007

This article is published under license to BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://​creativecommons.​org/​licenses/​by/​2.​0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Advertisement