Open Access

High-throughput sequencing of Medicago truncatula short RNAs identifies eight new miRNA families

  • Gyorgy Szittya1,
  • Simon Moxon2,
  • Dulce M Santos3,
  • Runchun Jing1,
  • Manuel PS Fevereiro3,
  • Vincent Moulton2 and
  • Tamas Dalmay1Email author
Contributed equally
BMC Genomics20089:593

DOI: 10.1186/1471-2164-9-593

Received: 19 August 2008

Accepted: 09 December 2008

Published: 09 December 2008

Abstract

Background

High-throughput sequencing technology is capable to identify novel short RNAs in plant species. We used Solexa sequencing to find new microRNAs in one of the model legume species, barrel medic (Medicago truncatula).

Results

3,948,871 reads were obtained from two separate short RNA libraries generated from total RNA extracted from M. truncatula leaves, representing 1,563,959 distinct sequences. 2,168,937 reads were mapped to the available M. truncatula genome corresponding to 619,175 distinct sequences. 174,504 reads representing 25 conserved miRNA families showed perfect matches to known miRNAs. We also identified 26 novel miRNA candidates that were potentially generated from 32 loci. Nine of these loci produced eight distinct sequences, for which the miRNA* sequences were also sequenced. These sequences were not described in other plant species and accumulation of these eight novel miRNAs was confirmed by Northern blot analysis. Potential target genes were predicted for most conserved and novel miRNAs.

Conclusion

Deep sequencing of short RNAs from M. truncatula leaves identified eight new miRNAs indicating that specific miRNAs exist in legume species.

Background

Gene expression is regulated at several layers in plants to ensure optimal temporal and spatial accumulation of proteins. One of the latest discovered regulatory layers involves short RNA (sRNA) molecules 21–24 nucleotides in length that act post-transcriptionally [1]. There are surprisingly many different sRNAs in plant cells indicating an extensive role for these molecules [2]. Plant sRNAs are produced from double stranded RNA (dsRNA) by one of the four Dicer-like proteins (DCL1-4). The different DCL proteins process dsRNAs generated by diverse pathways [1]. MicroRNAs (miRNAs) are produced from partially complementary dsRNA precursor molecules (pre-miRNA) [3]. Pre-miRNAs are originally single stranded RNAs with hairpin structures and recognized by DCL1 [4]. The other large class of plant sRNAs is small interfering RNAs (siRNAs). siRNAs are processed from dsRNAs usually generated by one of the RNA Dependent RNA Polymerases (RDRs). Trans-acting siRNA (ta-siRNAs) precursors are generated by RDR6 [5, 6] and heterochromatin siRNA precursors are made by RDR2 [7]. Another group of siRNAs, the natural antisense siRNAs (nat-siRNAs), are processed from dsRNA produced by overlapping antisense mRNAs [8].

MiRNAs are the best characterized sRNAs in plants [9]. The primary transcript (pri-miRNA) is transcribed by RNA polymerase II and contains an imperfect hairpin structure. DCL1 trims this hairpin structure producing the pre-miRNA and then a second cleavage by DCL1 produces the miRNA/miRNA* duplex [10]. This molecule has a two nucleotide 3' overhang at each side of the duplex and contains a few mismatches [9]. One of the strands of the miRNA/miRNA* duplex is integrated into RISC (RNA induced silencing complex). This strand is called mature miRNA and the partially complementary miRNA* strand gets degraded, although in most cases the miRNA* strand also accumulates at a lower level [9]. RISC finds specific mRNAs because the incorporated mature miRNA can anneal to partially complementary target sites [3]. Target sites show near perfect matches to plant miRNA sequences and initially it was thought that all target mRNAs are cleaved by RISC [3]. Recently it was shown that the translation of plant mRNAs is also suppressed without a cleavage [11].

Most plant miRNA families have been identified by traditional Sanger sequencing method in model species with known genome sequences (Arabidopsis, rice and poplar) and most miRNAs are conserved across plant families [12]. However, some miRNAs are species/family specific and Allen et al. [13] suggested that these "young" miRNAs have evolved recently, in contrary to the conserved miRNAs ("old" miRNAs). Since non-conserved miRNAs are often accumulated at a lower level than conserved miRNAs, traditional small-scale sequencing primarily reveals conserved miRNAs. Establishment of high-throughput technologies has allowed the identification of several non-conserved or lowly expressed miRNAs through deep sequencing, e.g. in Arabidopsis, wheat and tomato [1417]. Here we describe the deep sequencing of short RNAs extracted from M. truncatula leaves and the experimental validation of eight novel miRNAs.

Results

Deep sequencing of M. truncatula short RNAs

Two separate cDNA libraries of short RNAs were generated from Medicago truncatula leaves and both libraries were sequenced by Solexa (Illumina). The first PCR product was quantified by nanodrop and 5 pM was loaded to Solexa, which yielded 5942 clusters and 872,048 sequence reads. The second sample was also quantified on polyacrylamide gel because the capacity of Solexa is higher than this. Since the nanodrop gave an approximately 50 times higher concentration than quantification on a gel we concluded that the nanodrop overestimates the concentration of the PCR product. To obtain more sequences, we loaded four times of the amount that we would have loaded based only on the nanodrop reading and this yielded 23301 clusters and 3,076,823 sequence reads. It is worth mentioning that loading based on only quantification on gel would have led to overloading the Solexa and would have produced many but unreliable sequences.

The two sets of reads were combined and analysed together (Table 1) using the miRCat pipeline we have developed earlier [18]. The size distribution of sequence reads showed that the 24 nt class was the most abundant group of sRNAs followed by the 21 nt sequences and then the 23, 22 and 20 nt reads (Figure 1). The almost four million reads represented 1,563,959 distinct sequences suggesting that the library is still not saturated. Out of the four million reads 2,168,937 matched to the genome without any mismatches, representing 619,175 sequences.
https://static-content.springer.com/image/art%3A10.1186%2F1471-2164-9-593/MediaObjects/12864_2008_Article_1786_Fig1_HTML.jpg
Figure 1

Size distribution of sequenced short RNAs.

Table 1

Distribution of short RNAs

 

Number of reads

Number of distinct sequences

Total

3948871

1563959

Mapping to the genome without a mismatch

2168937

619175

Known miRNAs (exact match)

174504

25

New miRNA candidates With sequenced miRNA*

3370

8

New miRNA candidates With sequenced miRNA*

1272

18

Number of reads and distinct sequences are shown of different categories of sequences.

Conserved miRNAs

First we looked for known miRNAs by comparing our library to known miRNAs from other plant species. 174,504 reads corresponding to 25 conserved miRNA families showed perfect matches to known miRNAs. We analysed the number of reads for conserved miRNAs and miR156, 159 and 166 were represented most frequently in the library (Table 2). Allowing one or two mismatches between sequences in our library and sequences in miRBase increased the number of conserved miRNA families in M. truncatula to 31 (Table 2). Next we predicted target genes and putative targets were identified for 27 out of 31 conserved families (Additional File 1). No targets were found in M. truncatula for miR163, miR169, miR394 and miR894. We found homologs of known miRNA target genes for several conserved M. truncatula miRNAs, such as SBP for miR156, NAC for miR160, AGO1 for miR168, bZIP for miR165, GRAS for miR171, AP2 for miR172 and low affinity sulphur transporter for miR395. On the other hand we predicted many genes with unknown function and hypothetical genes for miRNA targeting (Additional File 1) and careful analysis of these potential targets will contribute to our understanding of the role of miRNAs in legume plants.
Table 2

Conserved miRNAs

miR

Exact

Shorter

Longer

1 mismatch

2 mismatches

Total

miR156

37580

5944

1112

14906

11423

70965

miR157

0

0

0

0

206

206

miR158

14

1

3

3

1

22

miR159

32003

30842

5825

1887

2454

73011

miR160

89

35

19

7

7

157

miR161

2

0

0

0

0

2

miR162

49

4

7

9

3

72

miR163

6

4

0

0

0

10

miR164

11815

794

210

639

213

13671

miR165

256

129

49

56

59

549

miR166

56402

12792

6349

1276

8253

85072

miR167

2729

623

420

114

133

4019

miR168

4404

429

173

338

159

5503

miR169

83

39

173

13

25

333

miR171

26

30

5

21

30

112

miR172

195

53

91

39

29

407

miR173

6

2

0

0

0

8

miR319

27322

944

3414

1075

1076

33831

miR390

729

154

32

55

43

1013

miR393

20

2

1

2

2

27

miR394

0

1

70

0

25

96

miR395

0

42

0

0

34

76

miR396

453

1279

158

41

466

2397

miR397

0

1

0

0

0

1

miR398

20

15

3

2

1

41

miR399

2

2

0

0

0

4

miR400

1

0

0

0

0

1

miR403

0

1

0

0

0

1

miR408

293

22

10

35

25

385

miR828

0

0

1

1

0

2

miR894

5

1

103

2

38

149

Total

174504

54185

18228

20521

24705

292143

Number of reads are shown for sequences that are similar to conserved miRNAs identified in other species. Figures are shown separately for sequences with exact matches and length, exact matches but shorter or longer than known miRNAs and for sequences with one or two mismatches to known miRNAs.

Novel miRNAs

The flanking regions of the 2,168,937 sequence reads matching the genome were subjected to secondary structure analysis. We used the strict criteria suggested by Jones-Rhoades et al. [9] to identify potential miRNA loci. 32 short RNA producing loci corresponding to 26 sequence reads could be folded into step-loop structures (Additional File 2). Nine of these loci produced eight distinct sequences, for which we also sequenced the miRNA* sequences (Table 3). These eight sequences were considered as novel legume specific miRNAs based on Rajagopalan et al. [15], who demonstrated that loci producing sequenced mature miRNAs and miRNA* sequences are miRNA loci. The other 23 loci producing 18 sRNAs were considered as putative new miRNA genes since at the moment there is not sufficient evidence to classify them as miRNA genes. Accumulation of all eight new miRNAs and most miRNA*s were validated by Northern blot analysis (Figure 2).
https://static-content.springer.com/image/art%3A10.1186%2F1471-2164-9-593/MediaObjects/12864_2008_Article_1786_Fig2_HTML.jpg
Figure 2

Expression of new miRNAs. Total RNA from stems and leaves of M. truncatula was analysed by Northern blot. The numbers correspond to ID numbers in Table 3. Size markers (19 and 24 nt RNA oligonucleotides) are shown on the left. The membranes were also hybridised with a probe specific to U6 [17].

Table 3

Potential new miRNA genes

sRNA

Chr

Start

No reads

Sequence

N. blot

miRNA*

miR2086

MtChr2

22878303

1164

GACATGAATGCAGAACTGGAA

+

Yes

C2

MtChr5

23546032

485

TGAGAATGTTAGATACGGAAC

-

No

miR1510b

MtChr5

17425793

721

ACATGGTCGGTATCCCTGGAA

+

Yes

miR1507

MtChr8

34001142

1170

CCTCGTTCCATACATCATCTAG

+

Yes

C5_1

MtChr4

10481611

414

GGTCCCCGGCAGCGGCGCCA

-

No

C5_2

MtChr4

10570962

414

GGTCCCCGGCAGCGGCGCCA

-

No

C5_3

MtChr4

10515784

414

GGTCCCCGGCAGCGGCGCCA

-

Yes

miR1510a

MtChr5

17429726

170

CGGAGGATTAGGTAAAACAAC

+

No

C7

MtChr2

13077141

50

AAAAGAATACTCATACATAACATT

+

No

C8

MtChr7

2887662

29

TGTAAGGGATGATGCAAATGAGAG

+

No

C9_1

MtChr2

6722889

28

AGGGTGCTTAGATATAGGGACGGA

+

No

C9_2

MtChr8

2492462

28

AGGGTGCTTAGATATAGGGACGGA

+

No

C9_3

MtChr8

10174192

28

AGGGTGCTTAGATATAGGGACGGA

+

No

miR1509

MtChr7

31515912

90

TTAATCTAGGAAAATACGGTG

+

Yes

C12

MtChr2

26140680

19

GAAAGGACTAAAACCAGGAACGGA

-

No

C13

MtChr2

25488088

24

TACGCAGGAGAGATGATGCCG

-

No

C14

MtChr5

28947435

44

CTTGGACTTCAAGAAACAAC

-

No

miR2087

MtChr2

9824368

35

GAAGTAAAGAACCGGCTGCAG

+

Yes

C16

MtChr1

29344468

38

TAACTGCCGAGGCGTGCTGA

-

No

C17

MtChr4

20677608

30

TGATGACGGAAGAAATCCAAA

-

No

C18

MtChr6

2189030

16

AGATGGAGATTAGACGGCTCA

-

No

C19

MtChr5

13285282

16

AGATTTAGGCGGCTTTGAACT

-

No

C20

MtChr6

8477357

22

TGGACTGAAGACAAAGAGAAA

-

No

C21_1

MtChr4

33246760

13

ATTTTTCAGCGGAAGTTAA

-

No

C21_2

MtChr4

27138541

13

ATTTTTCAGCGGAAGTTAA

-

No

miR2088_1

MtChr8

14579972

11

AGGCCTAGATTACATTGGAC

+

Yes

miR2088_2

MtChr8

14675564

11

AGGCCTAGATTACATTGGAC

+

Yes

C23

MtChr5

31612014

12

TGTTGGAACACGGCTTAAGGT

-

No

C24

MtChr3

13221230

12

TAGGTTTGAGAAAATGGGCA

-

No

C25

MtChr8

24335508

11

TCTGTCAGTAGACTCAAT

-

No

C26

MtChr5

28244439

9

AAGGGCATATGTTAAGGAAC

-

No

miR2089

MtChr5

17442776

9

TTACCTATTCCACCAATTCCAT

+

Yes

The first column (sRNA) shows the ID number of the sequences. The second and third columns show the genomic location of the putative miRNAs (Chr: chromosome; Start: starting position on the chromosome). The number of reads are indicated in the fourth column and the sequences themselves are listed in the fifth column. The results of the Northern blot analysis are shown in the sixth column (+: detected; -: not detected). Whether the miRNA* sequence was sequenced or not is indicated in the last column.

We also predicted target genes for putative miRNAs (Additional file 3) and the new miRNAs with sequenced miRNA* (Additional file 4). Five out of the eight new miRNAs have potential targets in the available M. truncatula genome. It is interesting that two of these five new miRNAs potentially target disease resistance genes suggesting a role for miRNAs in the regulation of biotic stress response.

Discussion

Deep sequencing of M. truncatula short RNAs

Most conserved plant miRNAs were identified by traditional Sanger sequencing. Due to the relatively small number of sequences generated this method primarily discovered conserved miRNAs. Recent progress in sequencing technologies allows deep sequencing of large libraries of short RNAs [2, 7, 17, 1923]. The longest reads are obtained by the 454 technology, which currently gives reads of 250–300 base pairs (bp). However, this technology yields much less reads than other techniques (about 400 000 per sample) [17]. The Solexa platform (Illumina) generates shorter reads (up to 35 bp) but yields 1–3 million reads per sample [22]. The other very high-throughput technique, massively parallel sequencing (MPSS), gives more reads than Solexa but the reads are even shorter, only 17 bp [23]. miRNAs are only 21–23 nt sequences therefore even MPSS can identify them, although this technology generates shorter than 21 bp reads. Because of this it is not the ideal choice for miRNA discovery but it is useful for profiling conserved miRNAs. We decided to use the Solexa platform to test whether new miRNAs can be found in the model legume M. truncatula.

We found the quantification of PCR product problematic because the nanodrop overestimated the concentration and using quantitative markers on polyacrylamide gel seemed to underestimate the concentration. The difference between the two approaches was 50 fold. Loading 5 pM sample according to the nanodrop result yielded relatively low number of sequences (872,048 reads), well below the capacity of Solexa. However, loading 50 times more would have given poor quality sequences due to overloading. We decided to load four times of the amount suggested by the nanodrop and this approach yielded sufficient number (more than 3 million) and good quality reads. Many short sequences did not map to the genome but it is not known what the explanation is for that. One possibility is that the rate of sequencing error is high and many short reads contains mistakes. The other possibility is that there are polymorphisms between the species we used and the one that was used for the genome sequencing. It is also possible that plants used in these experiments were infected symptomless pathogens and genomes of those organisms contaminated our libraries.

First we searched for conserved miRNAs in the combined, almost four million reads from the two separate sRNA libraries. MiRNAs showing perfect matches to 25 conserved families were found in our combined library, which is more than was identified using bioinformatics approaches [2426]. Allowing up to two mismatches further increased this number to 31 families. This work experimentally verified all conserved miRNAs predicted by [[24, 25] and [26]]. However, none of the predicted new miRNAs [26] were found and the eight new miRNAs we found were not predicted by any of the three studies [[24, 25] and [26]] illustrating the benefit of the sequencing approach. Target prediction for conserved miRNAs found several genes showing homology to genes validated in other species. However, several predicted targets are new without known function indicating that more work is required to elucidate the role of miRNAs in legumes.

New miRNAs

Validation of non-conserved miRNAs can be achieved through several ways. One possibility is providing evidence of biogenesis characteristic of miRNAs. This involves the identification of stem-loop structure of the potential pre-miRNAs and sequencing of the miRNA* molecules [9]. In the absence of evidence for biogenesis, functional data can complement the predictions based on structural analysis. MiRNA mediated cleavage is located in a specific site within the target site and this can be identified by 5'RACE analysis. We have found eight new non-conserved miRNAs supported by biogenesis data since the miRNA* strands were sequenced and detected by Northern blot analysis. We also found 18 other putative miRNAs based on structural data. However, we did not sequence the miRNA* strands for these and we do not have functional proof therefore at the moment these are only putative miRNAs.

The role of miRNAs in development and abiotic stress response is well documented. Several transcription factors involved in development are targeted by miRNAs [27]. Other miRNAs play a role in nutrient assimilation and responses to drought, cold and other abiotic stresses [1, 28]. Reports of miRNAs involved in biotic stress response are less common. Navarro et al [29] showed that bacterial flagellin expression induced miR393 and F-box auxin receptor genes were regulated by miR393. Two of the new miRNAs are predicted to target disease resistance genes suggesting a more extensive role for miRNAs in biotic stress response. Targets of the other new miRNAs also include beta-glucan-binding protein, peptidyl-prolyl cis-trans isomerise and a hypothetical protein. The biological importance of the potential regulation of these genes by miRNAs needs further investigation.

Conclusion

High-throughput sequencing analysis of sRNAs from M. truncatula leaves identified eight new miRNAs, which were not found in other species. Sequencing sRNAs from specific tissues of legume plants by deep sequencing is expected to reveal more new miRNAs.

Methods

Cloning of M. truncatula sRNAs and Northern blot analysis

RNA was extracted using the miRVana kit (Ambion) from the aerial part (including stems and leaves) of nine week old Medicago truncatula Gaertn. cv. Jemalong seedlings. Plants were grown in pots with soil in a growth chamber having a photoperiod of 16/8 h day/night, a thermoperiod of 25/18°C day/night and humidity of 40%. Small RNA fraction between 19–24 nt was isolated from 15% denaturing polyacrylamide gel and 15 μg was ligated to adaptors without de-phosphorylating and re-phosphorylating [30]. The short RNAs were converted to DNA by RT-PCR and the DNA was sequenced on a Solexa machine (Illumina). 15 μg of RNA extracted from M. truncatula leaves was analysed by Northern blot as described by Pall et al. [31].

Sequence analysis

The Medicago truncatula genome sequence (version 2.0) was downloaded from the Medicago Sequencing Resource website http://www.medicago.org/genome/downloads/Mt2/ and sequence reads were mapped to the genome using PatMaN [32]. miRNA candidates were generated by miRCat (http://srna-tools.cmp.uea.ac.uk/mircat/; [33]) using default parameters. DFCI Medicago Gene Index v 9.0 was used for the target predictions: ftp://occams.dfci.harvard.edu/pub/bio/tgi/data/Medicago_truncatula/MTGI.release_9.zip. Target searches were performed on the srna-tools website: http://srna-tools.cmp.uea.ac.uk/targets/[33].

The sequences can be found in GEO under GPL7704 platform (High-throughput sequencing of small RNAs in Medicago truncatula), series GSE13761, samples GSM346592 and GSM346593.

Notes

Declarations

Acknowledgements

The work was supported by the BBSRC (TD) and FCT (MPSF) through the ERA-NET Plant Genomics initiative.

Authors’ Affiliations

(1)
School of Biological Sciences, University of East Anglia
(2)
School of Computing Science, University of East Anglia
(3)
Laboratory of Plant Cell Biotechnology

References

  1. Phillips J, Dalmay T, Bartels D: The role of small RNAs in abiotic stress. FEBS Letters. 2007, 581 (19): 3592-7. 10.1016/j.febslet.2007.04.007.PubMedView ArticleGoogle Scholar
  2. Lu C, Tej SS, Luo S, Haudenschild CD, Meyers BC, Green PJ: Elucidation of the small RNA component of the transcriptome. Science. 2005, 309: 1567-1569. 10.1126/science.1114112.PubMedView ArticleGoogle Scholar
  3. Bartel DP: MicroRNAs: genomics, biogenesis, mechanism, and function. Cell. 2004, 116: 281-297. 10.1016/S0092-8674(04)00045-5.PubMedView ArticleGoogle Scholar
  4. Reinhart BJ, Weinstein EG, Rhoades MW, Bartel B, Bartel DP: MicroRNAs in plants. Genes Dev. 2002, 16: 1616-1626. 10.1101/gad.1004402.PubMedPubMed CentralView ArticleGoogle Scholar
  5. Peragine A, Yoshikawa M, Wu G, Albrecht HL, Poethig RS: SGS3 and SGS2/SDE1/RDR6 are required for juvenile development and the production of trans-acting siRNA in Arabidopsis. Genes Dev. 2004, 18: 2368-2379. 10.1101/gad.1231804.PubMedPubMed CentralView ArticleGoogle Scholar
  6. Vazquez F, Vaucheret H, Rajagopalan R, Lepers C, Gasciolli V, Mallory AC, Hilbert JL, Bartel DP, Crete P: Endogenous trans-acting siRNAs regulate the accumulation of Arabidopsis mRNAs. Mol Cell. 2004, 16: 69-79. 10.1016/j.molcel.2004.09.028.PubMedView ArticleGoogle Scholar
  7. Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC: MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant. Genome Research. 2006, 16: 1276-1288. 10.1101/gr.5530106.PubMedPubMed CentralView ArticleGoogle Scholar
  8. Borsani O, Zhu J, Verslues PE, Sunkar R, Zhu JK: Endogenous siRNAs derived from a pair of natural cis-antisense transcripts regulate salt tolerance in Arabidopsis. Cell. 2005, 123: 1279-1291. 10.1016/j.cell.2005.11.035.PubMedPubMed CentralView ArticleGoogle Scholar
  9. Jones-Rhoades MW, Bartel DP, Bartel B: MicroRNAS and their regulatory roles in plants. Annu Rev Plant Biol. 2006, 57: 19-53. 10.1146/annurev.arplant.57.032905.105218.PubMedView ArticleGoogle Scholar
  10. Kurihara Y, Watanabe Y: Arabidopsis micro-RNA biogenesis through Dicer-like 1 protein functions. Proc Natl Acad Sci USA. 2004, 101: 12753-12758. 10.1073/pnas.0403115101.PubMedPubMed CentralView ArticleGoogle Scholar
  11. Brodersen P, Sakvarelidze-Achard L, Bruun-Rasmussen M, Dunoyer P, Yamamoto YY, Sieburth L, Voinnet O: Widespread translational inhibition by plant miRNAs and siRNAs. Science. 2008, 320 (5880): 1185-90. 10.1126/science.1159151.PubMedView ArticleGoogle Scholar
  12. Axtell MJ, Bartel DP: Antiquity of microRNAs and their targets in land plants. Plant Cell. 2005, 17: 1658-1673. 10.1105/tpc.105.032185.PubMedPubMed CentralView ArticleGoogle Scholar
  13. Allen E, Xie Z, Gustafson AM, Sung GH, Spatafora JW, Carrington JC: Evolution of microRNA genes by inverted duplication of target gene sequences in Arabidopsis thaliana. Nat Genet. 2004, 36: 1282-1290. 10.1038/ng1478.PubMedView ArticleGoogle Scholar
  14. Fahlgren N, Howell MD, Kasschau KD, Chapman EJ, Sullivan CM, Cumbie JS, Givan SA, Law TF, Grant SR, Dangl JL, Carrington JC: High-throughput sequencing of Arabidopsis microRNAs: evidence for frequent birth and death of MIRNA genes. PLoS ONE. 2007, 2 (2): e219-10.1371/journal.pone.0000219.PubMedPubMed CentralView ArticleGoogle Scholar
  15. Rajagopalan R, Vaucheret H, Trejo J, Bartel DP: A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana. Genes Dev. 2006, 20: 3407-25. 10.1101/gad.1476406.PubMedPubMed CentralView ArticleGoogle Scholar
  16. Yao Y, Guo G, Ni Z, Sunkar R, Du J, Zhu JK, Sun Q: Cloning and characterization of microRNAs from wheat (Triticum aestivum L.). Genome Biology. 2007, 8 (6): R96-10.1186/gb-2007-8-6-r96.PubMedPubMed CentralView ArticleGoogle Scholar
  17. Moxon S, Jing R, Szittya G, Schwach F, Rusholme Pilcher RL, Moulton V, Dalmay T: Deep sequencing of tomato short RNAs identifies microRNAs targeting genes involved in fruit ripening. Genome Research. 2008,Google Scholar
  18. Moxon S, Schwach F, MacLean D, Dalmay T, Studholme DJ, Moulton V: A toolkit for analysing large-scale plant small RNA datasets. Bioinformatics. 2008,Google Scholar
  19. Henderson IR, Zhang X, Lu C, Johnson L, Meyers BC, Green PJ, Jacobsen SE: Dissecting Arabidopsis thaliana DICER function in small RNA processing, gene silencing and DNA methylation patterning. Nature Genetics. 2006, 38: 721-725. 10.1038/ng1804.PubMedView ArticleGoogle Scholar
  20. Berezikov E, Thuemmler F, van Laake L, Kondova I, Bontrop R, Cuppen E, Plasterk R: Diversity of microRNAs in human and chimpanzee brain. Nature Genetics. 2006, 38: 1375-1377. 10.1038/ng1914.PubMedView ArticleGoogle Scholar
  21. Ruby JG, Jan C, Player C, Axtell MJ, Lee W, Nusbaum C, Ge H, Bartel DP: Large-Scale Sequencing Reveals 21U-RNAs and Additional MicroRNAs and Endogenous siRNAs in C. elegans. Cell. 2006, 127: 1193-1207. 10.1016/j.cell.2006.10.040.PubMedView ArticleGoogle Scholar
  22. Glazov EA, Cottee PA, Barris WC, Moore RJ, Dalrymple BP, Tizard ML: A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach. Genome Research. 2008, 18 (6): 957-64. 10.1101/gr.074740.107.PubMedPubMed CentralView ArticleGoogle Scholar
  23. Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ: MicroRNAs and other small RNAs enriched in the Arabidopsis RNAdependent RNA polymerase-2 mutant. Genome Research. 2006, 16 (10): 1276-1288. 10.1101/gr.5530106.PubMedPubMed CentralView ArticleGoogle Scholar
  24. Sunkar R, Jagadeeswaran G: In silico identification of conserved microRNAs in large number of diverse plant species. BMC Plant Biology. 2008, 8: 37-50. 10.1186/1471-2229-8-37.PubMedPubMed CentralView ArticleGoogle Scholar
  25. Zhou ZS, Huang SQ, Yang ZM: Bioinformatic identification and expression analysis of new microRNAs from Medicago truncatula. Biochemical and Biophysical Research Communications. 2008, 374: 538-542. 10.1016/j.bbrc.2008.07.083.PubMedView ArticleGoogle Scholar
  26. Wen J, Frickey T, Weiller GF: Computational prediction of candidate miRNAs and their targets from Medicago truncatula non-protein-coding transcripts. In Silico Biol. 2008, 8 (3-4): 291-306.PubMedGoogle Scholar
  27. Kidner CA, Martienssen RA: The developmental role of microRNA in plants. Curr Opin Plant Biol. 2005, 8 (1): 38-44. 10.1016/j.pbi.2004.11.008.PubMedView ArticleGoogle Scholar
  28. Sunkar R, Zhu JK: Novel and stress-regulated microRNAs and other small RNAs from Arabidopsis. Plant Cell. 2004, 16 (8): 2001-19. 10.1105/tpc.104.022830.PubMedPubMed CentralView ArticleGoogle Scholar
  29. Navarro L, Dunoyer P, Jay F, Arnold B, Dharmasiri N, Estelle M, Voinnet O, Jones JD: A plant miRNA contributes to antibacterial resistance by repressing auxin signaling. Science. 2006, 312 (5772): 436-9. 10.1126/science.1126088.PubMedView ArticleGoogle Scholar
  30. Rathjen T, Pais H, Sweetman D, Moulton V, Munsterberg A, Dalmay T: High throughput sequencing of microRNAs in chicken somites. BMC Genomics. 2008,Google Scholar
  31. Pall GS, Codony-Servat C, Byrne J, Ritchie L, Hamilton A: Carbodiimide-mediated cross-linking of RNA to nylon membranes improves the detection of siRNA, miRNA and piRNA by northern blot. Nucleic Acids Research. 2007, 35 (8): e60-10.1093/nar/gkm112.PubMedPubMed CentralView ArticleGoogle Scholar
  32. Prufer K, Stenzel U, Dannemann M, Green REE, Lachmann M, Kelso J: PatMaN: rapid alignment of short sequences to large databases. Bioinformatics. 2008, 24 (13): 1530-1. 10.1093/bioinformatics/btn223.PubMedPubMed CentralView ArticleGoogle Scholar
  33. Moxon S, Schwach F, Maclean D, Dalmay T, Studholme DJ, Moulton V: A toolkit for analysing large-scale plant small RNA datasets. Bioinformatics. 2008, 24 (19): 2252-3. 10.1093/bioinformatics/btn428.PubMedView ArticleGoogle Scholar

Copyright

© Szittya et al; licensee BioMed Central Ltd. 2008

This article is published under license to BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Advertisement