Open Access

Use of genome sequence data in the design and testing of SSR markers for Phytophthora species

BMC Genomics20089:620

DOI: 10.1186/1471-2164-9-620

Received: 06 June 2008

Accepted: 19 December 2008

Published: 19 December 2008

Abstract

Background

Microsatellites or single sequence repeats (SSRs) are a powerful choice of marker in the study of Phytophthora population biology, epidemiology, ecology, genetics and evolution. A strategy was tested in which the publicly available unigene datasets extracted from genome sequences of P. infestans, P. sojae and P. ramorum were mined for candidate SSR markers that could be applied to a wide range of Phytophthora species.

Results

A first approach, aimed at the identification of polymorphic SSR loci common to many Phytophthora species, yielded 171 reliable sequences containing 211 SSRs. Microsatellites were identified from 16 target species representing the breadth of diversity across the genus. Repeat number ranged from 3 to 16 with most having seven repeats or less and four being the most commonly found. Trinucleotide repeats such as (AAG)n, (AGG)n and (AGC)n were the most common followed by pentanucleotide, tetranucleotide and dinucleotide repeats. A second approach was aimed at the identification of useful loci common to a restricted number of species more closely related to P. sojae (P. alni, P. cambivora, P. europaea and P. fragariae). This analysis yielded 10 trinucleotide and 2 tetranucleotide SSRs which were repeated 4, 5 or 6 times.

Conclusion

Key studies on inter- and intra-specific variation of selected microsatellites remain. Despite the screening of conserved gene coding regions, the sequence diversity between species was high and the identification of useful SSR loci applicable to anything other than the most closely related pairs of Phytophthora species was challenging. That said, many novel SSR loci for species other than the three 'source species' (P. infestans, P. sojae and P. ramorum) are reported, offering great potential for the investigation of Phytophthora populations. In addition to the presence of microsatellites, many of the amplified regions may represent useful molecular marker regions for other studies as they are highly variable and easily amplifiable from different Phytophthora species.

Background

The genus Phytophthora, with other Oomycetes, fall within the kingdom Stramenopila, which also includes golden-brown algae, diatoms, and brown algae such as kelp [14]. This genus stands out among the plant pathogens since a significant number of the 80 or so described species continue to prove a threat to ecosystem stability and plant productivity on a global scale [58]. Despite the importance of Phytophthora species, studies of their molecular diversity have been limited by the power of the genetic markers and difficulties in comparing results among laboratories. Accurate studies based on the analysis of mitochondrial and nuclear DNA have resulted in a consensus of the phylogenetic relationships within the genus with a grouping into 10 genetically related clades now accepted [2, 3, 9]. However, these studies were based on genes commonly conserved within a species and therefore unsuitable to characterize intraspecific variability. Other approaches to study intraspecific variability among Phytophthora species including RAPD-PCR and AFLP have proved valuable within a particular study but comparing results from one laboratory to another has always proved challenging with such fingerprinting tools [1013]. Although microsatellites or simple sequence repeats (SSRs) have been recognised as one of the most powerful choices of markers for molecular ecology they have only relatively recently been exploited in the study of Phytophthora populations. SSRs are tandemly repeated motifs of one to six bases which occur frequently and randomly in all eukaryotic genomes although their frequency varies significantly among different organisms [14]. They exhibit a high degree of length polymorphism among related organisms due to stepwise mutations affecting the number of repeat units and leading to polymorphism [14, 15]. Dinucleotide repeats account for the majority of microsatellites for many species whereas trinucleotide and hexanucleotide repeats are the most likely repeat classes to appear in coding regions because they do not cause a frameshift [16, 17]. Major advantages SSRs include: (i) multiple SSR alleles may be detected at a single locus using a simple PCR-based screen, (ii) SSRs are evenly distributed across the genome, (iii) they are co-dominant, (iv) very small quantities of DNA are required for screening, (v) analysis may be semi-automated, and (vi) results are objective compared to random amplification methods [18].

Microsatellites have been used to investigate genetic structure and reproductive biology of Oomycetes species including Plasmopara viticola, P. cinnamomi, P. infestans, and P. ramorum [1921, 2325]. However, a major limitation to their wider exploitation is the need for prior species-specific marker isolation that requires knowledge of the DNA sequence of the SSR flanking regions to which specific primers have to be designed. Such regions are usually conserved within a species but the likelihood of primers successfully working between species decreases with increasing genetic distance and, in practice, primers are usually developed anew for each species [25, 26]. Common methods for the discovery of SSR loci are based on constructing genomic DNA libraries enriched for SSR sequences. These methods were utilised for P. cinnamomi and P. ramorum, however they are time-consuming, and the specific sequencing of DNA libraries required is expensive [20, 25]. Many commercial and academic laboratories specialise in microsatellite isolation services and can provide a set of polymorphic microsatellite loci for a new species in 3–6 months for a cost of approximately USD 1,500 per locus, or USD 10,000 for 10–15 loci [14].

The availability of entire genome sequences for an increasing number of species including P. infestans http://www.broad.mit.edu/, P. ramorum and P. sojae http://genome.jgi-psf.org/ have proved novel opportunities to identify and evaluate potential SSR markers identified by computational tools (Abajian, 1994, http://espressosoftware.com/pages/sputnik.jsp) [27, 28]. This approach has been utilised to identify SSRs for the study of European and USA populations of P. ramorum and for monitoring the genetic variation in populations of P. infestans across Europe and worldwide [23, 24, 29, 30].

Recently, Garnica et al. used an in silico approach to survey and compare simple sequence repeats (SSRs) in transcript sequences from the genomes of P. sojae, P. ramorum and P. infestans [27]. They also evaluated in silico transferability of SSRs among the Phytophthora species and found that a proportion (7.5%) of primers could, in theory, be transferred between at least two of the three species. In the present study SSRs from P. infestans P. sojae and P. ramorum were analysed to identify useful loci common to many Phytophthora species (Approach 1) or to a restricted number of species closely related to P. sojae (Approach 2). Selected loci were amplified and sequenced from 16 (Approach 1) and 5 (Approach 2) different Phytophthora species and a comprehensive SSRs dataset was created.

Results

Approach 1 – SSRs for many Phytophthora species

The aim of this approach was to identify loci containing SSRs common to a large number of Phytophthora species (Fig. 1A). The method was validated using 16 different species (Table 1) representing the breadth of diversity across the genus [2, 3].
Table 1

Isolates of Phytophthora included in the study, their designations and origins.

Phytophthora species

Isolate numbers

Origin

  

Host

Country

Year

P. alni subsp. alni

SCRP2

Alnus sp.

UK

1995

 

SCRP4(a)

Alnus sp.

Germany

1995

 

SCRP8(a)

Alnus sp.

France

1996

P. cambivora

SCRP67 (IMI 296831)

Rubus idaeus

Scotland

1985

 

SCRP75(a)

Fagus sp.

UK

1995

 

SCRP80(a)

Castanea sativa

Italy

1995

 

SCRP82(a)

Eucalypt

Australia

 

P. cinnamomi

SCRP115 (CBS270.55)

Chamaecyparis lawsoniana

Netherlands

1993

 

SCRP118 (CBS342.72)

Persea gratissima

California

1972

 

SCRP121(a)

 

Australia

 

P. citricola

SCRP130

Rubus idaeus

Scotland

1986

 

SCRP136(a)

Soil

UK

1995

 

SCRP140(a)

Taxus sp.

UK

1995

 

SCRP143(a)

Quercus robur

Germany

1994

P. europaea

SCRP622

Quercus robur

Switzerland

1995

P. fragariae var. rubi

SCRP333 (IMI355974)

Rubus idaeus

Scotland

1985

P. ilicis

SCRP377

Ilex aquilifolium

UK

1995

 

SCRP379(a)

Ilex aquilifolium

UK

 

P. infestans

SC03.26.3.3

Solanum tuberosum

Scotland

2003

P. inundata

SCRP644 (IMI389751)

Salix sp.

UK

1972

P. lateralis

SCRP390 (IMI 040503)

Chamaecyparis lawsoniana

U.S.A.

1942

P. nemorosa

SCRP910

   

P. pseudosyringae

SCRP674 (IMI390500)

Malus pumila

Italy

2001

 

SCRP734(a)

Fagus sylvatica

Italy

2003

P. psychrophila

SCRP630

Quercus ilex

France

1996

P. quercina

SCRP541

Quercus robur

Germany

1995

P. ramorum

SCRP911

Rhododendron sp.

Scotland

2004

P. sojae

SCRP555

Glycine max

USA

 

(a) = Additional isolates utilised to evaluate intraspecific variability

https://static-content.springer.com/image/art%3A10.1186%2F1471-2164-9-620/MediaObjects/12864_2008_Article_1813_Fig1_HTML.jpg
Figure 1

Schematic representation of two different approaches utilised to identify SSRs in a broad range of Phytophthora species (A) or in Phytophthora spp. Clade 7 (B).

Analysis of sequences from P. infestans, P. sojae and P. ramorum genome projects and scanning for homologous SSRs

Predicted gene datasets from P. infestans http://www.broad.mit.edu/P. sojae and P. ramorum http://genome.jgi-psf.org/ were scanned for the presence of microsatellites defined as short tandem repeat motifs (SSRs) of 2–6 bp. Both perfect and compound SSRs were selected with a minimal acceptable length of 10 bp (dinucelotide motifs) and 12 bp (tri- and tetranucletide motifs). SSRs with a minimum of three repeats were included in the analyses of penta-nucleotide repeats. This search yielded 9333 sequences containing SSRs (1465 from P. infestans, 5348 from P. sojae and 2520 from P. ramorum). The relative abundance of SSRs was 103, 183 and 114 per Mb of predicted gene sequence for P. infestans, P. sojae and P. ramorum, respectively.

Selected regions were compared by BLAST analysis to identify homologous regions flanking SSRs in at least two of the three species (P. sojae, P. ramorum and P. infestans). This analysis identified 4135 SSRs from P. infestans (688), P. ramorum (1470), and P. sojae (1977). A very limited number of loci containing SSRs were common to the three species; most loci were common to P. ramorum and P. sojae (81.6%), P. infestans and P. ramorum (7%) or P. infestans and P. sojae (11%). In most of the cases, homologous loci contained the same SSR motif in different Phytophthoras, however the number of repeats was consistently higher in the 'source' species than the other two.

Among the selected loci, the number of SSR repeats ranged from 3 to 13, from 3 to 12 and from 3 to 17 in P. infestans, P. ramorum and P. sojae respectively. Most SSRs showed seven repeats or less (98.2% P. infestans, 97.4% P. ramorum, 94.4% P. sojae), with a repeat number of four being the most common in all species.

Selection and amplification of target regions containing SSRs

The 4135 homologous regions previously identified were manually analysed to select those with the highest number of repeats and flanked by the most conserved sequences on both sides. The latter condition was necessary to design primers suitable for as many species as possible. Based on this analysis 6, 7 and 12 target regions were identified across the genome of P. infestans, P. ramorum and P. sojae respectively. These regions, containing 8, 17 and 33 SSRs respectively, were selected (Table 2) for amplification from 16 different species of Phytophthora representing the breadth of diversity in the genus (Table 1). To this aim, a total number of 62 different degenerate primers (12 for P. infestans, 18 for P. ramorum, and 32 for P. sojae) were designed (Table 2). When target regions contained two or more SSRs and/or were too long to be amplified by a single amplification, a pool of different primers was designed (Table 2). Considerable effort was made to obtain successful amplification from as many species as possible. This involved screening of several primer pairs for each genomic region and for each Phytophthora species (Table 2) and adjustment of annealing temperatures and MgCl2 concentration for PCR reactions (Tables 3, 4, 5).
Table 2

Set of primers designed with the 1st approach (Fig. 1A) to amplify genomic regions with candidate SSRs in a broad range of Phytophthora species (Table 1).

 

Forward primers(a)

Reverse primers(a)

SSRs(a)

Source(b)

P. sojae

S1F

ACGACGTGTCCAAGAACCAC

S3R

ATGTTGACCGTGTTCTGCTG

(CCG)7;(AGC)4; (AGC)14

scaffold_3:

1346836–1347814

 

S4F

AARATGACGTGGACKGAGAG

S5R

TGATSGTGGAGAARCTCATCT

(AAC)14

scaffold_14:

861958–862585

 

S6F

GGAGTTCGCCATCAACAACT

S7R

TCAGCTTCTGTCGRTCGAC

(AAG)14

scaffold_24:

159790–160289

 

S8F

YGYGTCTCGCCCAYGAC

S9R

GACGACACCGGSGAGAG

(ACC)4;(AGC)4; (AGC)28; (AAC)4

scaffold_76:

171071–172890

 

S10F

GCGSTACGAGACCTGGAC

S11R

GACTCRCCCTTCGACTCSTC

(CAG)14

 
 

S12F

GGAGGCCGAGTCGGARTA

S13R

TAYTCCGACTCGGCCTCC

(AGC)14

scaffold_136:

56988–57479

 

S14F

GACGCMSYYGAGTGGAAAG

S15R

ATTTKGSACAGATACCGACG

(AAG)15

scaffold_65:

332082–332852

 

S16F

TCTACGTGAATGCCATGAGG

S17R

CGTTCAGCTTCTGTCGATCR

(AAG)15

scaffold_79:

50973–51428

 

S18F

YACCATCTCCAACCTGCTG

S19R

CACCACCTCGAGTAGCTCCC

(AGC)7; (AGG)13

scaffold_2:

1159730–1160958

 

S19F

GGGAGCTACTCGAGGTGGTG

S20R

TCGTCTCAATCTCKGACTGA

(AGC)6

 
 

S21F

ATCTGGGCTTCCASGAGGT

S22R

CTGATCCTCCGCCACAY

(AAG)12; (ATC)6; (ATC)4; (AAG)5

scaffold_138:

18289–18854

 

S23F

GACTCGGACTCGGACGAC

S25R

CTCCTGCTCKTCTTTCAGGC

(AGG)7; (AAG)10; (GAG)4; (AAG)12; (GAG)5; (AGA)6

scaffold_90:

249340–250137

  

S37R

CTTRCCBTCCTTGTCCTTYT

  
 

S27F

GAAGCGCGGGCGWGT

S31R

TCCTCCTCTTCTTCTTCGTCW

(AAG)4; (AGG)4; (ACG)4; (AGG)11

scaffold_16:

680126–681136

 

S31F

WGACGAAGAAGAAGAGGAGGA

S28R

TCATTCATCAGCGTGTCRAT

(GAG)4

 
 

S34F

ABGAWGACGABGAGGAVGAV

   
 

S29F

MGCAAGAAGGCGTCGTA

S30R

CCTTCATCATGAGCTTCTGG

(AGG)4 (AAG)11

scaffold_40:

353572–354360

P. ramorum

R1F

GYGGCGGTGGCTACAGYG

R3R

CTGCTGYTGCTGGTTGAAAG

(ACC)4; (ACC)5; (ACC)4

scaffold_23:

349447–350425

 

R2F

CTACTCSAGCCGCTACGC

   
 

R3F

CTTTCAACCAGCARCAGCAG

R4R

GTTCATCATGCCWCCCATR

(AGC)8

scaffold_23:

350406–351828

 

R4F

YATGGGWGGCATGATGAAC

R5R

AGGACCAGGAGATGGAGGAC

(AGC)4; (AGC)12; (AGC)4

 
 

R7F

TGTTCCARACCCGCTTCC

R8R

CACCAAGCAGCACKCGC

(ACG)9; (AAC)5; (AGC)10

scaffold_10:

436897–437690

  

R9R

GGAACGCACCAAAGACGC

  
 

R10F

GGAGATGACGGAAGATGACG

R11R

CCATCGAARTACATSACACGA

(AAGCC)4; (AGG)9; (AAG)7

scaffold_5:

750031–750612

 

R13F

AAGTCGAAGCTCGTGGTSAC

R14R

GTATCCGCTGRAAGAGCGTC

(AAG)10

scaffold_78:

40203–40815

 

R15F

CCGGAGCGCGTGGA

R16R

GGTAGTTGAGCGGCTTCTTG

(CCG)6

scaffold_2778:

35–305

 

R16F

CAAGAAGCCGCTCAACTACC

R17R

TAACGGATCAGCTCTTGCTG

(ATC)4; (AGG)8

scaffold_2778:

286–1134

P. infestans

I3F

GCCTGTGGAYGAGAATGGYS

I4R

CAGATCCACGACACCRGGY

(AAG)8

Pi_002_41652

_Feb05

 

I5F

CATCAACAAGTGCTCGTWCS

I6R

TAGTCRAYGTTCTTGTTGTTCA

(AGC)5; (AGC)8

Supercont1.7

842678–843649

 

I7F

GHGTGGGCGAGTACTCCAAG

I8R

AAGCTGGCTATRWACACTGCCG

(AG)9

Supercont1.4

1481811–1482015

 

I9F

GCATYGGGTCGTTCCTGTA

I10R

AGHGTGCAGTACAGACCCGC

(AAG)11

Supercont1.5

1235771–1236143

 

I11F

TCGTCBGTGTCCTCBACGTC

I12R

ACCAGCATCTTRTTCTGRGCAG

(ACC)8

Supercont1.45

522394–522633

 

I13F

GTCTGCGCTGTCGGAACT

I14R

TRATGATGCGGTTCATCTCG

(AAG)7; (AAG)4

Supercont1.220

167896–168460

(a) = Primers are listed according to the localization in their respective genome projects (P. sojae, P. ramorum or P. infestans) and according to the flanked SSRs. In some circumstances, a pool of different primers was designed to amplify selected genomic regions from as many as possible Phytophthora species. Similarly, when target regions contained two or more SSRs and were too long to be amplified by a single amplification a pool of different primers was designed.

(b) = Gene sequences available at http://genome.jgi-psf.org/sojae1/sojae1.home.html (P. sojae), http://genome.jgi-psf.org/ramorum1/ramorum1.home.html (P. ramorum) and http://www.pfgd.org/ or http://www.broad.mit.edu/annotation/genome/phytophthora_infestans/Home.html (P. infestans).

Table 3

Accession numbers and SSRs for GenBank deposited sequences http://www.ncbi.nlm.nih.gov/ amplified from 16 Phytophthora species (Table 1) using primers designed on P. sojae with the first approach (Fig.1A).

Phytoph.

species

SELECTED PRIMERS(a)

 

S1F-S3R

S4F-S5R

S6F-S7R

S10F-11R

S16F-17R

S18F-19R

S19F-20R

S21F-22R

S23F-S25R(1)

(2)S31F-28R

S27F-S31R

S29F-S30R

P. alni

subsp. alni

SCRP2

NS++

58°C/1.7 mM*

EF216617

No SSR

58°C/1.0 mM*

EF216607

(aac)4

58°C/1.7 mM*

EF216602

(agc)6

58°C/1.0 mM*

NS++

55°C/1.7 mM*

NA+

EF216590

No SSR

58°C/1.0 mM*

EF216580

(aag)5

(agg)5

(aag)4

(aag)6

(agg)5

58°C/1.0 mM*

EF216565

(agg)7

(aag)10

(agg)16 (aag)12

(aag)4

58°C/1.0 mM*

NS++

58°C/1.0 mM*

EF216555

(aag)8

(agg)4

(agg)4

(aag)5

(agg)4

(aag)4

(aag)5

58°C/1.0 mM*

EF216552

(aag)8

58°C/1.0 mM*

P. cambiv.

SCRP67

NS++

58°C/1.7 mM*

EF216618

No SSR

58°C/1.0 mM*

EF216606

(aac)4

58°C/1.7 mM*

EF216601

(agc)4

(cg)5

58°C/1.0 mM*

EF216593

No SSR

55°C/1.7 mM*

NS++

58°C/1.0 mM*

NS++

58°C/1.0 mM*

EF216581

(agg)4

(aag)5

(aag)4

58°C/1.0 mM*

EF216569

(agg)10 (aag)10

(agg)9

(aag)12

(agg)4

(agg)7

58°C/1.0 mM*

NA+

NA+

EF216551

(aag)8

58°C/1.0 mM*

P. cinnam.

SCRP115

NA+

NA+

NA+

NS++

58°C/1.0 mM*

NS++

55°C/1.7 mM*

NA+

NA+

NS++

58°C/1.0 mM*

NA+

NA+

NA+

EF2165

(aag)8

(agg)5

(aag)9

58°C/1.0 mM*

P. citricola

SCRP130

NA+

EF216619

No SSR

58°C/1.0 mM*

NA+

NA+

NA+

NA+

NA+

NS++

58°C/1.0 mM*

NA+

NS++

58°C/1.0 mM*

NA+

EF216553

(aag)7

(aag)7

58°C/1.0 mM*

P. europaea

SCRP622

NS++

58°C/1.0 mM*

EF216616 (acg)4

58°C/1.0 mM*

EF216605

No SSR

58°C/1.7 mM*

EF216600

No SSR

58°C/1.0 mM*

NS++

55°C/1.7 mM*

NS++

55°C/1.7 mM*

EF216589

No SSR

58°C/1.0 mM*

EF216576

(aag)4

58°C/1.0 mM*

EF216568

(agg)9

(aag)10

(aag)7

(agg)4

(aag)6

(agg)4

(agg)4

58°C/1.0 mM*

NA+

NA+

EF21655054

(aag)9

58°C/1.0 mM*

P. fragariae

var.rubi

SCRP333

NA+

NA+

NS++

58°C/1.7 mM*

NS++

58°C/1.0 mM*

EF216594 (aac)4

55°C/1.7 mM*

NA+

EF216584

No SSR

58°C/1.0 mM*

NA+

NA+

NA+

NS++

60°C/0.7 mM*

EF216542

(aag)7

(aag)8

58°C/1.0 mM*

P. ilicis

SCRP377

NS++

58°C/1.7 mM*

EF216608 (ccg)4

58°C/1.0 mM*

NA+

NS++

58°C/1.0 mM*

NS++

55°C/1.7 mM*

NA+

NA+

NA+

EF216575

No SSR

58°C/1.0 mM*

NA+

NS++

60°C/0.7 mM*

EF216543

(aag)5

58°C/1.0 mM*

P. infestans

sc 03.26.3.3

NA+

EF216615

No SSR

58°C/1.0 mM*

NA+

NA+

NS++

55°C/1.7 mM*

NA+

NA+

NA+

NA+

EF216560

No SSR

58°C/1.0 mM*

NA+

NS++

58°C/1.0 mM*

P. inundata

SCRP644

EF216624

No SSR

58°C/1.0 mM*

EF216614

No SSR

58°C/1.0 mM*

NA+

EF216599

No SSR

58°C/1.0 mM*

NS++

55°C/1.7 mM*

NA+

EF216588

No SSR

58°C/1.0 mM*

NA+

NA+

NS++

58°C/0.7 mM*

NS++

60°C/0.7 mM*

EF216549

(aag)8

58°C/1.0 mM*

P. lateralis

SCRP390

NS++

58°C/1.0 mM*

EF216611

No SSR

58°C/1.0 mM*

EF216604

(ac)5

58°C/1.7 mM*

EF216598

(agc)4

58°C/1.0 mM*

NS++

55°C/1.7 mM*

EF216592

(acg)4

(agc)4

58°C/1.0 mM*

EF216587

No SSR

58°C/1.0 mM*

EF216579

(aag)5

58°C/1.0 mM*

EF216564

(agg)5

(aag)4

(aag)6

(agg)4

58°C/1.0 mM*

EF216556

(agg)4

58°C/0.7 mM*

NS++

60°C/0.7 mM*

EF216548

(aag)5

(aag)9

58°C/1.0 mM*

P. nemor.

SCRP910

NA+

EF216613 (ccg)4

58°C/1.0 mM*

NA+

EF216597

No SSR

58°C/1.0 mM*

NA+

NS++

55°C/1.7 mM*

NA+

NA+

EF216572

No SSR

58°C/1.0 mM*

EF216559

No SSR

58°C/1.0 mM*

NA+

EF216547

(aag)5

58°C/1.0 mM*

P. pseudos.

SCRP674

EF216622

No SSR

58°C/1.0 mM*

NS++

58°C/1.0 mM*

NS++

58°C/1.7 mM*

EF216596

No SSR

58°C/1.0 mM*

NA+

NA+

NA+

NA+

EF216573

No SSR

58°C/1.0 mM*

EF216557

(agg)14

58°C/1.0 mM*

NS++

60°C/0.7 mM*

EF216546

(aag)4

58°C/1.0 mM*

P. psychro.

SCRP630

EF216623 (agc)4

58°C/1.0 mM*

EF216612 (ccg)4

58°C/1.0 mM*

NA+

NA+

NA+

NA+

NA+

NS++

58°C/1.0 mM*

EF216574

No SSR

58°C/1.0 mM*

EF216558

(agg)6

(agg)4

(aag)4

(agg)4

58°C/0.7 mM*

NS++

60°C/0.7 mM*

EF216545

(aag)4

58°C/1.0 mM*

P. quercina

SCRP541

EF216621

(agc)5

58°C/1.0 mM*

NA+

NA+

NA+

NA+

NA+

NA+

NS++

58°C/1.0 mM*

EF216563

(aag)10 (aag)5

58°C/1.0 mM*

EF216561

(agg)4

58°C/1.0 mM*

NA+

EF216544

(aag)7

58°C/1.0 mM*

P. ramorum

SCRP911

EF216620

No SSR

58°C/1.0 mM*

EF216610 (acc)4

58°C/1.0 mM*

EF216603

No SSR

55°C/1.7 mM*

NS++

58°C/1.0 mM*

EF216595

No SSR

55°C/1.7 mM*

EF216591

No SSR

58°C/1.0 mM*

EF216586

No SSR

58°C/1.0 mM*

EF216578

(aag)4

(atc)4

(aag)5

(aag)5

58°C/1.0 mM*

EF216562

(aag)4

(agg)4

(aag)7

58°C/1.0 mM*

NS++

58°C/0.7 mM*

NA+

EF216540 (aag)4

58°C/1.0 mM*

P. sojae

SCRP555

NA+

EF216609

(aac)14

58°C/1.0 mM*

NS++

58°C/1.7 mM*

NS++

58°C/1.0 mM*

EF382779

No SSR

55°C/1.7 mM*

NA+

EF216585 (agc)6

58°C/1.0 mM*

EF216577

(aag)12

(atc)6

(atc)4

(aag)5

58°C/1.0 mM*

NS++

58°C/0.7 mM*

NS++

58°C/0.7 mM*

NA+

EF216541

(agg)4

(aag)11

58°C/1.0 mM*

(a) = Primers listed in Table 2 and not reported in this table are those that did not produce any reliable sequence (see text).

(1) = Primer S25R was replaced by primer S37R for P. nemorosa, P. pseudosyringae, P. psychrophila, and P. ilicis.

(2) = Primer S31F was replaced by primer S34F for P. alni, P. citricola, P. infestans, P. nemorosa, and P. quercina.

NA+ = Isolate-primer combinations that did not produce any amplification or produced complex profiles (two or more fragments).

NS++ = Isolate-primer combinations for which single PCR bands were obtained but direct sequencing did not produce reliable results.

°C/mM* = Selected annealing temperature (°C) and MgCl2 concentration (mM) in PCR reactions.

Table 4

Accession numbers and SSRs for GenBank deposited sequences http://www.ncbi.nlm.nih.gov/ amplified from 16 Phytophthora species (Table 1) using primers designed on P. ramorum with the first approach (Fig. 1A).

Phytophthora

species

SELECTED PRIMERS(a)

 

(1)R1F-R3R

R3F-R4R

R4F-R5R

R7F-9R(2)

R10F-R11R

R13F-R14R

R16F-R17R

P. alni subsp. alni

SCRP2

NA+

NA+

EF216645

No SSR

58°C/1.0 mM*

EF216671

No SSR

58°C/1.0 mM*

EF216662

No SSR

58°C/1.7 mM*

EF216651

(aag)4

58°C/1.7 mM*

EF216625

(acg)4

58°C/1.0 mM*

P. cambivora

SCRP67

NS++

58°C/1.0 mM*

NA+

NS++

58°C/1.0 mM*

EF216673

(agc)8

58°C/1.0 mM*

EF216663

(agg)4

(aag)4

(agg)4

58°C/1.7 mM*

NS++

58°C/1.7 mM*

EF216626

(acg)4

58°C/1.0 mM*

P. cinnamomi

SCRP115

NA+

NA+

NA+

NA+

NA+

NS++

58°C/

1.7 mM*

NA+

P. citricola

SCRP130

NA+

NA+

EF216644

No SSR

58°C/1.0 mM*

NA+

NA+

NA+

EF216630

No SSR

58°C/1.0 mM*

P. europaea

SCRP622

NS++

58°C/1.0 mM*

NA+

EF216643

No SSR

58°C/1.0 mM*

NA+

EF216661

(agg)4

(aag)7

(agg)5

58°C/1.7 mM*

EF216655

(aag)4

58°C/1.7 mM*

NA+

P. fragariae

var. rubi

SCRP333

NS++

58°C/1.0 mM*

NS++

58°C/1 mM**

EF216634

No SSR

58°C/1.0 mM*

EF216672

(agc)7

58°C/1.0 mM*

EF216657

(aag)4

(agg)4

58°C/1.7 mM*

EF216647

(aag)4

58°C/1.7 mM*

NS++

58°C/1.0 mM*

P. ilicis

SCRP377

NS++

58°C/1.0 mM*

EF216646

(agc)4

(agc)4

58°C/1.0 mM*

EF216635

(agc)4

(accat)5

58°C/1.0 mM*

EF216664

(actg)3

(agc)6

58°C/1.0 mM*

NS++

58°C/1.7 mM*

EF216648

No SSR

58°C/1.7 mM*

NS++

58°C/1.0 mM*

P. infestans

sc 03.26.3.3

NS++

58°C/

1.0 mM*

NA+

NA+

NA+

NS++

58°C/1.7 mM*

NA+

NA+

P. inundata

SCRP644

EF216633

No SSR

58°C/

1.0 mM*

NA+

NA+

NA+

NA+

EF216654

No SSR

58°C/1.7 mM*

EF216629

No SSR

58°C/1.0 mM*

P. lateralis

SCRP390

EF216631

No SSR

58°C/1.0 mM*

NA+

EF216642

(aac)5

(agc)5

58°C/1.7 mM*

EF216669

(agc)5

(aac)6

58°C/1.0 mM*

EF216660

(agg)4

58°C/1.7 mM*

NA+

EF216628

(agg)8

(agc)4

58°C/1.0 mM*

P. nemorosa

SCRP910

NS++

58°C/1.0 mM*

NA+

EF216639

(agc)4

(accat)4

58°C/1.0 mM*

EF216668

(actg)3

(agc)6

58°C/1.7 mM*

NS++

58°C/1.7 mM*

EF216653

(agg)9

58°C/1.7 mM*

NA+

P. pseudosyringae

SCRP674

EF216632

No SSR

58°C/1.0 mM*

NA+

EF216641

(accat)4

58°C/1.0 mM*

EF216667

No SSR

58°C/1.0 mM*

NA+

EF216652

No SSR

58°C/1.7 mM*

NA+

P. psychrophila

SCRP630

NS++

58°C/1.0 mM*

NA+

EF216640

(accat)4

58°C/1.0 mM*

EF216666

(actg)3

(agc)6

58°C/1.0 mM*

NA+

NS++

58°C/1.7 mM*

NS++

58°C/1.0 mM*

P. quercina

SCRP541

NS++

58°C/1.0 mM*

NA+

EF216638

No SSR

58°C/1.0 mM*

EF216674

No SSR

58°C/1.0 mM*

NA+

EF216651

(aag)8

(aag)4

58°C/1.7 mM*

NA+

P. ramorum

SCRP911

NS++

58°C/1 mM*

NA+

EF216637

(agc)4

(agc)10

(agc)4

58°C/1.0 mM*

EF216665

(agc)24

58°C/1.0 mM*

EF216659

(aagcc)4

(agg)9

(aag)7

58°C/1.7 mM*

EF216650

(aag)10

58°C/1.7 mM*

EF216627

(atc)4

(agg)8

58°C/1.0 mM*

P. sojae

SCRP555

NA+

NA+

EF216636

(agc)5

58°C/1.0 mM*

EF216670

(agc)10

(agcg)5

58°C/1.0 mM*

EF216658

(agg)5

(aag)6

(agg)4

58°C/1.7 mM*

EF216649

(acg)4

(aag)4

58°C/1.7 mM*

NA+

(a) = Primers listed in Table 2 and not reported in this table are those that did not produce any reliable sequence (see text).

(1) = Primer R1F was replaced by primer R2F for P. cambivora, P. inundata, P. nemorosa, P. ilicis and P. fragaria.

(2) = Primer R9R was replaced by primer R8R for P. quercina.

NA+ = Isolate-primer combinations that did not produce any amplification or produced complex profiles (two or more fragments).

NS++ = Isolate-primer combinations for which single PCR bands were obtained but direct sequencing did not produce reliable results.

°C/mM* = Selected annealing temperature (°C) and MgCl2 concentration (mM) in PCR reactions.

Table 5

Accession numbers and SSRs for GenBank deposited sequences http://www.ncbi.nlm.nih.gov/ amplified from 16 Phytophthora species (Table 1) using primers designed on P. infestans with the first approach (Fig. 1A).

Phytophthora

species

SELECTED PRIMERS(a)

 

I3F-4R

I5F-I6R

I7F-I8R

I9F-I10R

I11F-I12R

I13F-I14R

P. alni subsp. alni

SCRP2

NS++

58°C/1.7 mM*

EF216535

No SSR;

58°C/1.0 mM*

NS++

58°C/1.7 mM*

EF216513

(aag)4

(agg)6

58°C/1.0 mM*

NA+

EF216477

(agg)4

(aag)5

58°C/1.7 mM*

P. cambivora

SCRP67

NS++

58°C/1.7 mM*

NA+

NS++

58°C/1.7 mM*

EF216516

(acg)4

(aag)5

(agg)6

58°C/1.0 mM*

NS++

58°C/1.7 mM*

EF216478

(agg)5

(aag)5

58°C

1.7 mM*

P. cinnamomi

SCRP115

NS++

58°C/1.7 mM*

NS++

58°C/1.7 mM*

NS++

58°C/1.7 mM*

EF216509

(aag)14

58°C/1.0 mM*

EF216494

(aag)4

58°C/1.7 mM*

NS++

58°C/1.7 mM*

P. citricola

SCRP130

NS++

58°C/1.7 mM*

EF216534

(agc)4; (agc)5

58°C/1.0 mM*

NS++

58°C/1.7 mM*

EF216520

(aag)4

58°C/1.0 mM*

EF216498

(aag)4

58°C/1.7 mM*

EF216482

(agg)9

(aag)5

58°C/1.7 mM

P. europaea

SCRP622

NS++

58°C/1.7 mM*

NS++

58°C/1.0 mM*

NS++

58°C/1.7 mM*

EF216512

No SSR

58°C/1.0 mM*

NS++

58°C/1.7 mM*

EF216476

(agg)5

(aag)5

58°C/1.7 mM*

P. fragariae

var. rubi

SCRP333

NS++

58°C/1.7 mM*

NA+

NA+

EF216500

(acg)4

58°C/1.0 mM*

NA+

NA+

P. ilicis

SCRP377

NS++

58°C/1.7 mM*

EF216532

(agc)9

58°C/1.0 mM*

NA+

EF216501

No SSR

58°C/1.0 mM*

EF216495

No SSR

58°C/1.7 mM*

EF216483

(aag)4

(agc)4

58°C/1.7 mM

P. infestans

sc 03.26.3.3

NS++

58°C

1.7 mM*

EF216524

(agc)6

(agc)5

58°C/1.0 mM

NS++

58°C/1.7 mM*

EF216499

(aag)11

58°C/1.0 mM*

EF216487

(acc)8

58°C/1.7 mM*

EF216474

(aag)7

(aag)4

58°C/1.7 mM

P. inundata

SCRP644

NS++

58°C/1.7 mM*

NS++

58°C/1.0 mM*

NS++

58°C/1.7 mM*

EF216508

No SSR

58°C/1.0 mM*

EF216497

No SSR

58°C/1.7 mM*

NA+

P. lateralis

SCRP390

NS++

58°C/1.7 mM*

EF216527

(agc)4

58°C/1.0 mM*

NS++

58°C/1.7 mM*

EF216507

No SSR

58°C/1.0 mM*

EF216493

No SSR

58°C/1.7 mM*

EF216481

(agg)5

(aag)4

58°C/1.7 mM*

P. nemorosa

SCRP910

NS++

58°C/1.7 mM*

EF216531

(agc)7

58°C/1.0 mM*

NA+

EF216503

No SSR

58°C/1.0 mM*

EF216492

(aag)4

58°C/1.7 mM*

EF216486

(acg)4

(aag)4

(agc)4

58°C/1.7 mM*

P. pseudosyringae

SCRP674

NS++

58°C/1.7 mM*

EF216529

(agc)7

58°C/1.0 mM*

NS++

58°C/1.7 mM*

EF216502

No SSR

58°C/1.0 mM*

EF216496

(aag)5

58°C/1.7 mM*

EF216485

(acg)4

(aag)4

58°C/1.7 mM*

P. psychrophila

SCRP630

NS++

58°C/1.7 mM*

EF216528

(agc)4

58°C/1.0 mM*

NS++

58°C/1.7 mM*

NA+

EF216491

(aag)4

58°C/1.7 mM*

EF216484

(aag)4

(agc)4

58°C/1.7 mM*

P. quercina

SCRP541

NS++

58°C/1.7 mM*

NS++

58°C/1.0 mM*

NS++

58°C/1.7 mM*

EF216506

No SSR

58°C/1.0 mM*

EF216490

(aag)5

58°C/1.7 mM*

EF216480

(agg)6

(aag)4

58°C/1.7 mM*

P. ramorum

SCRP911

NS++

58°C/1.7 mM*

EF216525

No SSR

58°C/1.0 mM*

NS++

58°C/1.7 mM*

EF216505

No SSR

58°C/1.0 mM*

EF216489

(acc)4

58°C/1.7 mM*

EF216479

(aac)7

(agg)9

58°C/1.7 mM

P. sojae

SCRP555

NS++

58°C/1.7 mM*

EF216526

No SSR

58°C/1.0 mM*

NA+

EF216504

(agc)4

58°C/1.0 mM*

EF216488

No SSR

58°C/1.7 mM*

EF216475

(agg)7

(aag)5

58°C/1.7 mM*

(a) = Primers listed in Table 2 and not reported in this table are those that did not produce any reliable sequence (see text).

NA+ = Isolate-primer combinations that did not produce any amplification or produced complex profiles (two or more fragments).

NS++ = Isolate-primer combinations for which single PCR bands were obtained but direct sequencing did not produce reliable results.

°C/mM* = Selected annealing temperature (°C) and MgCl2 concentration (mM) in PCR reactions.

The resultant primers enabled the amplification of 271 single PCR bands of the expected size (Fig. 2). In the remaining primer-species combinations, 193 amplifications did not produce any product or produced complex profiles (two or more PCR fragments) impeding direct sequencing (Fig. 2). Some primer combinations failed to amplify a product from any of the Phytophthora species whereas other combinations amplified single bands from all or most Phytophthora species (Tables 3, 4, 5).
https://static-content.springer.com/image/art%3A10.1186%2F1471-2164-9-620/MediaObjects/12864_2008_Article_1813_Fig2_HTML.jpg
Figure 2

Amplification results obtained with 16 Phytophthora species (Table 1) using primers designed against P. sojae, P. ramorum and P. infestans genomes using Approach 1 (Fig. 1A). NA represents primer-species combinations in which amplification reactions did not produce any product or produced complex profiles (two or more PCR fragments) preventing direct sequencing. NS represents primer-species combinations in which amplification reactions produced single PCR bands, however direct sequencing did not yield reliable sequences. SQ represents primer-species combinations in which reliable sequences were obtained.

Sequencing of single PCR bands and scanning for SSRs

All single PCR bands (271) were purified to remove excess primers and nucleotides and sequenced in both directions using the same primers used for the amplification. When forward and/or reverse sequences were not identical, amplification, purification and sequencing were repeated twice and all unreliable sequences were discarded. Finally, 171 sequences were obtained with primers designed against P. sojae (70), P. ramorum (50) and P. infestans (51) genomes (Fig. 2) and scanned to identify SSRs by means of sputnik. Sequenced regions contained a total number of 211 SSRs distributed across the genome of the 16 target species with those of clade 7 (P. alni, P. cambivora, P. europaea, P. fragariae and P. sojae) and clade 8 (P. lateralis and P. ramorum) more highly represented (Fig. 3; Tables 3, 4, 5). A single microsatellite was identified in P. inundata. All SSRs identified in P. infestans were amplified with primers designed against its own genome (Fig. 3). Identified SSRs ranged in the number of repeats from 4 to 16, from 3 to 16 and from 4 to 14 in P. sojae, P. ramorum and P. infestans respectively (Tables 3, 4, 5). A single repeat of 24 was found in an SCRI isolate of P. ramorum (Table 4). Most SSRs were of seven repeats or less (88.9% P. infestans, 82.8% P. ramorum, 76.8 P. sojae), with a repeat number of four being the most common in all species (Fig. 4). Overall, the most common motifs were (AAG)n, (AGG)n and (AGC)n representing 40.9%, 23.3% and 17.6% respectively of the total number of identified SSRs (Fig. 5). Trinucleotide repeats were the most common (94.7%) followed by pentanucleotide (2.4%), tetranucleotide (1.9%) and dinucleotide (1.0%) repeats.
https://static-content.springer.com/image/art%3A10.1186%2F1471-2164-9-620/MediaObjects/12864_2008_Article_1813_Fig3_HTML.jpg
Figure 3

Number of SSRs identified for each of the 16 Phytophthora species using primers designed against P. sojae, P. ramorum and P. infestans genomes (Approach 1, Fig. 1A).

https://static-content.springer.com/image/art%3A10.1186%2F1471-2164-9-620/MediaObjects/12864_2008_Article_1813_Fig4_HTML.jpg
Figure 4

Number of repeated motifs identified in 16 target Phytophthora species (Table 1) using primers designed against P. sojae, P. ramorum and P. infestans genomes according to Approach 1 (Fig. 1A).

https://static-content.springer.com/image/art%3A10.1186%2F1471-2164-9-620/MediaObjects/12864_2008_Article_1813_Fig5_HTML.jpg
Figure 5

List and frequency of the different SSR motifs identified in 16 Phytophthora species (Table 1 ) using primers designed on P. sojae, P. ramorum and P. infestans genomes according to Approach 1 (Fig. 1A ).

To evaluate intraspecific variability a few selected target regions amplified by primers S23F-S25R, S21F-S22R, I9-I10 and I5-6 (Table 2) were examined and sequenced from additional isolates of P. alni, P. cambivora, P. cinnamomi, P. pseudosyringae and P. ilicis (Table 1). The analysed target regions did not show intraspecific variability among analysed isolates of P. alni subsp. alni, P. pseudosyringae or P. ilicis, whereas P. cambivora and P. cinnamomi isolates were polymorphic in all the tested primer combinations. As an example, the target region amplified with primers I9-I10 from P. cinnamomi was characterised by 12, 14 and 18 repeated motifs (AGG) in three tested isolates (Table 6).
Table 6

Accession numbers and SSRs for selected microsatellites amplified and sequenced from two or more isolates of the same species to evaluate intraspecific variability.

Phytophthora species

Phytophthora isolates

Primers

SSRs

Accession

number

P. alni subsp. alni

SCRP2

S23F-S25R

(agg)7; (aag)10; (agg)16; (aag)12; (aag)4

EF216565

 

SCRP4

 

(agg)7; (aag)10; (agg)16; (aag)12; (aag)4

EF216567

 

SCRP8

 

(agg)7; (aag)10; (agg)16; (aag)12; (aag)4

EF216566

P. cambivora

SCRP67

S23F-S25R

(agg)10; (aag)10; (agg)9; (aag)12; (agg)4; (agg)7

EF216569

 

SCRP75

 

(agg)9; (aag)10; (agg)11; (aag)12; (agg)6

EF216571

 

SCRP82

 

(agg)10; (aag)10; (agg)9; (aag)12; (agg)5

EF216570

P. cambivora

SCRP67

S21F-S22R

(agg)4; (aag)5; (aag)4

EF216581

 

SCRP80

 

(agg)4; (aag)5; (aag)4

EF216582

 

SCRP82

 

(aag)4; (agg)6; (agg)4

EF216583

P. cambivora

SCRP67

I9F-I10R

(acg)4; (aag)4; (agg)6

EF216516

 

SCRP75

 

(acg)4; (aag)4; (agg)6

EF216519

 

SCRP80

 

(acg)4; (aag)4; (agg)6

EF216517

 

SCRP82

 

(aag)5; (agg)5

EF216518

P. cinnamomi

SCRP115

I9F-I10R

(aag)14

EF216509

 

SCRP118

 

(aag)18

EF216511

 

SCRP121

 

(aag)12

EF216510

P. pseudosyringae

SCRP674

I5F-I6R

(agc)7

EF216529

 

SCRP734

 

(agc)7

EF216530

P. ilicis

SCRP377

I5F-I6R

(agc)9

EF216532

 

SCRP379

 

(agc)9

EF216533

Approach 2 – Identification of SSRs in Phytophthora spp. clade 7

The aim of this approach was to focus the search for SSR loci to a restricted range of four clade 7 Phytophthora species (P. alni, P. cambivora, P. europaea and P. fragariae) phylogenetically related to P. sojae (Fig 1B) [9].

Identification of target regions

This approach was based on a detailed list of SSRs identified in the genome of P. sojae and provided by Dr. Niklaus Grunwald at the Agricultural Research Service, U.S. Department of Agriculture, Corvallis, Oregon. Among the list, sixty genomic regions (500–1000 bp) were manually selected on the basis of having the longest SSRs in exons (20), introns (20) and non coding regions (20). The selected regions (Table 7) were screened using BLAST against the entire genomes of P. ramorum and P. infestans to search for homology irrespective of the SSR regions. None of these regions aligned with sequences from the P. infestans genome whereas 18 of the 60 regions were sufficiently conserved to match homologous genes in P. ramorum (6 were localised in exons and 12 in introns). Surprisingly none of these 18 regions contained SSRs in P. ramorum, however it was hypothesised that microsatellites could be present in homologous regions of other Phytophthora species more closely related to P. sojae. To verify this hypothesis, thirty-six primers (18 pairs) were designed in the conserved flanking regions and used to amplify the target regions from P. alni, P. cambivora, P. europaea, P. fragariae and an SCRI isolate of P. sojae (Table 7). Degenerate primers were designed when necessary.
Table 7

Set of primers designed with the 2nd approach (Fig. 1B) to amplify genomic regions potentially containing SSRs in Phytophthora species of clade 7 [2].

Forward primer

Reverse Primer

SSRs

Source(a)

Gene(b)

S38F

TCGTSTTCTACGTGCTGGAY

S39R

GTAGCACGCGAACATGAASA

(AAC)18

scaffold_26:

667079–667377

E

S40F

TTCCTTAAGTGGGGGAGGAT

S41R

TRTCGGCRTTCAGCTTCTGT

(AAG)4; (AAG)22

scaffold_125:

153837–154222

I

S42F

GCTGCAAGAGTCSCTCGAGTA

S43R

CTTGAGGATGTCRATGAGCA

(AG)21

scaffold_89:

132819–133248

I

S44F

GTRGCTCCTTCCTTAAGTGG

S45R

GTGCTGCASGTAYGGCTTC

(AAG)17

scaffold_75:

344500–344901

I

S46F

GTTGCGCGTGAGGTTCTC

S47R

CAAAAGCTCTGCGTCC

(AG)22

scaffold_67:

282390–282656

I

S48F

YCGGGCSACGGTAGG

S49R

AAGAGCGTRAGCAGGAACC

(AG)18

scaffold_65:

225236–225440

I

S50F

GTGGCTTCCACTGYTGCTG

S51R

YATCAAGGACGTCAACTCGA

(AAC)9; (AACAGC)23

scaffold_48:

118994–119610

E

S52F

CGGGATTTRTCRGATCAGG

S53R

CTGTYTGATCARCTCTCCGCT

(AGG)19

scaffold_46:

153312–153646

E

S56F

CACGAGCTGCAGKCATAYCT

S57R

AGAATKGAMGCGATCGAC

(AGG)16

scaffold_21:

370731–371140

E

S58F

TCGATCRACAGAAGCTGCWA

S59R

GGAGTTCGCCATCAACAACT

(AAG)14

scaffold_19:

606139–606624

I

S60F

GGCGTTTAAAGGCGTTTAAA

S61R

CGTCTTCTTCTTGACGCACA

(AC)18

scaffold_52:

422559–422915

I

S64F

YTTGCGACTAGCAAAGTGG

S65R

CGAACTCCTTGTACAGGATGG

(AG)14

scaffold_56:

179585–179895

E

S66F

GCAGYAGGCCCGGCCT

S67R

GGAGTTCGCCATCAACAACT

(AAG)11

scaffold_12:

130593–130967

E

S68F

CGTCGGTGGAGTAAACATCA

S69R

AAAGGCGTTCGGAGAGYTG

(AG)14

scaffold_66:

83968:84423

I

S70F

ATGACGAGGCAGCAGTTGAC

S71R

AAGAACWGCGTSTACCTGCG

(ATC)13

scaffold_2:

564977–565285

I

S72F

GCARCAATCTTCTGCTTYTTC

S73R

ACACCTSCGTACWTTCGTCA

(AAC)12

scaffold_92:

221631–221935

I

S74F

CGGTGGTACTTGTCGTCCTC

S75R

TSTCCGGCTACATCATCATC

(ATT)12

scaffold_41:

327977–328190

I

S76F

GCATCTACGACCAGATCTACCC

S77R

GTAGACSGAGATGATGGCGT

(AC)8

scaffold_127:

112530–112930

I

(a) = Gene sequences available at http://genome.jgi-psf.org/sojae1/sojae1.home.html.

(b) E = exons; I = Introns

Amplification, sequencing and SSR scoring

Most primer-species combinations produced single PCR bands of the expected size (Table 8). Purification and direct sequencing of these PCR fragments produced 54 reliable sequences which were analysed as previously described for Approach 1. Twelve different microsatellites were identified: 2 in P. europaea, 3 in P. fragariae and P. alni and 4 in P. cambivora (Table 8). Among these, 10 were trinucleotides and 2 were tetranucleotides repeated 4, 5 or 6 times. All regions sequenced from the SCRI isolate of P. sojae contained the predicted/expected SSR (Table 8).
Table 8

Accession numbers and SSRs for GenBank deposited sequences amplified using primers designed with the second approach (Fig. 1B).

Selected

primers(a)

Phytophthora species

 

P. alni subsp. alni

SCRP2

P. cambivora

SCRP67

P. europaea

SCRP622

P. fragariae

SCRP333

P. sojae

SCRP555

S38–39

EF382833

No SSR

EF382832

No SSR

EF382831

No SSR

EF382830

No SSR

EF382829

(aac)18

S40–41

NS++

EF382801

(aac)4

EF382800

No SSR

EF382799

(aac)4

NS++

S42–43

NS++

EF382798

(ACG)6

EF382797

(acg)6; (agg)5

EF382796

No SSR

EF382795

(ag)21

S44–45

EF382793

(aac)4

EF382792

(aac)4

EF382794

No SSR

NS++

EF382791

(aag)5; (aag)5

S50–51

EF382790

Any SSR

NA+

EF382789

No SSR

EF382788

No SSR

NS++

S52–53

NA+

EF382786

No SSR

EF382787

No SSR

NS++

EF382785

(agg)19

S58–59

EF382784

(aac)4

EF382783

(aac)4

EF382782

No SSR

EF382781

(aac)4

EF382780

(aag)5; (aag)5

S64–65

EF382828

No SSR

EF382827

No SSR

EF382826

No SSR

EF382825

No SSR

EF382824

(ag)14

S68–69

EF382820

(aagg)4

EF382821

No SSR

EF382822

No SSR

EF382831

(aac)4; (aagg)4

EF382819

(ag)14

S70–71

EF382815

No SSR

EF382816

No SSR

EF382817

No SSR

EF382818

No SSR

EF382814

(act)13

S72–73

EF382810

No SSR

EF382811

No SSR

EF382812

No SSR

EF382813

No SSR

EF382809

(aac)12

S74–75

NS++

NS++

EF382807

No SSR

EF382808

No SSR

EF382806

(aat)12

S76–77

EF382802

No SSR

EF382803

No SSR

NS++

EF382805

No SSR

EF382804

(ac)8

(a) = Primers listed in Table 7 and not reported in this table are those that did not produce any reliable sequence.

NA+ = Isolate-primer combinations that did not produce any amplification or produced complex profiles (two or more fragments).

NS++ = Isolate-primer combinations for which single PCR bands were obtained but direct sequencing did not produced reliable results.

Discussion

The present study was undertaken to develop a method to rapidly identify loci containing SSRs and to create a pool of microsatellite markers for species of the genus Phytophthora taking advantage of publicly available sequences for P. sojae, P. ramorum and P. infestans. Recently, Garnica et al. explored the transferability of microsatellites across P. sojae, P. ramorum and P. infestans via an in silico virtual PCR approach [27]. In the present study, such an analysis on the same three species was conducted but also followed up with a comprehensive screening and validation process on multiple species to provide a practical evaluation of the procedure as a means of accelerating the search for new SSR markers in the genus Phytophthora.

The first approach was aimed at the identification of informative SSR loci common to many Phytophthora species. This approach was based on the hypothesis that among the large number of microsatellites distributed across the genome of species of the genus there may be a proportion in genes common to many species with sufficient sequence conservation in flanking regions to allow the design and use of universal SSR primers. Our search of the predicted gene sets yielded approximately 10% fewer SSRs and a corresponding lower abundance of SSRs per Mb of sequence than that of Garnica et al [27]. Preliminary analyses revealed a very limited number of loci containing SSRs that were common to the three Phytophthora species tested. The majority of the identified loci (81.6%) were common to P. sojae and P. ramorum only which is consistent with their closer phylogenetic relationship in clades 7 and 8 than to P. infestans in clade 1 [9, 2, 3]. Similarly, Garnica et al. found in their in silico analysis that 7.5% of their primers were, in theory, transferable between at least two species (mainly P. ramorum and P. sojae) and only 1.0% transferable between the three species [27]. Among the selected sequences satisfying the above conditions, the number of repeats ranged from 3 to 17 and most SSRs showed seven repeats or less, with a repeat number of four being the most common in all species. The abundance of different repeat motifs differed slightly between species however, on average, (AAG)n, (AGG)n and (AGC)n were the most abundant triplets in all three Phytophthoras (Fig. 5). These results differ from those reported by Garnica et al. in which (AGC)n, (ACG)n and (AGG)n were the most abundant triplets amongst all the screened EST sequences [27]. It should, however be considered that unlike the study of Garnica our data are confined to SSR sequences for which it was possible to identify a homologue in at least one of the other two species. Therefore it could be hypothesised that motifs (AAG)n and (AGG)n are more abundant in more conserved genes. The dominance of trinucleotide SSRs compared to dinucleotide SSRs was not surprising considering that trinucleotides are abundant in coding regions of all higher eukaryotic genomes [3133]. Dinucleotide repeats, in contrast, are characterised by higher mutation rates which may explain their abundance in introns and non-coding regions and lower frequency in coding regions, which cannot tolerate frame-shift mutations [34, 35].

Primers designed in the present study with the first approach were tested against a panel of 16 different Phytophthora species representing the breadth of diversity across the genus to amplify P. sojae, P. ramorum and P. infestans target regions containing 33, 17 and 8 SSRs respectively. Overall, these primers enabled the sequencing of 171 target regions which contained 211 SSRs ranging in repeat number from 3 to 16. Most of these SSRs showed seven repeats or less with four the most common repeat number and (AAG)n, (AGG)n and (AGC)n the most common motifs. Trinucleotide repeats were dominant followed by pentanucleotide, tetranucleotide and dinucleotide repeats. This data indicate that such an approach can be useful to identify cross-specific SSR loci in the genus Phytophthora. As further genome sequences become available, for example, P. capsici http://www.jgi.doe.gov/sequencing/why/CSP2006/Pcapsici.html, the process can be refined to specific subsets of the genus. The mutation rates and, consequently, the practical utility of the identified SSRs in the study of the specific Phytophthora species need to be examined further. Undoubtedly, a risk of this approach is that the selection is biased towards more conserved sequences which may subsequently have a lower mutation rate that reduces their utility as polymorphic markers. Furthermore, the fact that P. infestans SSRs were all identified using primers designed on its own genome (Fig. 3) may indicate that this approach is less appropriate for distant relatives considering that, as stated above, P. infestans is phylogenetically distant from P. sojae and P. ramorum. However, the identification of intraspecific polymorphisms in some selected SSRs is encouraging and demonstrates that at least some of the selected SSRs are valuable for immediate practical applications (Table 6). This is consistent with the reported applicability of EST-SSRs across closely related taxa in other organisms as well as Phytophthora [23, 3638]. In the present study, the focus on the breadth of species (16) prevented the analyses of a wider number of target regions. However, the same method could be easily applied to the study of more regions from one or a few species.

The application of the first method enabled the identification of novel SSRs from all the 16 target species with those of clade 7 and 8 more highly represented (Fig. 3). A higher proportion of SSRs from species of the clade 7 and 8 was expected considering that P. sojae and P. ramorum belong to these two clades [2, 3]. In light of this fact, a second approach to identify a greater number of polymorphic SSRs from within a more limited range of clade 7 taxa more closely related to P. sojae was investigated. Sixty P. sojae SSR candidates were compared by BLAST analysis against the complete genome sequence of the other two species yielding 18 SSR candidates which could be aligned with homologous regions in P. ramorum. However in none of these 18 candidates (6 exons and 12 introns) was the SSR maintained in P. ramorum. In four of the more closely related species (P. alni, P. cambivora, P. europaea and P. fragariae), however, some of the SSR regions were conserved (Table 8). In this study the focus was on discovery of SSRs in invasive forest Phytophthora species within the clade 7a, perhaps a higher success rate in marker discovery would have followed a search amongst the closest related species in clade 7b (P. sinensis, P. melonis, P. cajanae and P. vignae) [2]. Although a few SSR markers with potential were discovered using this approach, it was not a highly efficient means of identifying new polymorphic SSR loci and highlights the lack of conservation of SSR loci, even amongst coding regions within a single ITS clade of Phytophthora. Some degree of cross-species amplification has been observed between SSRs in P. infestans with other Clade 1c taxa and it is therefore likely that a wider application of this method concentrated on the closest relatives would be more productive [23].

Conclusion

The present study has tested two different methods to generate SSR markers that can be utilised across a broad range of Phytophthora species. The final number of identified loci for any single species may not be sufficient to run a complete population genetics analysis and key studies on the inter- and intraspecific variation remain. A comprehensive dataset of candidate SSRs from a range of species has been created (Table 3, 4, 5). The detailed groundwork needed to amplify these regions from such a diverse collection of species and target regions has been completed which moves beyond the previous in silico approach to improve our understanding of the range and sequence conservation of SSR loci amongst species [27]. In general, the level of interspecific SSR sequence conservation, even amongst more closely related species within a single clade, was low and the method may not be the most efficient means of identifying novel SSR loci. Apart from their application as molecular markers, determining the abundance and density of SSRs in Oomycetes may help understand whether these sequences have any functional and evolutionary significance [17]. Furthermore, irrespective of the microsatellites, some of the amplified regions represent valuable marker regions for a number of applications [39]. A single optimal target gene for all Phytophthora species and assay requirements is unlikely to exist, therefore the continued identification and characterization of new target genes offers new opportunities for detection and phylogenetic studies [3, 40, 41].

Methods

Phytophthora isolates and DNA extractions

Twenty-eight isolates (16 Phytophthora species) sourced from the SCRI culture collection were used in this study (Table 1). Isolates and species were selected to represent taxa most relevant to European forestry that also represented the breadth of Phytophthora diversity defined according to clades based on ITS sequence analysis [2]. Isolates were stored on oatmeal agar at 5°C and grown on French bean agar for routine stock cultures.

Total DNA was extracted from pure cultures of Phytophthora according to Schena and Cooke, diluted to 10 ng/μl and maintained at 5°C for routine amplifications and at -20°C for long term storage [42].

Analysis of sequences from P. infestans, P. sojae and P. ramorum genome projects and scanning for homologous SSRs

The predicted protein datasets of P. infestans (from the NCGR XGI database that was available prior to the Broad genome sequencing project) and P. ramorum and P. sojae http://genome.jgi-psf.org/ were screened for SSR loci using Sputnik (Chris Abaijan http://espressosoftware.com/pages/sputnik.jsp). Pairwise BLAST analysis using the default parameters was used to select loci conserved in different species combinations [43]. Manual screening of these loci on the basis of SSR and flanking region DNA sequence conservation yielded a short-list for further analysis.

Primer design and amplification conditions

All primers (Table 2 and 7) were designed with the Primer3 Software set up to generate a Tm of 60°C ± 2, a GC% between 20 and 80% and a length of 18–26 bp [44]. Primers were purchased from Eurogentec ltd. (Belgium). Considerable effort was made to obtain successful amplification of single PCR bands from as many species as possible. This involved adjustment of MgCl2 concentration (0.7, 1.0 or 1.7 mM) and annealing temperatures (55 or 58°C) for PCR reactions (Table 3, 4, 5). Furthermore in some circumstances alternative primers were designed and tested to amplify the target regions from as many taxa as possible (Table 2). PCR reactions were performed in a total volume of 15 μl containing 10 ng of genomic DNA, 1.5 μl of 10× Reaction Buffer (Promega Corporation, WI, USA), 100 μM dNTPs, 0.7, 1 or 1.7 mM MgCl2, 15 μg BSA, 2 unit of Taq polymerase (Taq DNA polymerase, Promega Corporation) and 1 μM of primers. PCR amplification conditions consisted of: 1 cycle of 95°C for 2 min; 40 cycles of 94°C for 30 s, 55 or 58°C for 30 s, 72°C for 60 s; and a final cycle of 72°C for 5 min.

DNA sequencing

The best primers and amplification conditions were identified for all primer-species combinations and target DNA was re-amplified in a total volume of 50 μl to provide sufficient amplicon for direct sequencing. Single PCR bands were purified with the MinElute PCR Purification Kit (Qiagen Ltd. West Sussex, UK) to remove excess primers and nucleotides. Sequencing was carried out with the same primers utilized for the amplification in a dye-terminator cycle-sequencing reaction (FS sequencing kit, Applied Biosystems, Warrington, UK) and run on an ABI373 automated sequencer (Applied Biosystems). All selected PCR fragments were sequenced using both the forward and the reverse primers.

Sequence analysis and SSRs scanning

The "Sequence Navigator" software (Applied Biosystems) was utilised to evaluate reliability of sequences and to compare forward and reverse sequences to create a consensus sequence. Non-reliable sequences in which both forward and reverse sequences contained doubtful bases were discarded. All sequences obtained in the present study were also parsed to a web version of SPUTNIK http://cbi.labri.fr/outils/Pise/sputnik.html, which uses a recursive algorithm to search for repeated patterns of nucleotides of length between 2 and 5.

Declarations

Acknowledgements

This work was funded by the European Union with a Marie Curie Intra-European Fellowship (Project: MEIFCT-2003-502327) and by the Scottish Government Rural and Environment Research and Analysis Directorate (RERAD). We thank C.M. Brasier and others for providing isolates, N. Williams for invaluable help with the culture collection and Nik Grunwald for providing a list of P. sojae SSR markers. Cultures are held under SASA License No. PH/11/2008.

Authors’ Affiliations

(1)
Department of "Gestione dei Sistemi Agrari e Forestali", Mediterranean University of Reggio Calabria, Località Feo di Vito
(2)
Scottish Crop Research Institute, Invergowrie, Dundee

References

  1. Baldauf SL, Roger AJ, Wenk-Siefert I, Doolittle WF: A Kingdom-level phylogeny of eukaryotes based on combined protein data. Science. 2000, 290: 972-977.View ArticleGoogle Scholar
  2. Cooke DEL, Drenth A, Duncan JM, Wagels G, Brasier CM: A molecular phylogeny of Phytophthora and related Oomycetes. Fungal Genet Biol. 2000, 30: 17-32.View ArticleGoogle Scholar
  3. Kroon LPNM, Bakker FT, Bosch van den GBM, Bonants PJM, Flier WG: Phylogenetic analysis of Phytophthora species based on mitochondrial and nuclear DNA sequences. Fungal Genet Biol. 2004, 41: 766-782.View ArticleGoogle Scholar
  4. Tyler BM, Tripathy S, Zhang X, Dehal P, Jiang RHY, Aerts A, Arredondo F, Baxter L, Damasceno CMB, Dickerman A, Dorrance AE, Dou D, Dubchak I, Garbelotto M, Gijzen M, Gordon S, Govers F, Grunwald N, Huang W, Ivors K, Jones RW, Kamoun S, Krampis K, Lamour K, Lee MK, McDonald WH, Medina M, Meijer HJG, Nordberg E, MacLean DJ, Ospina-Giraldo MD, Morris P, Phuntumart V, Putnam N, Rash S, Rose JKC, Sakihama Y, Salamov AA, Savidor A, Scheuring C, Smith B, Sobral BWS, Terry A, Torto-Alalibo T, Win J, Xu Z, Zhang H, Grigoriev I, Rokhsar D, Boore J: Phytophthora genome sequences uncover evolutionary origins and mechanisms of pathogenesis. Science. 2006, 313: 1261-1265.View ArticleGoogle Scholar
  5. Erwin DC, Ribeiro OK: Phytophthora diseases worldwide. 1996, APS Press, St Paul, MN, USAGoogle Scholar
  6. Jurskis V: Eucalypt decline in Australia, and a general concept of tree decline and dieback. Forest Ecol Manag. 2005, 215: 1-20.View ArticleGoogle Scholar
  7. Ristaino JB, Gumpertz ML: New frontiers in the study of dispersal and spatial analysis of epidemics caused by species in the genus Phytophthora. Annu Rev Phytopathol. 2000, 38: 541-576.View ArticleGoogle Scholar
  8. Rizzo DM, Garbelotto M, Hansen EM: Phytophthora ramorum: integrative research and management of an emerging pathogen in California and Oregon forests. Annu Rev Phytopathol. 2005, 43: 309-335.View ArticleGoogle Scholar
  9. Blair JE, Coffey MD, Park S, Geiser DM, Kang S: A multi-locus phylogeny for Phytophthora utilizing markers derived from complete genome sequences. Fungal Genet Biol. 2008, 45: 266-277.View ArticleGoogle Scholar
  10. De Merlier D, Chandelier A, Debruxelles N, Noldus M, Laurent F, Dufays E, Claessens H, Cavelier M: Characterization of alder Phytophthora isolates from Wallonia and development of SCAR primers for their specific detection. J Phytopathol. 2005, 153: 99-107.View ArticleGoogle Scholar
  11. Cooke DEL, Young V, Birch PRJ, Toth R, Gourlay F, Day JP, Carnegie S, Duncan JM: Phenotypic and genotypic diversity of Phytophthora infestans populations in Scotland (1995–97). Plant Pathol. 2003, 52: 181-92.View ArticleGoogle Scholar
  12. Ivors KL, Hayden K, Bonants PJM, Rizzo DM, Garbelotto M: AFLP and phylogenetic analyses of North American and European populations of Phytophthora ramorum. Mycol Res. 2004, 108: 378-392.View ArticleGoogle Scholar
  13. Cooke DEL, Lees AK: Markers, old and new, for examining Phytophthora infestans diversity. Plant Pathol. 2004, 53: 692-704.View ArticleGoogle Scholar
  14. Selkoe KA, Toonen RJ: Microsatellites for ecologists: a practical guide to using and evaluating microsatellite markers. Ecol Lett. 2006, 9: 615-629.View ArticleGoogle Scholar
  15. Mascheretti S, Croucher PJP, Vettraino A, Prospero S, Garbelotto M: Reconstruction of the Sudden Oak Death epidemic in California through microsatellite analysis of the pathogen Phytophthora ramorum. Mol Ecol. 2008, 17: 2755-2768.View ArticleGoogle Scholar
  16. Li YC, Korol AB, Fahima T, Beiles A, Nevo E: Microsatellites: genomic distribution, putative functions, and mutational mechanisms: A review. Mol Ecol. 2002, 11: 2453-2465.View ArticleGoogle Scholar
  17. Toth G, Gaspari Z, Jurka J: Microsatellites in different eukaryotic genomes: survey and analysis. Genome Res. 2000, 10: 967-981.PubMed CentralView ArticleGoogle Scholar
  18. Chistiakov DA, Hellemans B, Volckaert FAM: Microsatellites and their genomic distribution, evolution, function and applications: A review with special reference to fish genetics. Aquaculture. 2006, 255: 1-29.View ArticleGoogle Scholar
  19. Gobbin D, Pertot I, Gessler C: Identification of microsatellites markers for Plasmopara viticola and establishment of high-throughput method for SSR analysis. Eur J Plant Pathol. 2003, 109: 153-164.View ArticleGoogle Scholar
  20. Dobrowolski MP, Tommerup IC, Blakeman HD, O'Brien PA: Non-mendelian inheritance revealed in a genetic analysis of sexual progeny of Phytophthora cinnamomi with microsatellite markers. Fungal Genet Biol. 2002, 35: 197-212.View ArticleGoogle Scholar
  21. Dobrowolski MP, Tommerup IC, Shearer BL, O'Brien PA: Three clonal lineages of Phytophthora cinnamomi in Australia revealed by microsatellites. Phytopathology. 2003, 93: 695-704.View ArticleGoogle Scholar
  22. Knapova G, Gisi U: Phenotypic and genotypic structure of Phytophthora infestans populations on potato and tomato in France and Switzerland. Plant Pathol. 2002, 51: 641-653.View ArticleGoogle Scholar
  23. Lees AK, Wattier R, Shaw DS, Sullivan L, Williams NA, Cooke DEL: Novel microsatellite markers for the analysis of Phytophthora infestans populations. Plant Pathol. 2006, 55: 311-319.View ArticleGoogle Scholar
  24. Ivors K, Garbelotto M, Vries ID, Ruyter-Spira C, Te Hekkert B, Rosenzweig N, Bonants P: Microsatellite markers identify three lineages of Phytophthora ramorum in US nurseries, yet single lineages in US forest and European nursery populations. Mol Ecol. 2006, 15: 1493-505.View ArticleGoogle Scholar
  25. Prospero S, Black JA, Winton ML: Isolation and characterization of microsatellite markers in Phytophthora ramorum, the causal agent of sudden oak death. Mol Ecol. 2004, 4: 672-674.View ArticleGoogle Scholar
  26. Glenn TC, Schable NA: Isolating microsatellite DNA loci. Molecular evolution: producing the biochemical data, part B. Edited by: Zimmer EA, Roalson E. 2005, Academic Press, San Diego, USA, 202-222.View ArticleGoogle Scholar
  27. Garnica DP, Pinzón AM, Quesada-Ocampo LM, Bernal AJ, Barreto E, Grünwald NJ, Restrepo S: Survey and analysis of microsatellites from transcript sequences in Phytophthora species: frequency, distribution, and potential as markers for the genus. BMC Genomics. 2006, 7: 245-PubMed CentralView ArticleGoogle Scholar
  28. Robinson AJ, Love CG, Batley J, Barker G, Edwards D: Simple sequence repeat marker loci discovery using SSR primer. Bioinformatics. 2004, 20: 1475-1476.View ArticleGoogle Scholar
  29. Prospero S, Hansen EM, Grünwald NJ, Winton LM: Population dynamics of the sudden oak death pathogen Phytophthora ramorum in Oregon from 2001 to 2004. Mol Ecol. 2007, 16: 2958-2973.View ArticleGoogle Scholar
  30. Widmark AK, Andersson B, Cassel-Lundhagen A, Sandström M, Yuen JE: Phytophthora infestans in a single field in southwest Sweden early in spring: symptoms, spatial distribution and genotypic variation. Plant Pathol. 2007, 56: 573-579.View ArticleGoogle Scholar
  31. Borstnik B, Pumpernik D: Tandem repeats in protein coding regions of primate genes. Genome Res. 2002, 12: 909-915.PubMed CentralView ArticleGoogle Scholar
  32. Metzgar D, Bytof J, Wills C: Selection against frameshift mutations limits microsatellite expansion in coding DNA. Genome Res. 2000, 10: 72-80.PubMed CentralGoogle Scholar
  33. Subramanian S, Madgula VM, George R, Mishra RK, Pandit MW, Kumar CS, Singh L: Triplet repeats in human genome: distribution and their association with genes and other genomic regions. Bioinformatics. 2003, 19: 549-552.View ArticleGoogle Scholar
  34. Karaoglu H, Lee CMY, Meyer W: Survey of simple sequence repeats in completed fungal genomes. Mol Biol Evol. 2004, 22: 639-649.View ArticleGoogle Scholar
  35. Katti MV, Ranjekar PK, Gupta VS: Differential distribution of simple sequence repeats in eukaryotic genome sequences. Mol Biol Evol. 2001, 18: 1161-1167.View ArticleGoogle Scholar
  36. Cordeiro GM, Casu R, McIntyre CL, Manners JM, Henry RJ: Microsatellite markers from sugarcane (Saccharum spp.) ESTs cross transferable to Erianthus and Sorghum. Plant Sci. 2001, 160: 1115-1123.View ArticleGoogle Scholar
  37. Woodhead M, Russell J, Squirrell J, Hollingsworth PM, Cardle L, Ramsay L, Gibby M, Powell W: Development of EST-SSRs from the Alpine lady-fern, Athyrium distentifolium. Mol Ecol Notes. 2003, 3: 287-290.View ArticleGoogle Scholar
  38. Zhan A, Bao ZM, Wang XL, Hu JJ: Microsatellite markers derived from bay scallop Argopecten irradians expressed sequence tags. Fisheries Science. 2005, 71: 1341-1346.View ArticleGoogle Scholar
  39. Cooke DEL, Schena L, Cacciola SO: Tools to detect, identify and monitor Phytophthora species in natural ecosystems. J Plant Pathol. 2007, 89: 13-28.Google Scholar
  40. Schena L, Hughes KJD, Cooke DEL: Detection and quantification of P. ramorum, P. kernoviae, P. citricola and P. quercina in symptomatic leaves by multiplex real-time PCR. Mol Plant Pathol. 2006, 7: 365-379.View ArticleGoogle Scholar
  41. Schena L, Duncan JM, Cooke DEL: Development and application of a PCR based "molecular tool box" for the detection of Phytophthora species damaging forests and natural ecosystems. Plant Pathol. 2008, 57: 64-75.Google Scholar
  42. Schena L, Cooke DEL: Assessing the potential of regions of the nuclear and mitochondrial genome to develop a "molecular tool box" for the detection and characterization of Phytophthora species. J Microbiol Methods. 2006, 67 (1): 70-85.View ArticleGoogle Scholar
  43. Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ: Basic local alignment search tool. J Mol Biol. 1990, 215: 403-410.View ArticleGoogle Scholar
  44. Rozen S, Skaletsky HJ: Primer3 on the WWW for general users and for biologist programmers. Methods Mol Biol. 2000, 132: 365-386.Google Scholar

Copyright

© Schena et al; licensee BioMed Central Ltd. 2008

This article is published under license to BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Advertisement