Table 2 List of MITEs detected in the aphid’s genomes. NR = no related autonomous copy identified. Presence of short direct repeat (microhomologies) in the region of deletion breakpoints are indicated: BPEE for Breaking Point Exact Exact and BPNN for Breaking Point Near Near (according to the nomenclature proposed by Negoua et al. [49])
From: Diversity and evolution of mariner-like elements in aphid genomes
Clade | Tribe | Species | ID MITE | Length (bp) | Sublineage | Copy number | TIR sequences | Autonomous element related to MITE | Breakpoints | |
|---|---|---|---|---|---|---|---|---|---|---|
sequences | Average identity (%) | |||||||||
irritans DD34D | Macrosiphinimar | A. pisum | MITE1.1 | 923–1165 | sub1 | 5 | CGAGGCRTGTCCAGAAAGTAAGTGTACT | Apismar1.1 | 90.8 | - |
sub2 | 4 | CGAGGCGTGTCCCAAAARTAAGGTCTCCAT | NR | - | ||||||
M. persicae | MITE1.2 | 959, 1007 | sub1 | 2 | CGAGGCGTGTCCWGAAAGWAAGTGTACT | Mpmar1.1 | 92 | BPEE | ||
Batmar-like | A. pisum | MITE2.1 | 908–931 | sub1 | 3 | CGAGGTRTGACAATAAAATAACGAGACTTT | Apismar2.1 | 98.6 | ||
M. persicae | MITE2.2 | 908–912 | sub1 | 3 | 97 | BPNN | ||||
rosa DD41D | Crmar2-like | A. pisum | MITE4.1 | 349–548 | sub1 | 8 | AAGGGTGTCTCAAAAAGAACGCCGGATTTRAA | Apismar4.1 | 94.5 | BPEE |
sub2 | 4 | RGGRTRYCWCAAAAARAAGSGYGGATTTKRAA | 74.6 | |||||||
D. noxia | MITE4.2 | 578 | sub1 | 2 | WAGGGTGTCTCAAAAAGAACGCCGGATTTRAA | 97 | ||||
LTIR | DD41D | D. noxia | MITE5.1 | 790–822 | sub1 | 5 | TCACCAATTTAGGGATCACTGAATTTCTCGGC… | Apismar5.1 | 86.2 | BPEE |
DD40D | A. pisum | MITE5.2 | 411–441 | sub1 | 4 | AATGTGTCAAACTTCTAGAGGTGTTTCTACAC… | Apismar5.2 | 90.25 | BPEE | |
sub2 | 3 | 90 | BPNN | |||||||