Skip to main content

Table 1 PCR primer pairs for qRT-PCR expression analyses.

From: Population-specific gene expression in the plant pathogenic nematode Heterodera glycines exists prior to infection and during the onset of a resistant or susceptible reaction in the roots of the Glycine max genotype Peking

Afx probe set Genbank ID Gene Primers amplicon size (bp)
HgAffx.15612.1.S1_at CB281382 Hg-unc-9 F: 5'AGCCTAATGATGATCGAAACACTC3' 135
    R: 5'GAAACTGATCAGCACCGAAAATG3'  
HgAffx.18723.1.S1_at CA940457 Hg-unc-15 F: 5'TTGCGGAGCTGGAAATGACC3' 105
    R: 5'GGCTGGCCTGCAACACCTT3'  
HgAffx.21154.1.S1_at CK394306 Hg-unc-27 F: 5'TGGAGGAGGAGAAGTACGACATCA3' 133
    R: 5'TCATATTTGGACACTTTCTTCAGC3'  
HgAffx.17035.1.S1_at CB279321 Hg-unc-60B F: 5'AGGCGACTTTGGGGCTGGAGAG3' 121
    R: 5'ACGGCGGGGCAATTTTAGGTTC3'  
HgAffx.13291.1.S1_at CB374691 Hg-unc-97 F: 5'AGAGATCGGCGGAGCACTTTAC3' 106
    R: 5'CAGCGCGGTCACCACTCTTTC3'  
HgAffx.21881.2.S1_at CK351699 Hg-unc-112 F: 5'GGGCCTCCACTTGGTCACTATTAT3' 118
    R: 5'GTTCCGACATCCCTTCACTGCTC3'  
HgAffx.11541.1.S1_at CB934909 Hg-dys-1 F: 5'GGGCGATGACATGCGTGACTTC3' 150
    R: 5'GCCTCTGTTTCCGCGTTCTGTGG3'  
  1. For the PCR primers, the Genbank match for each unc homolog is provided. The amplicon length is provided in base pairs.