Skip to main content

Advertisement

Table 1 List of primers for amplification and full double-stranded sequence coverage of the entire mtDNA codR

From: Sequencing strategy for the whole mitochondrial genome resulting in high quality sequences

  Name Sequence 5' Corresponding fragment
PCR FampA AAATCTTACCCCGCCTGTTT A
PCR RampA AATTAGGCTGTGGGTGGTTG A
PCR FampB GCCATACTAGTCTTTGCCGC B
PCR RampB GGCAGGTCAATTTCACTGGT B
1 F1 CCGCTTCTGGCCACAGCACT B
2 F2 GGTTGGTCAATTTCGTGCCAG B
3 R1 ACTTGGGTTAATCGTGTGACC B
4 F3 CATCAAGCACGCAGCAATG B
5 F4 CTCACCACCTCTTGCTCAGC B
6 F5 CTTGACCGCTCTGAGCTAAAC B
7 F6 AAGCTAAGACCCCCGAAACC B
8 F7 AAACCTACCGAGCCTGGTG B
9 F8 GAGGAACAGCTCTTTGGACAC B
10 F9 TCGTCCCAACAATTATATTACTACCA B
11 R2 CTGTTTGTCGTAGGCAGATGG B
12 F10 AACGCCACTTATCCAGTGAACC B
13 F11 GACTCCCTAAAGCCCATGTCG B
14 F12 CATCTGCCTACGACAAACA B
15 F13 ACAGCCATTCTCATCCAAACCC B
16 F14 AACCACGTTCTCCTGATCAAA B
17 R3 GATATCGCCGATACGGTTG B
18 R4 AGCGGATGAGTAAGAAGATTCC B
19 R5 TTGAAGAAGGCGTGGGTACAG B
20 F15 TTCATCCCTGTAGCATTGTTCG B
21 F16 TTGCTCATCAGTTGATGATACG B
22 F17 CACTCTGTTCGCAGCAGTATG B
23 F18 CATCATCGAAACCGCAAAC B
24 F19 TTTCTCCAACATACTCGGATTC B
25 F20 ACAAACAATGGTCAACCAGTAAC B
26 F21 TCCAAAGACAACCATCATTCC B
27 R6 TTATCGGAATGGGAGGTGATTC B
28 F22 TACTCACCAGACGCCTCAACCG B
29 F23 AGTCCCACCCTCACACGATTC B
30 F24 CGCCTACACAATTCTCCGATC B
31 R7 CGGTTGTTGATGGGTGAGTC B
32 F25 AAATGGGCCTGTCCTTGTAG B
33 R8 TCATAAGGGCTATCGTAGTTTTC B
34 F26 GTGGCAAGAAATGGGCTAC B
35 F27 AACATATAACTGAACTCCTCACACC B
36 F28 GCCGCAGTACTCTTAAAACTAGG B
37 F29 AGGACTCAACATACTAGTCACAGC B
38 F30 GCCATACTAGTCTTTGCCGC B
39 R9 GCTGTGTTGGCATCTGCTC B
40 F31 AAAGACCACATCATCGAAACC B
41 F32 CTAACAGGTCAACCTCGCTTCC B
42 F33 CCTTCATAAATTATTCAGCTTCCT B
43 F34 CAATGATATGAAAAACCATCGTT B
44 R10 GGATGGCGGATAGTAAGTTTGT B
45 F35 CAGGGTTGGTCAATTTCGT B
46 F36 AATGGTTTGGCTAAGGTTGT B
47 R11 ACGAACAATGCTACAGGGATG B
48 F37 GGCATTATCCTCCTGCTTGCAACTAT B
49 R12 ATGTCCTGATCCAACATCGAG A
50 R13 AGAAGAGCGATGGTGAGAGC A
51 F38 CGACCTCGATGTTGGATCAGGACA A
52 F39 AGATGGCAGAGCCCGGTAATC A
53 F40 ACTACAACCCTTCGCTGACG A
54 F41 CCCTAGCATTACTTATATGATATGTCTCCATACCCATTACAATCTCC A
55 F42 TCAGGCTTCAACATCGAATACG A
56 F43 CCCATCCTAAAGTAAGGTCAGC A
57 F44 CCCTTTCACTTCTGAGTCCCAG A
58 F45 CACCATCACCCTCCTTAACC A
59 R14 GCTGAGTGAAGCATTGGACTG A
60 F46 TAAGCACCCTAATCAACTGGC A
61 R15 ATAGTGATGCCAGCAGCTAGG A
62 F47 CGCATCTGCTATAGTGGAGG A
63 R16 TTTCATGTGGTGTATGCATCG A
64 F48 GCCATAACCCAATACCAAACG A
65 F49 GAGGCTTCATTCACTGATTTCC A
66 R17 GGGCAGGATAGTTCAGACGG A
67 F50 TTCCCACAACACTTTCTCGGCC A
68 R18 AAGTTAGCTTTACAGTGGGCTCTAG A
69 F51 CGGTCAATGCTCTGAAATCTGTG A
70 F52 CTGTTCGCTTCATTCATTGCC A
71 R19 GTGGCGCTTCCAATTAGGTG A
72 R20 GTGCTTTCTCGTGTTACATCG A
73 R21 GAAAGTTGAGCCAATAATGACG A
74 F53 TTTCACTTCCACTCCATAACGC A
75 F54 CCTGATACTGGCATTTTGTAGATGTGG A
76 F55 ACTACCACAACTCAACGGCTAC A
77 F56 CTAACCGTGCAAAGGTAGCA A
78 F57 GCAATTCCCGGACGTCTAAACCAAA A
79 F58 GCCATAATATGATTTATCTCCACA A
80 F59 AAACCCTCGTTCCACAGAA A
81 F60 GATGAATAATAGCAGTTCTACCGT A
82 F61 CAACGTAAAAATAAAATGACAGTT A
83 F62 ATATGAAAATCACCTCGGAGC A
84 R22 AGTTACAATATGGGAGATTATTCC A
85 F63 CGCAAGTAGGTCTACAAGACG A
86 F64 CTAATCTTCAACTCCTACATACTTCC A
87 R23 ATCTGTTTTTAAGCCTAATGTGG A
88 F65 AAGATTAAGAGAACCAACACCTCT A
89 F66 AACAACCGACTAATCACCACCCAACAATG A
90 F67 TCATCTTCACAATTCTAATTCTACTG A
91 F68 TCGAGTCTCCCTTCACCATT A
92 F69 CGGCTTCGACCCTATATCC A
93 R24 GGTAAAAGGAGGGCAATTTCT A
94 F70 CTACTCTCATAACCCTCAACACC A
95 F71 ATTAAACCAGACCCAGCTACG A
96 F72 AGCATATTTCACCTCCGCTAC A