Skip to main content

Table 2 Primers used for Real Time PCR gene expression analysis of HMGN3a, the housekeeping gene GAPDH, and SMARCAL1.

From: Functional genomics of HMGN3a and SMARCAL1 in early mammalian embryogenesis

Gene Primer sequence and position (5' - 3') Product size (bp) Accession Number
HMGN3a_F GTTCCAGCCCGTTGCTTTAC (22 – 42) 355 NM_001034504.1
HMGN3a_R GACCATTCATTCTCCCTCGTTAC (376 – 399)   
GAPDH_F TGCTGGTGCTGAGTATGTGGT (333 – 354) 295 XM_865742
GAPDH_R AGTCTTCTGGGTGGCAGTGAT (627–648)   
SMARCAL1_F CCATCTGCATAGCGGCCTAT (1397–1416) 141 NM_176666
SMARCAL1_R CGGTTACCACGACGTTGATGT (1537–1517)