Skip to main content

Table 2 Primers used for WC1 transcript amplification and for cDNA clone sequencing reactions

From: Genomic organization and classification of the bovine WC1 genes and expression by peripheral blood gamma delta T cells

Primer name Sequence (5'-3')
Primers used for gene amplification:
WC1atg-for ATGGCTCTGGGCAGACACCTCTC
WC1full-forA GATGGTTACAGGTGGACATTGAAGG
WC1group1,2-rev TCAYGAGAAAGTCAYTGKGGATG
WC1group3-rev CTACATGGTGCTAAGCTCCACATC
WC1group4-rev TCATCTCCTAGTTAATACAGCATC
SRCR1-rev TGCACAGATGACCTGGGCAGTGG
Primers used for sequencing reactions:
WC1seq1-for CTCAACCTACAGGCTCTG
WC1seq2-for CAGGTGGAGATGAACATTTC
WC1seq3-for CACGACTGCAGACACAAGC
WC1seq4-for GAAGACATCACTGTGTCCGTG
WC1seq5-for GAGAAGCCCTCAATGCCAC
WC1seq6-for CATGGAAGACATCACTGTG
WC1seq7-for GCTACACAGATGGAGAGCAG
WC1seq8-for GGCTCATGACAAACGGCTCCTCTCAG
WC1seq1-rev GAGCTTCTCTCTGTCTGTGCAG
WC1seq2-rev GCAGCACAGTCCCACAG
WC1seq3-rev GCCCTTCCCCAAAGTGAGCTG
WC1seq4-rev CTGGTCAAGGATCTCCACTCTC
WC1seq5-rev GATCCTGCCCCAAAGTGAGC
WC1seq6-rev GTGTGAAGTTTCCATCAGAC
WC1seq7-rev GCAGTAGGGAGAACTCTC