Skip to main content

Table 4 Oligonucleotide sequences used for real-time PCR

From: Transcriptional analysis of the mammalian heart with special reference to its endocrine function

Name Forward Primer Reverse Primer
ANF GCCGGTAGAAGATGAGGTCA GGGCTCCAATCCTGTCAATC
AGS1 GCGGCGAAGTCTACCAGTTG TGTCTAAGCTGAACACCAGAATGA
Bet1 AAGCAAGTGGGAGAGCAGAA GAGGAAAGAAACGGCCCTAC
BNP TCTGCTCCTGCTTTTCCTTA GAACTATGTGCCATCTTGGA
G6PD CCAGCCTTCTACAAGCACCTCAA AATAGCCCCCACAACCCTCAGTA
Gαo GTCACCGACATCATCATTGC AGGTTAGACAGGGGCTTGGT
Kcnj5 TCCTTCTAGTGCAGGCCATC TTTTCCAAGGTGAGGACTGG
Kir6.1 CACAAGAACATCCGAGAGCA CAGACTCCAGGCCACTCTTC
Nr2f2 AAAGTCCCAGTGTGCTTTGG ATATCCCGGATGAGGGTTTC
Pitx2 GTACCCCGGCTACTCGTACA CACCATGCTGGACGACATAC
RGS2 ATTGGAAGACCCGTTTGAGCTA TTCCTCAGGAGAAGGCTTGATAA
RGS6 ATGTCGGCGTTTGAAGAATC AAGCTTTCAGCCACTTTGGA
Sec22 GCAAGATGTGCAGAGGATCA ATCTCACAGCCACCAAAACC
SGNE1 TCCAAATCCCTGTCCTCTTG TGTCCAGCCTCTTTCCTTGT
TREK-1 GTGTCCTCTTCGTGGCTCTC ACGAGGATCCAGAACCACAC