Skip to main content

Table 2 Primer pairs and corresponding annealing temperatures used for successful amplification of mitochondrial genome fragments from Sipunculus nudus

From: Mitochondrial genome sequence and gene order of Sipunculus nudus give additional support for an inclusion of Sipuncula into Annelida

Primer names Primer sequence (5'-3') Annealing temperature Approxim. size of PCR product
Sn-cox1-f CTCCCACTTAGCACCCTC 48°C 400 bp
Sn-cox2-r TAAGAGAATAATGGCGGG   
Sn-cox2-f CCAACCACTCTTTTATGCC 50°C 700 bp
Sn-cox3-r CCAGGATTAGGGCGGT   
Sn-cox3-f TTTTCCTATACCTCTGCATC 48°C 700 bp
Sn-cob-r TTGAATGACAAGGCAGAGA   
Sn-cob-f CTCCTCGCCCCCAA 48°C 2500 bp
Sn-16S-r GATTTATTGAAGAGTGGTTAGTGA   
Sn-16S-f TCATACCCCGCACTCC 48°C 600 bp
Sn-nd3-r CAAACCCGCACTCAAAC   
Sn-nd3-f GGTAAGTGAACGGGGAAC 50°C 2500 bp
Sn-nd1-r AAAAGGTTGGGGGAGG   
Sn-nd1-f CGCTATCACCTCCACCTT 50°C 4000 bp
Sn-cox1-r ATTCGGCACGGATAAGA