Skip to main content

Table 4 Q-PCR primer pairs used to amplify selected barley and wheat transcripts.

From: Comparative transcriptomics in the Triticeae

Probeset Forward primer Reverse primer Product size (bp)
Barley1    
Contig8230 TACATGCTCTTGTTTGGTGCTACTG AAGGTAAGTAGGCAGCAGTGAAGGT 204
Contig6943 GGGGAAATCCCAGGTCGTCGAT GGCTTGCTGCTAGGGTTTTCAG 266
Contig7925 CGAACCGTAGAATGTGTAAGGG GGGAGGAAAGATACACGCTT 114
Contig3031 TTACTATGCTGGATATGGACAAGGG TCTCATCTCATGTCTGGAAGACCC 190
Contig4668 CCCCCCACAAGTACCTGAAGA CGTTGGCTTGCTTAGCTCTTCC 286
Contig7671 CTAAGCGACCTTGCATCTTTTGAC AACGCTAGTGCTACTGGCAGGA 213
Contig20269 GAAGGCTCAGAAAGTTGCTGCTAT GCAAAATCATTCACTGCTTCCAGAG 224
Contig5740 GAGGCTGTTCAGCAACTGGACTG CAAGGATCCCAGCCACATACTG 227
Contig15148 GATCTCTTCGTGGTGGATCACATAC GCTTGATGTCCTATGCTTTCCAA 221
Contig11660 ACCTCATCAACCTCTGCGGC TTCCAGAGAACGGAGGCAGG 210
Contig14399 AGAAAGAGAGATTTTGAAGCTTGGC AATCCATCGCCATGCCAACT 213
Contig15147 GGCGGGGCACTTTTGAGGACAT CGAGCCTGCGACGGGTTATT 182
Contig2400 AAGCATGCCGCCATCCCGTT CCCAACCTGACAACTCCACCTAGA 244
Wheat    
Ta.3039.1 ACGTCCATAACGATGGTCTTCATTG GTAGTGGCCTCAGCATCACCATTGC 170
Ta.13729.1 TTTTCTACATGCTCTTGTTTGGTGC AAAAGATCAACCCATGTGCTGCTCC 265
Ta.27013.1 CGAAGCGTGTATCTTTCCTC CAGACACAAACGAAAATGAC 183
Ta.7602.1 AGCCCCCCACAAGTACCTGATGATG GTCGTCATCCTCGTCACCATCTTCC 201
Ta.27369.1 TTACTATGCTGGATATGGACAAGGC TGCTACAACATTAGCCTTGACAGTG 230
Ta.9536.1 GCCCTAAACGACCTTGCATCTTTTG AAACTGAAGCACTAACCTACGACGC 236
Ta.968.1 ATGTGCTGCGTCGTCAGATACATAG TACCCTCCTCGACTTCCTTGTGATC 204
Ta.4425.1 GATGCCATCAGATCCTCCAATT GCCACTCCGTTGTGTCATAATATGG 235
Ta.27038.1 CGAAGCGTGTATCTTTCCTC CAGACACAAACGAAAATGAC 151
Ta.7256.1 CATCTCATGGTACCTGACTGTCGA GCAACAGACTGCCACCAGCA 264
TaAffx.46790.1 TCATGTCAGTTTATTGCAAGG CAGTGACACTATAACAATACAGTTCT 240
TaAffx.128707.1 GAAAAGGTTGTAGTTCAGAAGG TTGCTCTGGACTACTGTCTTC 259
  1. Primer sequence details used in the Q-PCR verification of selected barley and wheat expression profiles and the size of the corresponding RNA products.