Skip to main content

Table 1 Primer sequences used for qRT-PCR

From: Coordinated patterns of gene expressions for adult muscle build-up in transgenic mice expressing myostatin propeptide

Target Gene Accession No. Amplicon (bp) Forward Primer (5-3) Reverse Primer (5-3)
Glyceraldehyde-3-phosphate dehydrogenase NM_199472 191 aacgaccccttcattgac tccacgacatactcagcac
Myostatin propeptide U84005 99 gctctttggaagatgacgat catttgggcttgccatcc
Myogenin NM_031189 100 actcccttacgtccatcgtg acccagcctgacagacaatc
Follistatin-like 1 NM_008047 96 cagccaggaatagcatggat ctcttcctgggcagagtgac
Cyclin-dependent kinase inhibitor 1A NP001104569.1 117 ttgggaaggaaaagggctat gaggaaccgtccaagaatga
Procollagen, type I, alpha 1 U08020 110 gacctcagggtattgctgga accttgtttgccaggttcac
Procollagen, type I, alpha 2 AW545978 138 atgcacatcaatgtggagga aggctgacacgaactgaggt
Procollagen, type III, alpha 1 BG968894 96 ctatgacattgggggtcctg ttttgttttgctggggtttc
Procollagen, type V, alpha 2 NM_007737 111 gcagctccagatgacacaaa tgggtgtttcttggaaccat
Procollagen, type V, alpha 3 NM_016919 99 gctcttctgtgggtttcctg taaagcagatggagccgagt
Procollagen, type VI, alpha 1 NM_009933 109 tgacccaactggtcaactca gggcgggatctagataggag
Procollagen, type VI, alpha 2 BI455189 106 aacccaaagccccttaccta agactctggggtcctccaat
Procollagen, type VI, alpha 3 AF064749 101 acggagaacagtgccagact agaaccaaggactggtcgtg
Fibronectin 1 BC004724 114 agtgcttcatgccgctagat acatcactggggtgtggatt
Biglycan BC019502 93 ggtgggcatcaatgacttct cagtagggcacagggttgtt
Calpain 3 AI323605 88 ccaccctaaaagtggcagaa ctgggttgtccatagcacct
Calpain 7 BG068214 93 agtccccatgatgaaagcac gcaggttggtgaatgtagca
Caspase 7 BB752393 110 cctggcactattggggtaaa gccatcaaaaagggacacat
Ubiquitin specific protease 25 NM_013918 126 cttcccagggtcaccataga ggtcggcatagtcgttttgt
Atrogin 1/F-box protein 32 NM_026346 115 gttttcagcaggccaagaag ttgccagagaacacgctatg
Ubiquitin-conjugating enzyme E2D 3 BG070073 147 gtgacttgcattgggttcct tgatcatgctgtgttcgtga
WW domain E3 ubiquitin protein ligase BB397174 101 ttggtaggccacactgtcaa taggagaaagctgggggtct
Proteasome 26S subunit, ATPase, 6 NM_025959 106 acactggatcctgctttgct gtcctgcgtggattttcaat
Proteasome activator subunit 4 BM195254 99 agtgtggttgagcgtgtcag agttttgaccgccttgtgtc
NADH dehydrogenase 1 α subcomplex, 1 BC018422 97 gaagtgccctgctttatgga cgtggaatcctggagatcat
NADH dehydrogenase 1 α subcomplex, 4 BC011114 99 tattggagcagggggtactg catggctctgggttgttctt
NADH dehydrogenase 1 α subcomplex, 5 NM_026614 108 tctggcaaggaaaatgttga ccatccaccatctgacactg
NADH dehydrogenase 1 α subcomplex, 7, C88880 112 gctgccttcatcctgacatt gcaggccttgaactcagaac
NADH dehydrogenase Fe-S protein 1 BC006660 98 gtgttgctgcagagtggaaa aatcgcttctaccccaggtt
Ubiquinol-cytochrome c reductase subunit NM_025650 136 gccttacatcaacggcaagt ctccagtgtccagcttcctc
Cytochrome c oxidase, subunit Vic AV111078 115 tcgaagagatgacgaaggcta atagttcaggagcgcaggtc
ATP synthase mitochondrial F1 complex assembly factor 1 BB771055 99 cccttcagagttgccttcag gggccataagcgacagttta
ATP synthase, H+ transporting, mitochondrial F1 complex, O subunit AV066932 96 gaagtgccatgcacagtgac ttggtttggactcaggaagc
Adrenodoxin D43690 105 ggaacgttggcttgctctac aaaagccaggtcaagcatgt
Electron transferring flavoprotein, alpha polypeptide BC003432 106 tgacaaaaagtgaccgacca tctgccaggtcatacagcag