Skip to main content

Table 3 Primers used for class I gene amplification. Class I loci for which no expression was detected (Maeu-UP and Maeu-UL) were excluded.

From: MHC-linked and un-linked class I genes in the wallaby

Class I locus Primers
Maeu-UE α1F – ATG TGC CTG CAG AAA GTG TCT GCG
Primer set 1 α2R – AT GGT TCA GGG CTC CTG AGT TCC
Maeu-UK α1F – AGT AGT TAG AGA GAC GGA GCA CAC
Primer set 2 α2R – GTA CTT CTG CAG CCA TTC AGT
Maeu-UO α1F – CAA GAG ATA CCA GAT TAC TGG GA
Primer set 4 α2R – CGT TCC CAG CGA TCC AAC TTA GA
Maeu-UM α1F – GCG GGC CCA GAC TGG GGT TAG AG
Primer set 4 α2R – ACG TTT AGG GCC ACG TTG TCC AAT
MHC un-linked class I α1F – CACTCCATGAGGTATTTCGACA
Primer set 5 α3R – GGCTCAGGCAGCCCCTCGTGC