Skip to main content

Table 2 Primer pairs used for q-PCR analysis with target gene information.

From: Transcriptomic and metabolomic profiling of Zymomonas mobilis during aerobic and anaerobic fermentations

Primers1 Sequences (5' to 3') PCR product size (bp)
ZMO0084_F TGCAAGCATTGCCTACAAAG 100
ZMO0084_R CCATTGAGGTGAACCCATCT  
ZMO0178_F TGATCATCGGTGGTGGTATG 120
ZMO0178_R TTTCAGCAGCAGCGAAAATA  
ZMO0367_F ACAGCCTGATGAAACCATCC 111
ZMO0367_R AACACATCCGTGAGGGAAAG  
ZMO0369_F GCGTTTCTCTATTGCGGAAG 110
ZMO0369_R CGAAACGTTCCCAAGCTAAC  
ZMO0749_F TATCCTGCGGTCTTGGAGTC 108
ZMO0749_R CCGTCTTCAAAGGCATTCAT  
ZMO0817_F GCACCGAAATCAGCAAAAAT 107
ZMO0817_R GTGTTGGGACTGGGTTCATC  
ZMO0976_F CAGCAGATGGACGAGTTCAA 113
ZMO0976_R TCGTTTTTCTTGGCATAGGG  
ZMO1062_F AGGCCAATGACGGTTTACAG 115
ZMO1062_R GCTTCCTGATCCAAAAGCTG  
ZMO1118_F CGCCTGTTATTCTGGTGGAT 109
ZMO1118_R CGCCTTATTTCAGCCCTATG  
ZMO1129_F AGTGAAACCGACTGGCCTAA 104
ZMO1129_R ATGGTTTCAATCGCAGCTCT  
ZMO1360_F TGGTCTCAAGCATCACTTCG 114
ZMO1360_R CCGCAGTTCAGTTCGTTACA  
ZMO1478_F AGTAGCGGTGCTGAACTGGT 109
ZMO1478_R CGGCAGGCCATTTATAAGAA  
ZMO1608_F ACATGGCTAACGACGCTTCT 111
ZMO1608_R TCTTGATCTGACCGCAGTTG  
ZMO1660_F ATGAGCGTCCAGCAATTCTT 102
ZMO1660_R TTCCCCGACATGACTCAGTA  
ZMO1863_F GGAACTCTGGCAGAAACAGC 111
ZMO1863_R GGATAACCCAAGACGAGCAA  
ZMO1876_F ATCAGGATTTGACGCTGGAA 100
ZMO1876_R ACCATCGCTTCGACAATAGC  
ZMO1959_F ACAAGGCTGCCGATTTATTG 104
ZMO1959_R TTGGCTCAGCAGATGTTGTC  
  1. 1PCR primer pair nomenclature. F: forward primer, R: reverse primer for each respective gene.