Skip to main content

Table 2 HV1 types observed in groups described in Table 1.

From: Complexity of the MSG gene family of Pneumocystis carinii

HV1 type Nucleotide sequence of HV1 and encoded peptide
1 CAAGCACCAGTAGCACCAGCAGCA
Q A P V A P A A
2 CAAGCATCAGGAGCACCAGCAGCA
Q A S G A P A A
3 CAAGCACCAGTGGCACCAGCAGCA
Q A P V A P A A
4 CAAGCACCACAAGGAGCACCAGCA
Q A P Q G A P A
5 CAAGCACCAGCAGTACCACCAGCA
Q A P A V P P A
6 CAAGTAGTACAAGTAGTACAAGTAGCA
Q V V Q V V Q V A
7 CAAGCACCAGCAGGAGTAGTACAAGTAGCACAA
Q A P A G V V Q V A Q
8 CAAGCACCAGCAGGAGTAGTACAAG G AGCACAA
Q A P A G V V Q V A Q
9 CAAGCACAAGTAGTACAAGGAGCACAA
Q A Q V V Q G A Q
10 CAAGCACAAGGAGTACAAGGAGCACAA
Q A Q G V Q G A Q
11 CAAGCATTAGGAGTACAA
Q A L G V Q
12 CAAGCACAAGGAGGAGCAGCAGCAGGAGCACAA
Q A Q G G A A A G A Q
13 CAAGCAAAAGTAGTACAAGGAGCACAAGTAGCACAA
Q A K V V Q G A Q V A Q
14 CAAGCACCACAAGCAGCACCAGCAGCG
Q A P Q A A P A A
15 CAAAGACCACAAGGAGCACCAGCA
Q R P Q G A P A
16 CAAGCAGTACAAGGAGCACAA
Q A V Q G A Q
17 CAACAACAAGTGGCACAAGTAGCACAA
Q Q Q V A Q V A Q
18 CAAGCAGCAGGAGGAGCAGCG
Q A A G G A A
19 CAAGCAGCAGCACAAAAACAA
Q A A A Q K Q
20 CGGGCGCGAGGAGTACAAGGAGCACAA
R A R G V Q G A Q
21 CAAGCACAAGGAGCAGGAGGAGCAGCG
Q A Q G A G G A A
22 CAAGCAGTACAAGGAGCAGCG
Q A V Q G A A
23 CAAGCAGTACAAGGAGCAGTG
Q A V Q G A V
24 CAAGCACAAGTAGTACAAAAACAA
Q A Q V V Q K Q
25 CAAGCACAAGTAGTACAAGTAGCACAA
Q A Q V V Q V A Q
26 CAAGCAGCAGTAGTAGCG
Q A A V V A
27 CAAGCAGTAGGAGTAGTAGCG
Q A V G V V A
28 CAAGCAGCAGGAGCAGTAGCG
Q A A G A V A
29 CAAAATCAAGCAGCACCAGCAGCG
Q N Q A A P A A
30 CAAGCAGCAGGAGTAGTAGCG
Q A A G V V A
31 CAACAACAAGTACCACAAGGAGCACAA
Q Q Q V P Q G A Q