Skip to main content

Table 4 Primers used in this study

From: Streptococcus pneumoniae nasopharyngeal colonization induces type I interferons and interferon-induced gene expression

Primer Name Sequence 5' → 3'
Ywhaz_F CACAGCCTCCCCTCATCCT
Ywhaz_R GGGAGACGGTGACAGACCAT
Socs3_F GCCACCTGGACTCCTATGAGAA
Socs3_R TCTGACCCTTTTGCTCCTTAAAGT
Ifit3_F GGGAGAATGTGCTGAAAAAAGC
Ifit3_R GGAGTCAGGGAGAGAAAGCAGTT
Irg1_F TTTTTCTTTCCACACAGAGCCTTA
Irg1_R ACTGCTTCACCACCCCAAGT
InfA2_F GTGAGGAAATACTTCCACAG
InfA2_R GGCTCTCCAGACTTCTGCTC
InfB2_F CAGCTCCAAGAAAGGACGAAC
InfB2_R GGCAGTGTAACTCTTCTGCAT
InfG_F GAACTGGCAAAAGGATGGTGA
InfG_R TGTGGGTTGTTGACCTCAAAC