Skip to main content

Table 1 Gene specific primers used for quantitative RT-PCR

From: Gene array analysis of adrenal glands in broiler chickens following ACTH treatment

Gene symbol Forward Primer Reverse Primer Accession Number
ARL10 GCTGCCTGTTCCATCCTCAT CCTTACCCCAAGTGCTCCC XM_414552
d-cry TACACTGCCGTGGGTGGTACT GCCCCCACATCTAAGCCTG NM_205501
Predicted PRAX-1 GGAAACTCGCTGCCAAACA CCTACTGGCGTTGCGTTGA XM_001236228
TSKU GCTCAGCTGGGATCGTGTG ATCCTTCCCGTGATAGGCAA NM_001005346
ICER GTAATGGCAGCCTCCCCAG GGCAGCTTCCCTGTTTTTCA NM_204387
Predicted HSD17B7 TACCACCAACCTCTTTGGGC TGCTGGAAGAGGTCCAGATGA XM_001232165
MYPN ATCCTCCACCTGCACAATCG AGACAGCGTTAATGGGACCG XM_421565
Predicted KCTD1 CCCCTGCATCTCCATTGAAC GGTATACATGTGCCCACCCAC XM_001231830
Predicted NARFL CCTGACTGGATGCCCTTGAA GCAGCCCT GGAGATAATGTTG XM_414836
Predicted NUDT5 GAGAGTGCTGCATTGCGAGAG TGCTGTTTGACACACCTGGG XM_001235499
Predicted DNAJA5 TGGGAGAAACGAGCTATGGAA TCCCTCTTGCGAATAAAGGC XM_425006
Predicted CCNG1 GATCGAGTCTGCCCATGACAA TGTGGAAGCCGAAGAACTGA XM_414493
STAR AGTGATGGCCCTTATCTCGGT GGTGGCTGCTACAAACACTGC NM_204686
SC4MOL CACATCCTCTGGAAACGCTCA GCGACATATTACCCATGCCC NM_001006438
NCB5R CCTACCACCACTATTCCCCCA GCGACACTATGGCACACCC XM_416445
PISD CGTGCAGTTTGCCAAGTCCTA CCTGAACAGCCACCATCACC XM_415253
ATF4 CATGGGTTCTCCAGCGACA GAGAAGGCATCCTCCTGGCT NM_204880
FKBP5 CCTCCAATGCCACCCTCTTT TCCTTTCCTCTTGATCCTCCG NM_001005431
Transketolase CGAGTGATTGCTTTGGATGGA TCACGAGTGGCACAACCAACT XM_414333