Skip to main content

Advertisement

Table 2 Sequences of all MAPH primers used in this study.

From: Quadruplex MAPH: improvement of throughput in high-resolution copy number screening

Primer name Sequence
Fam PZA Fam-AGTAACGGCCGCCAGTGTGCTG
PZB CGAGCGGCCGCCAGTGTGATG
Rox PGA Rox-CCGCCATGGCCGCGGGAT
PGB AGGCGGCCGCACTAGTGAT
Ned-PBSB Ned-GGTCGACGGTATCGATAAGCTTG
PBSA CCCCCGGGCTGCAGGAATTC
PBSA2 GCCCCCGGGCTGCAGGAATTC
Hex-PUCB Hex-CGACTCTAGAGGATCCAGAGG
PUCA CGACGGCCAGTGAATTCCAG