Skip to main content

Table 2 Read frequency and mature sequences of Gossypium hirsutum novel miRNA candidates.

From: Enrichment of a set of microRNAs during the cotton fiber development

ID Precursor Library 5p Reads 3p Reads 5p Sequence (5' -- 3')
3p Sequence (5' -- 3')
miRNVL1 AI054573 WT 324 5 ACTTTTGAACTGGATTTGCCGA(22)
   M 750 4 TGCAAATCCAGTCAAAAGTTA(21)
miRNVL2 DW497660 WT 79 3 TGAACTGGGTTTGTTGGCTGC(21)
   M 234 0 AGCCAACAACATCAGTTCTAA(21)
  1. The 5p and 3p sequences originate from the 5' and 3' arm of the folded precursors, respectively. WT: Xuzhou 142 (wild-type); M: fuzzless-lintless mutant in Xuzhou 142 background.