Skip to main content

Table 4 Primers used in this study.

From: Characterization of the oxidative stress stimulon and PerR regulon of Campylobacter jejuni

Primer DNA sequence from 5' to 3'
For gene cloning
   perR-01 ATGCAGATCT GTTATGGACAAGGTGTGGCA (BglII)
   perR-02 ATGCAGATCT CATTGGAACTATCCAAAGTTGG (BglII)
   katA-01 ATGCGGTACC CGATTTTGGAAACATTATAGCTGA (KpnI)
   katA-02 ATGCCTGCAG TAATGGGGTTTGTCCACGAT (PstI)
   ahpC-01 ATGCAGATCT CTGGAGTGTCCCCACTTCTC (BglII)
   ahpC-02 ATGCAGATCT CCAAAACCCCAGCAATCATA (BglII)
   sodB-01 ATGCGAATTC TTAAAAGTGGCCCATTCGTC (EcoRI)
   sodB-02 ATGCCTGCAG TCCTTTTACTTCACGCAAGC (PstI)
For inverse PCR
   perR-03 ATGCGGATCC CACATAGTCTTTGCGGAGTAGC (BamHI)
   perR-04 ATGCGGATCC GATAGGCAATCTCGTCAATCA (BamHI)
   katA-03 ATGCGGATCC ATAAGCTCGGCAGCTTCTTG (BamHI)
   katA-04 ATGCGGATCC ACAATGTCGCTGGTGCTATG (BamHI)
   ahpC-03 ATGCGGATCC ACCGCTCCTTTTGGACCTAT (BamHI)
   ahpC-04 ATGCGGATCC TCGCCATGCTGTGGTTAAT (BamHI)
   sodB-03 ATGCGGATCC TCACCAAAAGCATTGGTATCAT (BamHI)
   sodB-04 ATGCGGATCC GGCATGGGATCAGTTAGCTT (BamHI)
For complementation
   aphA3-01 TCCCCCGGG GATAAACCCAGCGAAC (SmaI)
   aphA3-02 TCCCCCGGG AAGCTTTCTAGA CATCTAAATC (SmaI, XbaI)
   fur-05 GATTTAGATGTCTAGCATGCTAGTGAAAAGTTGCAAGA
   fur-06 GGGGAAGCTTTCTAGGCTTTTTCTATTCTTTGCTGCTC
   katA-05 GATTTAGATGTCTAGTTACGTGCATCCCAGTGTTC
   katA-06 GGGGAAGCTTTCTAGCCACCAAAAGTGGCAAGTAAA
   ahpC-05 ATCCACTAGTTCTAGCATTCAACGCATTTGTTTGC
   ahpC-06 CTAGGGCCGCTCTAGAAAAATGAAGAAAAAGCCTCGT
   sodB-05 GATTTAGATGTCTAGTTTTTCATATTTTCCTCCTTATGAA
   sodB-06 GGGGAAGCTTTCTAGCATTTTTGCCCCTTTTTGTG
   perR-05 GATTTAGATGTCTAGGACCTATTGCTTTGCGTTAT
   perR-06 GGGGAAGCTTTCTAGTGCTTAATGACACTTTTTGC
For identification of the rRNA insertion site
   Ak233 GCAAGAGTTTTGCTTATGTTAGCAC
   Ak234 GAAATGGGCAGAGTGTATTCTCCG
   Ak235 GTGCGGATAATGTTGTTTCTG
   AR56 CATCCTCTTCGTCTTGGTAGC
   Ak237 TCCTGAACTCTTCATGTCGATTG
  1. The restriction sites used for cloning are bolded and the restriction enzymes used are indicated in parentheses.
\