Skip to main content

Table 1 List of primers used for Q-PCR experiments

From: Anti-proliferative action of vitamin D in MCF7 is still active after siRNA-VDR knock-down

   Primers 5' → 3'  
Gene
symbol
Accession number
[GenBank:]
Forward Reverse
FAM14A NM_032036 GCCTCTGTTGGGTCAGTGTTG TCATCTTCTTTAGCCTCGGGTT
CYP24A1 NM_000782 GACTACCGCAAAGAAGGCTAC CATCACTTCCCCTGGTTTCATTA
PHLDA1 NM_007350 TGAAGGAGGGCGTGCTGG GCTGCTTGGGCGGGATAA
DDIT4 NM_019058 GGACGCACTTGTCTTAGCAGTTCTC CCAGGGCGTTGCTGATGAA
CYFIP2 NM_014376 CATTCCGTATCCACCGTCCAA GCTGGGTAATGAGTCTGTTCAAGTC
FOXC1 NM_001453 CACTCGGTGCGGGAGATGTT GAGACTGGCTGGAAGGGAAGG
CRABP2 NM_001878 ACAGGAGGGAGACACTTTCTACATCAA TCCCATTTCACCAGGCTCTTACA
ST6GALNAC5 NM_030965 GCCACTGGACGGATACCTCG CTGGGAGCCTTGCCGACT
NUAK1 NM_014840 TGAAGAAGCGAAGCAACAGCG GAGGGTAAGGCAGGACCAACTA
VDR NM_000376 AGCGGAAGGCACTATTCACC CATCATGCCGATGTCCACACA
GAPDH NM_002046 TGAAGCAGGCGTCGGAGGG CGTCAAAGGTGGAGGAGTGGGT