Skip to main content

Advertisement

Table 5 Primer sequence information used in this study

From: Eurotatorian paraphyly: Revisiting phylogenetic relationships based on the complete mitochondrial genome sequence of Rotaria rotatoria (Bdelloidea: Rotifera: Syndermata)

Primers Sequence (5'-3') Binding region Source Estimated size of PCR products
LCO1490 GGTCAACAAATCATAAAGATATTGG cox1 [75] 712 bp
HCO2198 TAAACTTCAGGGTGACCAAAAAATCA cox1   
16SA CGCCTGTTTATCAAAAACAT rrnL [76] 437 bp
16SB CCGGTTGAACTCAGATCA rrnL   
Cytb-Uni5-2 GGATCCGGHTATGTBYTVMYDTGAGG cob This study 451 bp
Cytb-Uni3-2 GGATCCAYARRAARTAYCATTCWGG cob   
CO2-Uni5 GGWCATCAWTGRTATTGRAVWTATGA cox2 This study 296 bp
CO2-Uni3 TGATTWRCHCCACAVATWTCWGMACA cox2   
RotspCO1+425 GGCTTCATATTGCGGGTGTCTC cox1 This study 1,559 bp
Roti16S-60 TTAGTACGGTCAGATTACTGCAGC rrnL   
Roti16S+320 AGTTGTTTACTACCTCGATGTTGGATC rrnL This study 3,082 bp
RotaCtB-110 AAAACGTGAAAGAGTAGGAGCACCTACTC cob   
RotaCtB+260 GTGACTTCTATTAATGATAAGGTGGAG cob This study 4,668 bp
RotaCO2-100 CCGGGATTACAACACGATTATCTACATC cox2   
RotaCO2+180 CGGCAGATGTTCTTCATTCTTGAGCG cox2 This study 5,481 bp
RotspCO1-265 CGAGGAAAAGCCATATCTATCAC cox1