Skip to main content

Table 5 Primer sequence information used in this study

From: Eurotatorian paraphyly: Revisiting phylogenetic relationships based on the complete mitochondrial genome sequence of Rotaria rotatoria (Bdelloidea: Rotifera: Syndermata)

Primers Sequence (5'-3') Binding region Source Estimated size of PCR products
Cytb-Uni5-2 GGATCCGGHTATGTBYTVMYDTGAGG cob This study 451 bp
RotspCO1+425 GGCTTCATATTGCGGGTGTCTC cox1 This study 1,559 bp
Roti16S+320 AGTTGTTTACTACCTCGATGTTGGATC rrnL This study 3,082 bp
RotaCtB+260 GTGACTTCTATTAATGATAAGGTGGAG cob This study 4,668 bp
RotaCO2+180 CGGCAGATGTTCTTCATTCTTGAGCG cox2 This study 5,481 bp