Skip to main content

Advertisement

Table 1 Expression of mature- and pre-miRNAs in Vitis vinifera

From: High throughput approaches reveal splicing of primary microRNA transcripts and tissue specific expression of mature microRNAs in Vitis vinifera

miRNA Sequence Expression data miRNA Sequence Expression data
   A B C D    A B C D
MIR156A TGACAGAAGAGAGGGAGCAC 2229 ____ N __I___ MIR171G TTGAGCCGAACCAATATCACC 0 __RC N R*L*I*___
MIR156B TGACAGAAGAGAGTGAGCAC 835876 ___C N ______ MIR172A AGAATCTTGATGATGCTGCAT 3450 _S_C N ______
MIR156C TGACAGAAGAGAGTGAGCAC 835876 ____ N ______ MIR172B AGAATCTTGATGATGCTGCAT 73450 ____ N ______
MIR156D TGACAGAAGAGAGTGAGCAC 835876 LSRC N ______ MIR172D AGAATCTTGATGATGCTGCAT 73450 ____ N _LIBgBv_
MIR156E TGACAGAGGAGAGTGAGCAC 251 ____ N ______ MIR172C GAATCTTGATGATGCTGCAG 1 ____ N _LIBgBv_
MIR156F TTGACAGAAGATAGAGAGCAC 30 _S__ N RLIBgBvBm MIR319B TTGGACTGAAGGGAGCTCCCT 1 ____ N RLIBgBvBm
MIR156G TTGACAGAAGATAGAGAGCAC 30 LS_C N RLIBgBvBm* MIR319C TTGGACTGAAGGGAGCTCCCT 1 _S__ N RLIBgBvBm
MIR156I TTGACAGAAGATAGAGAGCAC 30 _S__ N RLIBg*BvBm MIR319E TTTGGACTGAAGGGAGCTC 1 _S_C Y RLIBgBvBm
MIR156H TGACAGAAGAGAGAGAGCAT 69 LS__ Y ______ MIR319G ATTGGACTGAAGGGAGCTCCC 0 ___C N RLIBgBvBm
MIR159A CTTGGAGTGAAGGGAGCTCTC 0 ____ N RLIBgBvBm MIR319F TTGGATTGAAGGGAGCTCCCT 1 _S__ N RLI*BgBv*Bm*
MIR159B CTTGGAGTGAAGGGAGCTCTC 0 ____ N RLIBgBvBm MIR390 AAGCTCAGGAGGGATAGCGCC 141 _S__ N RLIBgBvBm
MIR159C TTTGGATTGAAGGGAGCTCT 124 LSRC N RLIBgBvBm MIR393A TTCCAAAGGGATCGCATTGAT 14983 ____ Y RLIBgBvBm
MIR160A TGCCTGGCTCCCTGAATGCCA 276 ____ N RLI*BgBv*Bm* MIR393B TCCAAAGGGATCGCATTGATC 398 LS__ Y RLIBgBvBm
MIR160B TGCCTGGCTCCCTGAATGCCA 276 ____ Y RLIBgBvBm MIR394A TTGGCATTCTGTCCACCTCC 748 _S__ N ______
MIR160E TGCCTGGCTCCCTGAATGCCA 276 ____ Y RLIBgBvBm MIR394B TTGGCATTCTGTCCACCTCC 748 LS_C N ______
MIR160C TGCCTGGCTCCCTGTATGCCA 130 _SRC N RLIBgBvBm* MIR394C TTGGCATTCTGTCCACCTCC 748 ____ N ______
MIR160D TGCCTGGCTCCCTGTATGCCA 130 ____ N RLIBgBvBm MIR395A TGAAGTGTTTGGGGGAACTC 198 ____ N RLIBgBvBm
MIR160F TGCCTGGCTCCCTGTATGCCA 130 ____ N RL*IBg*Bv*Bm MIR395B TGAAGTGTTTGGGGGAACTC 198 ____ N RLIBgBvBm
MIR162 TCGATAAACCTCTGCATCCAG 1 LS_C Y RLIBgBvBm MIR395C TGAAGTGTTTGGGGGAACTC 198 ____ N RLI*BgBvBm
MIR164A TGGAGAAGCAGGGCACGTGCA 13841 ____ N RLIBg__ MIR395D TGAAGTGTTTGGGGGAACTC 198 ____ N RLIBgBvBm
MIR164C TGGAGAAGCAGGGCACGTGCA 13841 L___ N RLIBg__ MIR395E TGAAGTGTTTGGGGGAACTC 198 ____ N RLIBgBvBm
MIR164D TGGAGAAGCAGGGCACGTGCA 13841 ____ N RLIBg__ MIR395F TGAAGTGTTTGGGGGAACTC 198 ____ N RLIBgBvBm
MIR164B TGGAGAAGCAGGGCACATGCT 1 ____ N _LI*Bg__ MIR395L TGAAGTGTTTGGGGGAACTC 198 ____ N RLIBgBvBm
MIR166A TCGGACCAGGCTTCATTCCT 181 LSRC Y RLIBgBvBm MIR395 M TGAAGTGTTTGGGGGAACTC 198 ____ N RLIBgBvBm
MIR166B TCGGACCAGGCTTCATTCCT 181 LS__ N RLIBgBvBm MIR395G TGAAGTGTTTGGGGGAACTC 198 ____ N RLIBgBvBm
MIR166C TCGGACCAGGCTTCATTCCCC 219273 LSRC N RLIBgBvBm MIR395H TGAAGTGTTTGGGGGAACTC 198 ____ N RLIBgBvBm
MIR166D TCGGACCAGGCTTCATTCCCC 219273 _S__ N RLIBgBvBm MIR395I TGAAGTGTTTGGGGGAACTC 198 ____ N RLIBgBvBm
MIR166E TCGGACCAGGCTTCATTCCCC 219273 _SRC N R*LI*Bg*Bv*Bm* MIR395J TGAAGTGTTTGGGGGAACTC 198 _S__ N RLIBgBvBm
MIR166F TCGGACCAGGCTTCATTCCCC 219273 ____ N RLIBgBvBm MIR395K TGAAGTGTTTGGGGGAACTC 198 ____ N RLIBgBvBm
MIR166G TCGGACCAGGCTTCATTCCCC 219273 ____ N RLIBgBvBm* MIR395N CTGAAGAGTCTGGAGGAACTC 0 ____ N _L____
MIR166H TCGGACCAGGCTTCATTCCCC 219273 _S_C N RLIBgBvBm MIR396B TTCCACAGCTTTCTTGAACTT 2204 LS_C N RL_Bg__
MIR167A TGAAGCTGCCAGCATGATCTG 166 L_RC N RLIBgBvBm MIR396A TTCCACAGCTTTCTTGAAC 810 _S__ N RL_Bg__
MIR167B TGAAGCTGCCAGCATGATCTA 4965 L__C Y RL*IBg*BvBm MIR396C TTCCACAGCTTTCTTGAAC 810 ____ N RL_Bg__
MIR167C TGAAGCTGCCAGCATGATCT 89 ____ N RLIBgBvBm MIR396D TTCCACAGCTTTCTTGAAC 810 _S_C N RL_Bg__
MIR167D TGAAGCTGCCAGCATGATCTA 4965 LS__ N RLIBgBvBm MIR397A ATTGAGTGCAGCGTTGATGAA 714 LS_C N R__Bg__
MIR167E TGAAGCTGCCAGCATGATCTA 4965 ____ N RLIBgBvBm MIR397B ATTGAGTGCAGCGTTGATGAA 714 ____ N R__Bg__
MIR168 TCGCTTGGTGCAGGTCGGGAA 5 LSRC Y RLIBgBvBm MIR398A TTCTCAGGTCACCCCTTTGGG 13 _SRC N RL_Bg__
MIR169B TGAGCCAAGGATGGCTTGCCG 0 ____ N _L__BvBm MIR398B CTCATGTGTTCTCAGGTCGCC 15 LSRC N R__Bg__
MIR169H TGAGCCAAGGATGGCTTGCCG 0 ____ N _L__BvBm MIR398C CTCATGTGTTCTCAGGTCGCC 15 LSRC N R__Bg__
MIR169A CAGCCAAGGATGACTTGCCGG 675 ____ N _LIBgBvBm MIR399A TGCCAAAGGAGAATTGCCCTG 106 L___ N R_I___
MIR169C CAGCCAAGGATGACTTGCCGG 675 ____ N _LIBgBvBm MIR399H TGCCAAAGGAGAATTGCCCTG 106 L___ N R_I___
MIR169J CAGCCAAGGATGACTTGCCGG 675 ____ N _LIBgBvBm MIR399B TGCCAAAGGAGAGTTGCCCTG 34 ____ N R__Bg_Bm
MIR169K CAGCCAAGGATGACTTGCCGG 675 ____ N _LIBgBvBm MIR399C TGCCAAAGGAGAGTTGCCCTG 34 ____ N R__Bg_Bm
MIR169S CAGCCAAGGATGACTTGCCGG 675 ____ N _LI*BgBvBm MIR399I CAAAGGAGAGTTGCCCTG 1 L_RC N R__Bg_Bm
MIR169W CAGCCAAGGATGACTTGCCGG 675 ____ N _LIBgBvBm MIR399D TGCCAAAGGAGATTTGCTCGT 0 ____ N ______
MIR169L GAGCCAAGGATGACTTGCCGT 0 ____ N _LIBgBvBm MIR399E TGCCAAAGGAGATTTGCCCGG 0 ___C N ______
MIR169 M AGCCAAGGATGACTTGCCGGC 16 ____ N _LI*BgBv*Bm* MIR399F TGCCGAAGGAGATTTGTCCTG 0 ____ N ______
MIR169N AGCCAAGGATGACTTGCCGGC 16 ____ N _L*I*Bg*Bv*Bm* MIR399G TGCCAAAGGAGATTTGCCCCT 0 ____ N R_I__Bm
MIR169O GAGCCAAGGATGACTTGCCGC 0 ____ N _LIBgBvBm MIR403A TTAGATTCACGCACAAACTCG 0 ____ N RLIBgBvBm
MIR169P AGCCAAGGATGACTTGCCG 16 ____ N _LIBgBvBm MIR403B TTAGATTCACGCACAAACTCG 0 ____ N RLIBgBvBm
MIR169Q AGCCAAGGATGACTTGCCG 16 ____ N _LIBgBvBm MIR403C TTAGATTCACGCACAAACTCG 0 ___C N RLI*BgBvBm*
MIR169E TAGCCAAGGATGACTTGCCTG 8 L___ N _LIBgBvBm MIR403D TTAGATTCACGCACAAACTCG 0 ____ N RLIBgBvBm
MIR169F CAGCCAAGGATGACTTGCCGA 317 ___C N _LIBgBvBm* MIR403E TTAGATTCACGCACAAACTCG 0 ____ N RLIBgBvBm
MIR169G CAGCCAAGGATGACTTGCCGA 317 _S__ N _LIBgBvBm MIR403F TTAGATTCACGCACAAACTCG 0 _SRC N RLIBgBvBm
MIR169R TGAGTCAAGGATGACTTGCCG 0 ____ N _LI*BgBv*Bm* MIR408 TGCACTGCCTCTTCCCTGGC 131 LSRC Y RLIBgBvBm
MIR169T TGAGTCAAGGATGACTTGCCG 0 ____ N _L*I*Bg*Bv*Bm* MIR477A ATCTCCCTCAAAGGCTTCCAA 0 ____ N ___BgBvBm
MIR169U TGAGTCAAGGATGACTTGCCG 0 ____ N _L*I*Bg*Bv*Bm* MIR479 TGTGGTATTGGTTCGGCTCATC 2 ____ N ______
MIR169V AAGCCAAGGATGAATTGCCGG 0 ____ N __IBg__ MIR482 CCTACTCCTCCCATTCC 0 LSRC Y ______
MIR169X TAGCCAAGGATGACTTGCCTA 1 ____ Y _LIBgBvBm MIR535A TGACAACGAGAGAGAGCACGCT 0 ____ Y RLIBgBvBm
MIR169Y TAGCGAAGGATGACTTGCCTA 0 ____ N __I___ MIR535B TGACAACGAGAGAGAGCACGCT 0 ____ Y RLIBgBvBm
MIR169I GAGCCAAGGATGACTGGCCGT 0 ____ N _L_Bg__ MIR535C TGACAACGAGAGAGAGCACGCT 0 ____ Y RLI*BgBv*Bm
MIR169D CAGCCAAGAATGATTTGCCGG 0 ____ N ______ MIR535D TGACAACGAGAGAGAGCACGCT 0 ____ Y RLIBgBvBm
MIR171B TGATTGAGCCGCGTCAATATC 0 ____ N R_____ MIR535E TGACAACGAGAGAGAGCACGCT 0 ____ Y RLIBgBvBm
MIR171C TGATTGAGCCGTGCCAATATC 637 ____ N RLIBg__ MIR828A TCTTGCTCAAATGAGTATTCCA 0 ____ N ______
MIR171D TGATTGAGCCGTGCCAATATC 637 ____ N RLIBg__ MIR828B TCTTGCTCAAATGAGTGTTCCA 0 ____ N ______
MIR171A TGATTGAGCCGTGCCAATATC 637 _SRC Y RLIBg__ MIR845A TAGCTCTGATACCAATTGATA 0 ____ N ______
MIR171I TGATTGAGCCGTGCCAATATC 637 ____ N RLIBg__ MIR845B TAGCTCTGATACCAATTGATA 0 ____ N ______
MIR171E TGATTGAGCCGCGCCAATATC 53 ___C N RLI*BgBv*Bm* MIR845C AGGCTCTGATACCAATTGATG 0 ____ N ______
MIR171H TGGTTGAGCCGCGCCAATATC 0 ____ N RLIBgBvBm MIR845D TGGCTCTGATACCAATTGATGG 0 ____ N ______
MIR171F TTGAGCCGCGCCAATATCACT 0 _S__ N RLIBgBv_ MIR845E TGGCTCTGATACCAATTGATGG 0 ____ N ______
  1. For each predicted pre-miRNA the table reports: the mature sequence, the number of perfect matching short RNA reads observed in leaf (column A), tissues in which significant expression of the precursor was observed by Illumina whole transcriptome sequencing (column B, where L = leaf, R = root, S = stem, C = callus), the presence of 454 reads including the precursor sequence in leaf (column C, where Y = yes, N = no), and tissues where the Combimatrix oligoarray showed significant expression of the mature sequence (column D, where L = leaf, I = inflorescence, R = root, Bg = immature berry, Bv = veraison, Bm = mature berry). Asterisks indicate signal detected for precursor in that tissue. Mature miRNAs are ordered to reflect expected cases of crosshybridization for oligonucleotide arrays. For all microRNAs, chromosome, strand and coordinates of the precursor miRNA are provided (scaffold coordinates indicate that the miRNA was situated on a scaffold not incorporated into the 8.4× genome assembly).