Skip to main content

Advertisement

Table 1 The locations of 24 miRNAs downstream of Alu elements in the human genome.

From: Alu-directed transcriptional regulation of some novel miRNAs

Id-Alu Chr Strand Seq
Intergenic    
AluSx-11437 chr1 + CTACTCGGGAGGCTGAGGCAGGA
AluSq/x-173806 chr2 + AGGTCAGGAGTTTGAGACCA
AluSg/x-1110454* chr19 + ATCGTGCATCCCTTTAGAGTGTT
AluSx-138854 chr2 - CCAGGAGGTGGAGGTTGCAGT
AluSc-1117364 chr20 + GGTGGATCACGAGGTCAGGAG
AluY-346134 chr5 - GCCACTGCACTCCAGCCTGG
anti-intron    
AluJo-118885 chr2 - ACGCCTGTAATCCCAGCACTTT
AluSp-1004023 chr17 + AGGCTGAGGTGGGAGGAT
AluSg-1022676 chr17 + AGGTCAGGAGTTTGAGACCAGCCTGGCCAA
AluJo-135090 chr2 - CCAGGAGGTGGAGGTTGCAGTG
AluSx-13507 chr1 - CGAGACTAGCCTGGCCAACATGGTG
AluJo-576611 chr9 + CTGCACTCCAGCCTGGGCA
AluSx-3296 chr1 - GCCACTGCACTCCAGCCTGG
FLAM_C-1110015 chr19 - TCAGGAGTTTGAGACCAGC
intron    
AluJb-641 chr1 + AGGCCTGTAATCCCAGCATTTT
AluSx-966613 chr16 - AGGTGGAGGTTGCAGTGAG
AluSc-109651 chr2 - ATGCCTGTAATCCCAGCACTTT
AluY-468716 chr7 + CAGGAGGTGGAGGTTGCAGTGAGC
AluY-1159909 chr22 - CCAGGAGGTGGAGGTTGCAGTG
AluSg-433754 chr7 + CTTGAACCCAGGAGGCGGA
AluSg-974039 chr16 + CTTTGGGAGGCTGAGGTGGG
AluSq/x-374792 chr6 - GAGGTCAGGAGTTCGAGACT
AluJo-512070 chr8 + GGAGGCCAAGGTGGGAGGAT
AluY-583205 chr9 - TACTCGGGAGGCTGAGGCAGGAGAA
  1. The sequences given represent the most abundant and longest miRNA sequences identified by high-throughput solexa sequencing. Asterisk indicates that the pre-miRNA can produce two mature miRNAs. The sequence of another miRNA is: CCCTCTAGATGGAAGCACTGTC.