Skip to main content

Advertisement

Table 2 Oligonucleotides used for Northern blotting

From: Alu-directed transcriptional regulation of some novel miRNAs

Name Sequence 5'->3' Position
Alu GCGATCTCGGCTCACTGCAAG 238-218
5SrRNA AAAGCCTACAGCACCCGGTATT 120-99
ATAD3B-sen GGATTCCGTGCCTTTGTGA 807-825
ATAD3B-anti TTGGTGTTCCTGGTTGCTA 1099-1117
AluJb-641 AAAATGCTGGGATTACAGGCCT  
AluJo-576611 TGCCCAGGCTGGAGTGCAGT  
AluJo-135090 CACTGCAACCTCCACCTCCTGG  
Let-7a AACTATACAACCTACTACCTCA