Skip to main content

Table 1 The primer sequences used for the validation of differentially expressed genes by PTTG overexpression through qRT-PCR.

From: Effect of PTTG on endogenous gene expression in HEK 293 cells

S. No Gene name Forward Primer Reverse primer
1 PTTG 5' gccttagatgggagatctca 3' 5' gctttaacagtcttctcagt 3'
2 v-jun 5' gcgtgcgctcttagagaaac 3' 5' ccgttgctggactggattat 3'
3 v-maf 5' cccgaccgaacagaagac 3' 5' gcttggtgatgatggtgatg 3'
4 H2be 5' ccgcaaagagagctactcca 3' 5' ggagctggtgtacttggtga 3'
5 H1c 5' agcgtagcggagtttctctg 3' 5' tagcgctcttcttcggagtt 3'
6 H2bo 5' gcagccgcaaagagacttac 3' 5' tggagctggtgtacttggtg 3'
7 H2ac 5' agaagaacaacagccgcatc 3' 5' gcttcttcgccttctttgg 3'