Skip to main content
Figure 5 | BMC Genomics

Figure 5

From: Temperature Switch PCR (TSP): Robust assay design for reliable amplification and genotyping of SNPs

Figure 5

Real-time PCR showing biphasic amplification in TSP assays. Reactions were performed under TSP cycling conditions using A. 0.1 μM of LS primer pair only (forward 5'-CTACTGGAAGGCCGGCAAGC and reverse 5'-CGCATAAACCTCAACATCTGAGCA), B. 0.5 μM of NLS primer pair only (forward 5'-GCG TTAAGCATACAGTTTTAGTA and reverse 5'-GGG CCTGAAACCAACC). Underlined sequence indicates the non-complementary 5'-tail region. C. 0.1 μM of LS primer pair and 0.5 μM of NLS primer pair, and D. negative control reaction with 0.1 μM of LS primer pair and 0.5 μM of NLS primer pair without genomic DNA template.

Back to article page