Skip to main content

Table 2 RT-PCR primers

From: Proteomic identification of differentially expressed and phosphorylated proteins in epidermis involved in larval-pupal metamorphosis of Helicoverpa armigera

Primer name Forward primer Reverse primer
Hexamerin aggagcaacctctcgcagaaag tgacgggaagacttcaggaag
Calponin ccagactattgatttgtgggaga cgttcttgtcagcctctttgg
Arylphorin subunit aacaagattgagcgcaagtcc ctaggcatgttgtcgggcac
60 S acidic ribosomal protein P0 caaggaggctaccaccatca cccatgtcgtcgtcgctct
Aldehyde dehydrogenase cgccctggtcaaggaagc ggagccggtgaaagcaact
Eukaryotic translation initiation factor 4A ctggcatcaggtcgtggaaa tgcaaggcataatagcgcgt
ATP synthase beta subunit gcccgtggtgtccagaag gggcacgagccacagtcag
Proteasome 3 alpha subunit tctgcgagggaaggatggt catcggaaatgagacctgctact
Broad atggctgatcaattctgttta gttcggtgaagagaaattttc
β-actin cctggtattgctgacggtatgc ctgttggatggtggagagggaa