Conservation of DNA-binding specificity and oligomerisation properties within the p53 family

BMC Genomics

Table 1 DNA-binding parameters of p53 orthologs and paralogs.

Protein^a	logK_d(direct) GGACATGTCC^b,c	logK_dRef (competition)^d	Tightest binder logK_d^e	Consensus sequence using a ΔlogK_d cut-off of 0.1 and 0.2 ^f	Bit Score ^g
Dmp53	-7.28 ± 0.03	-7.56	GA ACATGTCC -7.58	NRACATGTMB NDACRTGTHN	10.3
Drp53	-7.20 ± 0.03	-7.42	GGG CATGC CC -7.59	RRRCATGCCY VRRCATGYCB	13.1
Hsp53	-7.25 ± 0.03	-7.12	A GACATGTCC -7.14	RRRCWTGYCY NDRCWWGYCY	8.8
Mmp53	-7.02 ± 0.04	-6.88	GGACATGC CC -6.94	VRRCWTGYYY NDRCWWGYYN	6.2
Xlp53	-7.32 ± 0.02	-7.08	A GACATGTCC -7.13	VRRCATGYCY NDRCWWGYCY	10.9
ΔNp63α	-7.12 ± 0.01 (4)	-7.21	A GG CATGTCC -7.37	NDRCDWGYCH NNRCDDGYHN	7.2
ΔNp63β	-7.13 ± 0.04 (6)	-7.45	GGG CATGTCC -7.46	NRRCATGTCY NRRCRWGYCN	12.0
ΔNp63γ	-7.17 ± 0.02	-7.48	GGACATGTCC -7.48	NRRCATGTCB NRRCRWGYCN	12.7
ΔNp73β	-7.26 ± 0.02	-7.62	C GG CATGTCT -7.89	VRGCATGYCY NRGCAWGYCB	14.5
p73CT	-6.62 ± 0.04 (6)	-6.83	GGG CATGTCC -7.03	NRGCATGYCY NRRCAWGYCN	13.2

^aFull-length proteins of p53 (Dm = Drosophila melanogaster, Dr = Danio rerio, Hs = Homo sapiens, Mm = Mus musculus, Xl = Xenopus laevis) and naturally occurring isoforms of human p63 and p73 were used. By contrast, p73CT is not naturally occurring and comprises p73 residues 104-383.
^bDouble stranded labelled reporter DNA (Alexa488-GGACATGTCCGGACATGTCCf)
^cEach direct titration experiment was repeated 16 times, if not otherwise indicated after the standard deviation (SD) in brackets
^dDouble stranded unlabelled reference DNA GGACATGTCCGGACATGTCC
^eDeviations from the reference sequence are shown in bold letters
^fN = any nucleotide, D = A, G or T; R = G or A; M = A or C; B=G, C or T; H = A, C or T; W= A or T; Y = C or T; V = A, C or G
^gFor bit score explanation see figure 4.

ISSN: 1471-2164