Skip to main content

Table 5 Putative new microRNAs

From: MicroRNA and tasiRNA diversity in mature pollen of Arabidopsis thaliana

sRNA Sequence Target Accession Cleavage
ath-MIR2933a GAAATCGGAGAGGAAATTCGCC CPUORF AT5G09460 Not tested
ath-MIR2933b GAAATCGGAGAGGAAATTCGCC CPUORF AT5G09460 Not tested
ath-MIR2934 TCTTTCTGCAAACGCCTTGGA SUVH6 AT2G22740 No
ath-MIR2935 TGGAATCACACGGTCGTCATTC YUC11 AT1G21430 No
ath-MIR2936 CTTGAGAGAGAGAACACAGACG TIF AT1G76720 No
ath-MIR2937 ATAAGAGCTGTTGAAGGAGTC ASML2 AT3G12890 No
ath-MIR2938 GATCTTTTGAGAGGGTTCCAG HSFA7B AT3G63350 No
ath-MIR2939 TAACGCACAACACTAAGCCAT F-Box AT3G19890 Yes
  1. 7 candidate sequences capable of forming hairpin structures identified by miRCat software. Target sequences are shown, and cleavage was tested for 5 of the 7 sequences using 5' RACE-PCR.