Figure 4From: Analysis of small nucleolar RNAs reveals unique genetic features in malaria parasitesLocalization of snoRNA. Reverse transcriptase PCR assays showing A) cluster of PFS11 and PFS12 (using forward primer against PFS11 and reverse against PFS12; the primers sequences are ATGATGACTGAATAAATAATATG and TCAGATATAAAATTTATCTTCAC respectively) and B) Localization of PFS9 in 3' UTR of protein coding gene; P is the positive control containing genomic DNA as template, D is a negative control that lacks a template, C is a negative control containing cDNA generated using DNA polymerase and R is the reaction which contains cDNA generated using reverse transcriptase enzyme; L is the 100 bp ladder from Fermentas. C) Sequence of an EST from P. vivax. PVS11 and PVS12 are shown within a box in the figure. D) Localization of PVS9 in the mRNA, Sequence of two overlapping EST are identical with snoRNA at its 3' end and protein coding sequence at 5' region.Back to article page