Skip to main content

Table 1 miR-206 sequence variation

From: MicroRNA transcriptome profiles during swine skeletal muscle development

Sequence Quantity observed
UGGAAUGUAAGGAAGUGUGUGA 2286
UGGAAUGUAAGGAAGUGUGUGAA 79
UGGAAUGUAAGGAAGUGUGUGU 78
UGGAAUGUAAGGAAGUGUGU 41
UGGAAUGUAAGGAAGUGUGUGAU 34
UGGAAUGUAAGGAAGUGUGUGA 15
UGGAAUGUAAGGAAGUGUGUG 13
UGGAAUGUAAGGAAGUGUGU 9
UGGAAUGUAAGGAAGUGUGUGG 8
CGGAAUGUAAGGAAGUGUGUGA 7
  1. Mir-206 differed in length or sequence at the 5' and 3' ends. MiR-206 sequences of this type were clustered into a single miR sequence identified as the predominant sequence. Mir-206 sequences with the greatest observations are listed.