Skip to main content

Table 2 Novel porcine miR

From: MicroRNA transcriptome profiles during swine skeletal muscle development

Temporary identifiers Sequence
PN1 CCGCAGGUGCGGCCACUUGUUU
PN2 GUGUUGGUGUGCACUUAUUU
PN3 CGAACCGAAUCCCUCACUAAA
PN4 AGGGGAGUGGUGGGGGGAG
PN5 CGAACCGAACUCCUCACUAAA
PN6 AGGGUUGGGCGGAGGCUUUCC
PN7 CCACGAGGAGGAGACGCAGUG
PN8 UGGCACAGGGUCCAGCUGUCGGC
PN9 GGGGUGGGGGUCUGGGGGGUGU
PN10 GAGAGAUCAGAGGCGCAGAGU
PN11 GUGUGGGACGGUGGGGUGGGUU
PN12 GUCGGGGAGGUUCCAGCUCUCAUUU
  1. Twelve novel miR were detected that were not closely related to previously reported miR in the database. The miR were given temporary identifiers PN (porcine new) 1 to PN12.