Skip to main content

Table 1 Overgo and primer sequences

From: A bacterial artificial chromosome library for the Australian saltwater crocodile (Crocodylus porosus) and its utilization in gene isolation and genome characterization

Name Description Sequence
CMOF C-mos overgo, forward TGGAGGATGGCTTATCTCTGAG
CMOR C-mos overgo, reverse GGCAAATATTGGGGCTCAGAGA
CR1aOF CR1a overgo, forward AGCGGAGGTGGTTCAAGCACCT
CR1aOR CR1a overgo, reverse AAGGTGTTCAATGTAGGTGCTT
CR1bOF CR1b overgo, forward AATAGGTCCAAGGAGGTGATAC
CR1bOR CR1b overgo, reverse CCGATAGAGGGGAAGTATCACC
CMF1 C-mos forward primer1 ATCACGGCAGAGCTTCTGGG
CMR1 C-mos reverse primer1 TGGCAAATATTGGGGCTCAG
CMF2 C-mos forward primer 2 GTTGTGCAAGATCGGAGACT
CMR2 C-mos reverse primer 2 GACGTAACTGGGCTACATTC