Skip to main content

Table 2 G4 and pTTSs overlapping in the MYC promoter and MYC intragenic regions pTTSs overlapped with G4s are in bold type.

From: TTS Mapping: integrative WEB tool for analysis of triplex formation target DNA Sequences, G-quadruplets and non-protein coding regulatory DNA elements in the human genome

G4 ID Sequence Chr Start End Strand TSS ID
Quad-8-CCC-5773 CCCCACCTTCCCC ACCCTCCCCACCCTCCCC ATAAGCGCCCCTCCCGGGTTCCC Chr8 128817351 128817404 - TSS15008128817345
TSS15008128817365
Quad-8-CCC-5771 CCCCCTGCCCCTCCC ATATTCTCCC Chr8 128816440 128816464 - TSS15008128816440