Skip to main content

Advertisement

Table 1 miRNAs identified in Ae. albopictus C7/10 cells and predicted in Ae. aegypti.

From: Identification of microRNAs expressed in two mosquito vectors, Aedes albopictus and Culex quinquefasciatus

C710 # miRNA # miRNA* Sequence Length aga ame dme Ae. aegypti Start End Strand
184 1487481 0 UGGACGGAGAACUGAUAAGGGC 22 Y Y Y 1.496 143378 143399 Minus
275 23841 78 UCAGGUACCUGAAGUAGCGC 20 Y Y Y 1.24 486591 486610 Plus
277 4453 7 UAAAUGCACUAUCUGGUACGAC 22 Y Y Y 1.265 508860 508881 Plus
9 4085 602 UCUUUGGUAUUCUAGCUGUAGA 22 Y Y Y 1.785 186231 186252 Plus
8-3p 3002 - UAAUACUGUCAGGUAAAGAUGUC 23 Y Y Y 1.411 876091 876113 Plus
252.1 1608 13 UAAGUACUAGUGCCGCAGGAG 21 Y Y Y 1.56 1580060 1580080 Minus
bantam-5p 1384 - CCGGUUUUCAUUUUCGAUCUGAC 23 Y Y Y 1.49 157893 157915 Minus
71 1246 17 AGAAAGACAUGGGUAGUGAGAU 22 ? Y ? 1.268 889428 889449 Minus
8-5p 1244 - CAUCUUACCGGGCAGCAUUAGA 22 Y Y Y 1.411 876052 876073 Plus
276-1 1209 4 UAGGAACUUCAUACCGUGCUC 21 Y Y Y 1.5 2769510 2769530 Minus
276-2 - - UAGGAACUUCAUACCGUGCUC 21 Y Y Y 1.134 39026 39046 Plus
317-1 1118 0 UGAACACAGCUGGUGGUAUCU 21 Y Y Y 1.265 429503 429523 Plus
317-2 - - UGAACACAGCUGGUGGUAUCU 21 Y Y Y 1.153 2154717 2154737 Minus
283 947 0 CAAUAUCAGCUGGUAAUUCUGGGC 24 Y Y Y 1.68 2729393 2729416 Minus
252.2 888 - CUAAGUACUAGUGCCGCAGGAG 22 Y Y Y 1.56 1580060 1580081 Minus
let-7 650 0 UGAGGUAGUUGGUUGUAUAGU 21 Y Y Y 1.43 1156331 1156351 Plus
2 708 1 UAUCACAGCCAGCUUUGAAGAGC 23 Y Y Y 1.268 888597 888619 Minus
998 561 0 UAGCACCAUGAGAUUCAGC 19 ? ? Y 1.744 322338 322356 Plus
92b 530 0 AAUUGCACUUGUCCCGGCCUG 21 Y Y Y 1.116 1319201 1319221 Plus
1889-3p 478 - CACGUUACAGAUUGGGGUUUCC 22 Y ? ? 1.68 2720796 2720817 Minus
bantam-3p 475 - UGAGAUCAUUUUGAAAGCUGAU 22 Y Y Y 1.49 1579555 1579576 Minus
306 454 81 UCAGGUACUGAGUGACUCUCAG 22 Y ? Y 1.785 213078 213099 Plus
281 398 1 AAGAGAGCUAUCCGUCGAC 19 Y Y Y 1.957 134462 134480 Plus
1889-5p 378 - UAAUCUCAAAUUGUAACAGUGG 22 Y ? ? 1.68 2720896 2720917 Minus
980 309 6 UAGCUGCCUAGUGAAGGGC 19 ? ? Y 1.23 1043069 1043087 Plus
278 286 53 ACGGACGAUAGUCUUCAGCGGCC 23 Y Y Y 1.16 3596269 3596291 Plus
989 242 0 UGUGAUGUGACGUAGUGGUAC 21 Y ? Y 1.115 804187 804207 Minus
14 247 0 UCAGUCUUUUUCUCUCUCCUAU 22 Y Y Y 1.249 1089019 1089040 Minus
11 222 31 CAUCACAGUCUGAGUUCUUGCU 22 Y ? Y 1.744 322062 322083 Plus
190 210 0 AGAUAUGUUUGAUAUUCUUGGUUG 24 Y Y Y 1.195 82254 82277 Minus
1 169 0 UGGAAUGUAAAGAAGUAUGGAG 22 Y Y Y 1.812 291373 291394 Plus
34 147 1 UGGCAGUGUGGUUAGCUGGUUG 22 Y ? Y 1.265 509536 509557 Plus
1890 123 0 UGAAAUCUUUGAUUAGGUCUGG 22 Y ? ? 1.204 1733356 1733377 Plus
988 118 24 CCCCUUGUUGCAAACCUCACGC 22 Y ? Y 1.442 623057 623078 Minus
957 99 0 UGAAACCGUCCAAAACUGAGGC 22 Y ? Y 1.7 464339 464360 Plus
305 96 4 AUUGUACUUCAUCAGGUGCUCUGG 24 Y Y Y 1.24 495601 495624 Plus
996 88 0 UGACUAGAUUACAUGCUCGUC 21 Y Y Y 1.437 567507 567527 Minus
87 79 0 GUGAGCAAAUUUUCAGGUGUGU 22 Y Y Y 1.36 1010846 1010867 Plus
12 68 3 UGAGUAUUACAUCAGGUACUGGU 23 Y Y Y 1.68 2720468 2720490 Minus
13 57 1 UAUCACAGCCAUUUUGACGAGUU 23 Y Y Y 1.268 888744 888766 Minus
92a 44 0 UAUUGCACUUGUCCCGGCC 19 Y Y Y 1.116 1267254 1267272 Plus
33 40 0 GUGCAUUGUAGUUGCAUUGCA 21 ? Y Y 1.487 351656 351676 Plus
279 36 2 UGACUAGAUCCACACUCAUUAA 22 Y Y Y 1.437 572258 572279 Minus
79 33 6 GCUUUGGCGCUUUAGCUGUAUGA 23 Y Y Y 1.785 213277 213299 Plus
263 32 0 AAUGGCACUGGAAGAAUUCACGG 23 Y Y Y 1.981 164999 165021 Minus
7 32 0 UGGAAGACUAGUGAUUUUGUUGU 23 Y Y Y 1.1359 46041 46063 Plus
**2945 32 0 UGACUAGAGGCAGACUCGUUUA 22 Y ? ? 1.43 481083 481105 Plus
100-5p 30 - AACCCGUAGAUCCGAACUUGUG 22 Y Y Y 1.43 1142184 1142205 Plus
100-3p 25 - CAAGAACGGAUGUAUGGGAUUC 22 Y Y Y 1.43 1142224 1142245 Plus
970 21 0 UCAUAAGACACACGCGGCUAU 21 Y ? Y 1.229 1045875 1045895 Plus
210.1 13 0 CUUGUGCGUGUGACAACGG 19 Y Y Y 1.512 515650 515668 Plus
999 14 0 UGUUAACUGUAAGACUGUGUCU 22 ? ? Y 1.100. 2315145 2315166 Plus
308 16 4 CGCGGUAUAUUCUUGUGGCUUG 22 Y ? Y 1.107 508980 509001 Plus
125 7 3 UCCCUGAGACCCUAACUUGUGA 22 Y Y Y 1.43 1156615 1156636 Plus
210.2 6 0 UUGUGCGUGUGACAACGGCUAU 22 Y Y Y 1.512 515646 515667 Plus
307 6 0 CACAACCUCCUUGAGUGAGCGA 22 Y ? Y 1.16 1859430 1859451 Minus
1000-1 6 0 AUAUUGUCCUGUCACAGCAGU 21 Y Y Y 1.187 325478 325498 Plus
1000-2 - - AUAUUGUCCUGUCACAGCAGU 21 Y Y Y 1.3798 224 244 Minus
375 4 0 UUUGUUCGUUUGGCUCGAGUUA 22 Y Y Y 1.309 1318752 1318773 Minus
309-1 4 - UCACUGGGCAAAGUUUGUCGCA 22 Y ? Y 1.15 907938 907959 Plus
309-2 - - UCACUGGGCAAAGUUUGUCGCA 22 Y ? Y 1.602 94088 94109 Plus
932 3 - UGCAAGCAAUGUGGAAGUGAAG 22 ? Y Y 1.1064 154192 154213 Minus
315 2 0 UUUUGAUUGUUGCUCAGAAAGC 22 Y Y Y 1.612 104143 104164 Plus
927 1 0 CAAAGCGUUUGGAUUCUGAAAC 22 Y Y Y 1.26 2065461 2065482 Plus
**2943 1 0 UUAAGUAGGCACUUGCAGGC 20 Y ? ? 1.348 212450 212470 Plus
1891-1 predicted   UGAGGAGUUAAUUUGCGUGUUU 22 Y ? ? 1.199 1109750 1109771 Minus
1891-2 predicted   UGAGGAGUUAAUUUGCGUGUUU 22 Y ? ? 1.466 72802 72823 Plus
1175 predicted   AAGUGGAGUAGUGGUCUCAUCG 22 Y ? ? 1.125 1648037 1648058 Plus
1174 predicted   UCAGAUCUACUUAAUACCCAU 21 Y ? ? 1.125 1647921 1647941 Plus
993 predicted   UACCCUGUAGUUCCGGGCUUUU 22 Y Y Y 1.056 256798 256819 Plus
981 predicted   UUCGUUGUCGACGAAACCUGCA 22 Y Y Y 1.127 638380 638401 Minus
965 predicted   UAAGCGUAUAGCUUUUCCCAUU 22 Y ? Y 1.51 2008701 2008722 Plus
316 predicted   UGUCUUUUUCCGCUUACUGCCG 22 ? Y Y 1.289 891327 891348 Minus
285 predicted   UAGCACCAUUCGAAAUCAGUAC 22 ? ? Y 1.26 3339153 3339174 Minus
137-1 predicted   UAUUGCUUGAGAAUACACGUAG 22 Y Y Y 1.1191 97844 97865 Plus
137-2 predicted   UAUUGCUUGAGAAUACACGUAG 22 Y Y Y 1.137 260684 260705 Minus
133 predicted   UUGGUCCCCUUCAACCAGCUGU 22 Y Y Y 1.778 350306 350327 Minus
124 predicted   UAAGGCACGCGGUGAAUGC 19 Y Y Y 1.6 1664623 1664641 Minus
31 predicted   UGGCAAGAUGUUGGCAUAGCUGA 23 ? Y Y 1.636 483257 483279 Minus
10 predicted   ACCCUGUAGAUCCGAAUUUGUU 22 Y Y Y 1.44 813557 813578 Plus
iab-4-1 predicted   ACGUAUACUGAAUGUAUCCUGA 22 Y Y Y 1.708 50265 50286 Plus
iab-4-2 predicted   ACGUAUACUGAAUGUAUCCUGA 22 Y Y Y 1.423 763526 763547 Minus
2940 125253 4125 UGGUUUAUCUUAUCUGUCGAGGC 23 ? ? ? 1.222 643960 643982 Plus
2765 1162 0 UGGUAACUCCACCACCGUUGGC 22 Y ? ? 1.11 5248310 5248331 Plus
2951 1136 28 AAGAGCUCAGUACGCAGGGG 20 ? ? ? multiple    
2941-1 9 0 UAGUACGGCUAGAACUCCACGG 22 ? ? ? 1.385 413147 413168 Minus
2941-2 - - UAGUACGGCUAGAACUCCACGG 22 ? ? ? 1.385 413451 413472 Minus
  1. aga = An. gambiae; ame = Ap. mellifera; dme = D. melanogaster.
  2. Top group: miRNAs and miRNA* strands identified by deep sequencing
  3. Middle group: predicted miRNAs identified in Cx. quinquefasciatus but absent from C7/10 cells were cross-referenced with the Ae. aegypti (AaegL1)
  4. Bottom group: novel miRNAs identified in this study. miR-2765 (not present in miRBase v14) has recently been identified in Bombyx mori.
  5. ** novel miRNAs (not present in miRBase v14) recently identified in Ae. aegypti mosquitoes while this manuscript was under review