Skip to main content

Advertisement

Table 2 miRNAs identified in Cx. quinquefasciatus adult female mosquitoes.

From: Identification of microRNAs expressed in two mosquito vectors, Aedes albopictus and Culex quinquefasciatus

Culex # miRNA # miRNA* Sequence Length aga ame dme supercontig Start End Strand
184 107190 0 UGGACGGAGAACUGAUAAGGGC 22 Y Y Y 3.567 240312 240333 Minus
317-1 71313 2 UGAACACAGCUGGUGGUAUCU 21 Y Y Y 3.36 1133209 1133229 Plus
317-2 - - UGAACACAGCUGGUGGUAUCU 21 Y Y Y 3.36 1134875 1134895 Plus
277 58628 0 UAAAUGCACUAUCUGGUACGAC 22 Y Y Y 3.36 1153785 1153806 Plus
1 36084 0 UGGAAUGUAAAGAAGUAUGGAG 22 Y Y Y 3.78 246250 246271 Plus
989 23667 0 UGUGAUGUGACGUAGUGGUAC 21 Y ? Y 3.315 321364 321384 Plus
275 13910 2 UCAGGUACCUGAAGUAGCGC 20 Y Y Y 3.291 329815 329834 Plus
957 11682 0 UGAAACCGUCCAAAACUGAGGC 22 Y ? Y 3.787 29593 29614 Plus
8-3p 10950 - UAAUACUGUCAGGUAAAGAUGU 22 Y Y Y 3.40 815865 815886 Minus
281 9322 95 AAGAGAGCUAUCCGUCGACAGU 22 Y Y Y 3.64 99744 99765 Plus
Let-7 9266 5 UGAGGUAGUUGGUUGUAUAGU 21 Y Y Y 3.4 280610 280630 Plus
34 6301 3 UGGCAGUGUGGUUAGCUGGUU 21 Y Y Y 3.36 1154478 1154498 Plus
263 3749 2 AAUGGCACUGGAAGAAUUCACGG 23 Y Y Y 3.219 351848 351870 Minus
252-1 3157 2 (C)UAAGUACUAGUGCCGCAGGAG 21 Y Y Y 3.1787 6836 6856 Minus
252-2 - - (C)UAAGUACUAGUGCCGCAGGAG 21 Y Y Y 3.975 115594 115614 Plus
87 2364 0 GUGAGCAAAUUUUCAGGUGUGU 22 Y Y Y 3.431 379788 379809 Plus
71 2232 14 AGAAAGACAUGGGUAGUGAGAU 22 ? Y ? 3.366 117552 117573 Minus
bantam-5p 1459 - CCGGUUUUCAUUUUCGAUCUGAC 21 Y Y Y 3.65 199737 199759 Minus
9 1138 440 UCUUUGGUAUUCUAGCUGUAGA 22 Y Y Y 3.83 64733 64754 Plus
11 888 5 CAUCACAGUCUGAGUUCUUGCU 22 Y ? Y 3.153 639669 639690 Minus
276-1 860 2 UAGGAACUUCAUACCGUGCUCU 22 Y Y Y 3.136 340911 340932 Plus
276-2 - - UAGGAACUUCAUACCGUGCUCU 22 Y Y Y 3.136 541192 541213 Plus
276-3 - - UAGGAACUUCAUACCGUGCUCU 22 Y Y Y 3.2457 930 951 Plus
210.1 720 5 UUGUGCGUGUGACAACGGCUAU 22 Y Y Y 3.549 157657 157678 Minus
927 703 21 CAAAGCGUUUGGAUUCUGAAAC 22 Y Y Y 3.11 560282 560302 Plus
bantam-3p 689 - UGAGAUCAUUUUGAAAGCUGA 21 Y Y Y 3.65 199698 199718 Minus
8-5p 594 - CAUCUUACCGGGCAGCAUUAGA 22 Y Y Y 3.40 815904 815925 Minus
2 547 2 UAUCACAGCCAGCUUUGAAGAGC 23 Y Y Y 3.366 116861 116883 Minus
998 434 0 UAGCACCAUGAGAUUCAGC 19 ? ? Y 3.153 639527 639545 Minus
210.2 405 - CUUGUGCGUGUGACAACGGCUAU 23 Y Y Y 3.549 157657 157679 Minus
14 358 0 UCAGUCUUUUUCUCUCUCCUAU 22 Y Y Y 3.676 52251 52272 Minus
285 324 5 UAGCACCAUUCGAAAUCAGUAC 22 ? ? Y 3.98 262290 262311 Minus
1890 287 0 UGAAAUCUUUGAUUAGGUCUGG 22 Y ? ? 3.64 982786 982807 Minus
190-1 231 0 AGAUAUGUUUGAUAUUCUUGGUUG 24 Y Y Y 3.181 347953 347976 Minus
190-2 - - AGAUAUGUUUGAUAUUCUUGGUUG 24 Y Y Y 3.351 105098 105121 Minus
283 224 0 CAAUAUCAGCUGGUAAUUCUGGG 23 Y Y Y 3.57 559462 559484 Plus
7 192 0 UGGAAGACUAGUGAUUUUGUUGU 23 Y Y Y 3.1 3357390 3357412 Minus
100 170 43 AACCCGUAGAUCCGAACUUGUG 22 Y Y Y 3.4 271414 271435 Plus
1891 167 1 UGAGGAGUUAAUUUGCGUGUUU 22 Y ? ? 3.829 180383 180404 Minus
999 165 0 UGUUAACUGUAAGACUGUGUCU 22 ? ? Y 3.14 96917 96938 Plus
309 33 1 UCACUGGGCAUAGUUUGUCGCAU 23 Y ? Y 3.145 66041 66063 Minus
375 144 0 UUUGUUCGUUUGGCUCGAGUUAC 23 Y Y Y 3.455 42584 42605 Plus
306 143 65 UCAGGUACUGAGUGACUCUCAG 22 Y ? Y 3.83 80436 80457 Plus
125 140 7 UCCCUGAGACCCUAACUUGUGA 22 Y Y Y 3.4 280975 280996 Plus
315 131 0 UUUUGAUUGUUGCUCAGAAAGC 22 Y Y Y 3.438 61926 61947 Plus
124 105 0 UAAGGCACGCGGUGAAUGC 19 Y Y Y 3.8 2074772 2074790 Plus
92b 96 0 AAUUGCACUUGUCCCGGCCUG 21 Y Y Y 3.722 164913 164933 Minus
1889-5p 89 - UAAUCUCAAAUUGUAACAGUGG 22 Y ? ? 3.57 562555 562576 Plus
981-1 82 0 UUCGUUGUCGACGAAACCUGCA 22 Y Y Y 3.431 144482 144503 Plus
981-2 - - UUCGUUGUCGACGAAACCUGCA 22 Y Y Y 3.431 151371 151392 Plus
12 80 2 UGAGUAUUACAUCAGGUACUGGU 23 Y Y Y 3.57 563009 563031 Plus
31 76 2 UGGCAAGAUGUUGGCAUAGCUGA 23 ? Y Y 3.559 256577 256599 Minus
10 59 40 CAAAUUCGGUUCUAGAGAGGUUU 23 Y Y Y 3.12 96000 96022 Minus
1174 58 0 CUGGGUAUUUUAGAUCAUCGGC 22 Y ? ? 3.86 865901 865922 Plus
**2945 52 0 UGACUAGAGGCAGACUCGUUU 20 Y ? ? 3.4 184461 184481 Plus
1000 49 0 AUAUUGUCCUGUCACAGCAGU 21 Y Y Y 3.153 102853 102873 Minus
13 37 3 UAUCACAGCCAUUUUGACGAGU 22 Y Y Y 3.366 116994 117015 Minus
996 36 2 UGACUAGAUUACAUGCUCGU 20 Y Y Y 3.19 1437010 1437029 Minus
137 33 0 UAUUGCUUGAGAAUACACGUAG 22 Y Y Y 3.1714 27566 27587 Minus
133 32 0 UUGGUCCCCUUCAACCAGCUGU 22 Y Y Y 3.1189 55748 55769 Plus
1175 35 7 AAGUGGAGUAGUGGUCUCAUCG 22 Y ? ? 3.86 866116 866137 Plus
279 26 21 UGACUAGAUCCACACUCAUUAA 22 Y Y Y 3.19 1441123 1441144 Minus
92a 24 - UAUUGCACUUGUCCCGGCCUAU 22 Y Y Y 3.722 174912 174933 Minus
932-3p 22 - UGCAAGCAAUGUGGAAGUGA 22 ? Y Y 3.261 301413 301432 Minus
970 20 0 UCAUAAGACACACGCGGCUAU 21 Y ? Y 3.495 35970 35990 Plus
316 18 0 UGUCUUUUUCCGCUUACUGCCG 22 ? Y Y 3.496 152508 152529 Minus
305 17 1 AUUGUACUUCAUCAGGUGCUCU 22 Y Y Y 3.291 339134 339155 Plus
**2944a-1 13 1 GAAGGAACUUCUGCUGUGAUC 21 Y ? ? 3.66 328681 328701 Minus
**2944a-2 - - GAAGGAACUUCUGCUGUGAUC 21 Y ? ? 3.145 66240 66260 Minus
988 11 5 CCCUUGUUGCAAACCUCACGC 21 Y ? Y 3.791 14331 14351 Plus
932-5p 11 - UCAAUUCCGUAGUGCAUUGCAG 22 ? Y Y 3.261 301450 301471 Minus
1889-3p 7 - CACGUUACAGAUUGGGGUUUCC 22 Y ? ? 3.57 562642 562663 Plus
993 4 1 UACCCUGUAGUUCCGGGCUUUU 22 Y Y Y 3.12 55487 55508 Plus
278 3 0 UCGGUGGGACUUUCGUCCGUUU 22 Y Y Y 3.16 1026212 1026233 Plus
965 2 0 UAAGCGUAUAGCUUUUCCCAUU 22 Y ? Y 3.48 484177 484198 Plus
Iab-4 2 1 ACGUAUACUGAAUGUAUCCUGA 22 Y Y Y 3.12 681163 681184 Plus
980 2 0 UAGCUGCCUAGUGAAGGGC 19 ? ? Y 3.263 352922 352940 Plus
308 3 1 CGCAGUAUAUUCUUGUGGCUUG 22 Y ? Y 3.98 764133 764154 Plus
79 2 0 GCUUUGGCGCUUUAGCUGUAUGA 23 Y Y Y 3.83 80591 80613 Plus
**2943 1 0 UAAGUAGGCACUUGCAGGCAAAG 23 Y ? ? 3.121 94164 94186 Minus
**2944b-1 1 0 GAAGGAACUCCCGGUGUGAUAU 22 Y ? ? 3.66 328838 328859 Minus
**2944b-2 - - GAAGGAACUCCCGGUGUGAUAU 22 Y ? ? 3.145 66389 66410 Minus
33 predicted   GUGCAUUGUAGUUGCAUUGCA 21 ? Y Y 3.1258 69381 69401 Minus
2951 162309 342 AAGAGCUCAGCACGCAGGGGUGGC 24 ? ? ? multiple    
2952 2203 - UAGUACGGCCAUGACUGAGGGC 22 ? ? ? 3.5 753922 753943 Minus
2941-1 1221 3 UAGUACGGCUAGAACUCCACGG 22 ? ? ? 3.5 753643 753664 Minus
2941-2 - 1 UAGUACGGCUAGAACUCCACGG 22 ? ? ? 3.5 753797 753818 Minus
  1. aga = An. gambiae; ame = Ap. mellifera; dme = D. melanogaster.
  2. Top group: miRNAs and miRNA* strands identified by deep sequencing
  3. Middle group: predicted miR-33 was identified in C7/10 cells but absent from Cx. quinquefasciatus. miR-33 was cross-referenced with the Cx. quinquefasciatus genome.
  4. Bottom group: novel miRNAs identified in this study.
  5. ** novel miRNAs (not present in miRBase v14) recently identified in Ae. aegypti mosquitoes while this manuscript was under review