Skip to main content

Table 1 Differentially regulated Zur target genes preceded by candidate Zur-binding sites in C. glutamicum ATCC 13032.

From: The Zur regulon of Corynebacterium glutamicum ATCC 13032

CDS Gene Predicted function 21-bp motif1 Differential gene expression2
     Array RT-PCR
cg0040 - secreted protein - 3.34 4.5
cg0041 znuA2 ABC-type Zn/Mn transporter, substrate-binding protein - 5.68 27900
cg0042 3 znuB2 ABC-type Zn/Mn transporter, permease subunit TAATGATAACGGTTATCATTT 2.25 331
cg0043 znuC2 ABC-type Zn/Mn transporter, ATPase subunit AAATGATAACCGTTATCATTA 2.13 50.2
cg0794 yciC P-loop GTPase of the COG0523 family TATTGAAAATGATTCCCAAAA 2.75 10.5
cg0795 - oxidoreductase TAATGGAAATTGTTTTCAATA 5.43 45500
cg2911 4 znuA1 ABC-type Zn/Mn transporter, substrate-binding protein TGTTGACATCCTTTTTCAATA 3.52 43.8
cg2912 znuC1 ABC-type Zn/Mn transporter, ATPase subunit - 2.79 75.8
cg2913 znuB1 ABC-type Zn/Mn transporter, permease subunit - 1.29 29.0
  1. 1 Genes listed without 21-bp motif (-) belong to predicted operons.
  2. 2 The gene expression in C. glutamicum JS2502 was compared with that of the wild-type strain ATCC 13032. Array, m-values obtained by DNA microarray hybridizations (intensity ratio); RT-PCR, values obtained by RT-PCR (relative expression).
  3. 3 First gene of the putative cg0042-cg0041-cg0040 operon.
  4. 4 First gene of the putative cg2911-cg2912-cg2913 operon.