The Zur regulon of Corynebacterium glutamicum ATCC 13032

BMC Genomics

Table 1 Differentially regulated Zur target genes preceded by candidate Zur-binding sites in C. glutamicum ATCC 13032.

CDS	Gene	Predicted function	21-bp motif¹	Differential gene expression²
				Array	RT-PCR
cg0040	-	secreted protein	-	3.34	4.5
cg0041	znuA2	ABC-type Zn/Mn transporter, substrate-binding protein	-	5.68	27900
cg0042 ³	znuB2	ABC-type Zn/Mn transporter, permease subunit	TAATGATAACGGTTATCATTT	2.25	331
cg0043	znuC2	ABC-type Zn/Mn transporter, ATPase subunit	AAATGATAACCGTTATCATTA	2.13	50.2
cg0794	yciC	P-loop GTPase of the COG0523 family	TATTGAAAATGATTCCCAAAA	2.75	10.5
cg0795	-	oxidoreductase	TAATGGAAATTGTTTTCAATA	5.43	45500
cg2911 ⁴	znuA1	ABC-type Zn/Mn transporter, substrate-binding protein	TGTTGACATCCTTTTTCAATA	3.52	43.8
cg2912	znuC1	ABC-type Zn/Mn transporter, ATPase subunit	-	2.79	75.8
cg2913	znuB1	ABC-type Zn/Mn transporter, permease subunit	-	1.29	29.0

¹ Genes listed without 21-bp motif (-) belong to predicted operons.
² The gene expression in C. glutamicum JS2502 was compared with that of the wild-type strain ATCC 13032. Array, m-values obtained by DNA microarray hybridizations (intensity ratio); RT-PCR, values obtained by RT-PCR (relative expression).
³ First gene of the putative cg0042-cg0041-cg0040 operon.
⁴ First gene of the putative cg2911-cg2912-cg2913 operon.

ISSN: 1471-2164